IL2 receptor dimerization-based reporter gene cell line as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biology, and particularly discloses a reporter gene cell line based on IL2 receptor dimerization as well as a preparation method and application of the reporter gene cell line. The preparation method comprises the following steps: selecting HIL2RB (p.1 to270) and HIL2RG (p.1 to290) as target genes, and respectively connecting the target genes with protein tags SmBiT and LgBiT for artificial synthesis to obtain reporter gene segments; by utilizing EcoRI and BamHI, inserting the reporter gene segment into a lentivirus plasmid empty vector to obtain a recombinant plasmid; transfecting the recombinant plasmid to a lentivirus packaging cell to obtain a recombinant virus; and transferring the recombinant virus into a host cell, and screening to obtain the IL2 receptor dimerization-based reporter gene cell line. By designing and transforming the connection mode of the IL-2 receptor complex and the reporter gene, the reporter gene cell line of the IL-2 receptor complex with a stable structure is constructed, and the reporter gene cell line has important significance on in-vitro research of interaction between IL-2 and an IL-2 receptor, preparation of an antibody from an immune animal or in-vitro screening of the antibody and the like.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and more specifically, to a reporter gene cell line based on IL2 receptor dimerization and a preparation method and application thereof. Background Art

[0002] Interleukins (ILs) are a class of cytokines that were originally found to be expressed by white blood cells. At least 38 types have been discovered so far. Interleukin-2 (IL-2) is one of the earliest discovered cytokines, also known as T cell growth factor (TCGF), and is an important immune regulatory factor.

[0003] IL-2 is one of the earliest immunotherapy drugs, but it must be taken at very high doses to be effective and is highly toxic, causing fatal vascular leakage syndrome and other side effects. Later, studies found that IL-2 actually has dual activities. High doses of IL-2 can promote T cell proliferation and drive anti-tumor activity, but it also activates regulatory T cells (Tregs); low doses of IL-2 only activate regulatory T cells, inhibit the immune response of immune cells, and can treat autoimmune diseases.

[0004] The receptor of IL-2, interleukin-2 receptor (IL-2R), contains three subunits: α, β, and γ. The three subunits can form receptors with different affinities. Among them, IL-2Rα alone is a low-affinity receptor, which does not participate in signal transduction alone. IL-2Rβ and IL-2Rγ form a medium-affinity receptor, which can transmit signals downstream through JAK. With the participation of IL-2Rα, the affinity is enhanced to a high-affinity receptor. After IL-2 specifically binds to its receptor, it activates multiple pathways such as Jak-STAT, MAPK, and P13K, inhibits apoptosis, induces cell proliferation and differentiation, and produces a variety of biological effects. Based on the above structural biology research, different R&D companies have carried out different IL-2 modification and design methods, including PEGylation modification, Fc fusion, IL-2 mutant design, bispecific antibody design, combined immune checkpoint antibody medication and other strategies.

[0005] Therefore, constructing a reporter gene cell line with a stable IL-2 receptor complex is of great significance for studying the interaction between IL-2 and IL-2 receptor in vitro, preparing antibodies by immunizing animals, or screening antibodies in vitro. Summary of the invention

[0006] In order to solve the above technical problems, the present application provides a reporter gene cell line based on IL2 receptor dimerization and a preparation method and application thereof.

[0007] This application adopts the following technical solutions: In a first aspect, the present application provides a method for preparing a reporter gene cell line based on IL2 receptor dimerization, comprising: (1) H_IL2RB (p.1to270) and H_IL2RG (p.1to290) were selected as target genes, and they were connected to protein tags SmBiT and LgBiT for artificial synthesis to obtain reporter gene fragments; (2) using EcoRI and BamHI, inserting the reporter gene fragment into the empty vector of the lentiviral plasmid, and sequencing using the primer sequences of PTRE2-F and PGK-R to obtain a recombinant plasmid; (3) transfecting the recombinant plasmid into lentiviral packaging cells to obtain recombinant virus; (4) The recombinant virus is transferred into host cells, and after screening, a reporter gene cell line based on IL2 receptor dimerization is obtained.

[0008] Furthermore, the reporter gene fragments are: H_IL2RB(p.1to270)-SmBiT, H_IL2RG(p.1to290)-LgBiT, H_IL2RG(p.1to290)-SmBiT, H_IL2RB(p.1to270)-LgBiT.

[0009] Furthermore, the nucleotide sequences of the reporter gene fragments are: The nucleotide sequence of H_IL2RB(p.1to270)-SmBiT is shown in SEQ ID NO.1; The nucleotide sequence of H_IL2RG(p.1to290)-LgBiT is shown in SEQ ID NO.2; The nucleotide sequence of H_IL2RG(p.1to290)-SmBiT is shown in SEQ ID NO.3; The nucleotide sequence of H_IL2RB(p.1to270)-LgBiT is shown in SEQ ID NO.4.

[0010] Furthermore, the above-mentioned lentiviral plasmid empty vector is lenti-CMV-MCS-PGK-Puro and lenti-CMV-MCS-PGK-Blasticidin.

[0011] Furthermore, in the process of obtaining the recombinant plasmid, the amino acid sequence of the PTRE2-F primer is shown as SEQ ID NO.5; the amino acid sequence of the PGK-R primer is shown as SEQ ID NO.6.

[0012] Furthermore, the lentivirus packaging cells include Escherichia coli stbl3 or 293T anchorage-dependent epithelial-like cells.

[0013] Furthermore, the host cell mentioned above includes any one of human osteosarcoma cells U2OS, HEK-293 cells and CHO-K1 cells.

[0014] In a second aspect, the present application provides a reporter gene cell line based on IL2 receptor dimerization, and the reporter gene cell line is prepared by the above preparation method.

[0015] Furthermore, the reporter gene cell lines are U2OS-H_IL2RB(p.1to270)-SmBiT / H_IL2RG(p.1to290)-LgBiT and U2OS-H_IL2RG(p.1to290)-SmBiT / H_IL2RB(p.1to270)-LgBiT.

[0016] In a third aspect, the present application provides a reporter gene cell line based on IL2 receptor dimerization for use in any of the following (1)-(3): (1) Application in the study of the interaction between IL-2 and IL-2 receptor; (2) Application in the preparation of antibodies in immunized animals; (3) Application in in vitro screening of antibodies.

[0017] In summary, this application has the following beneficial effects: 1. The reporter gene cell line prepared by the preparation method provided in the present application does not rely on signaling pathways, but is based on receptor dimerization. The IL2 receptor dimer reporter gene cell line adopts a new connection method that has not yet been implemented. In the stage of obtaining the reporter gene fragment, the target genes H_IL2RB (p.1to270) and H_IL2RG (p.1to290) are connected to SmBiT and LgBiT respectively. Since SmBiT and LgBiT are two parts after the NanoLuc protein is split, they have very low background binding in the unbound state and only approach when the protein dimerizes. The target gene is connected to SmBiT and LgBiT in different ways, resulting in different distances and positions when SmBiT and LgBiT are close, thereby affecting the docking efficiency of the core structure. It is not desirable to have a docking efficiency that is too high or too low, because too high an efficiency may lead to a high background, and too low an efficiency may lead to a low base signal and difficult to detect.

[0018] 2. The reporter gene cell line based on IL2 receptor dimerization provided in the present application has a short detection time of only 30 minutes for the Nanoluc reporter gene cell line, while conventional reporter gene detection requires more than 6 hours. Therefore, the reporter gene cell line of the present application can greatly shorten the detection time; at the same time, the experiment shows that the reporter gene dimer cell constructed using this connection method (IL2RB-SmBiT / IL2RG-LgBiT) has better sensitivity than the existing technology products at the pool cell stage.

[0019] 3. The present application provides a reporter gene cell line with a structurally stable IL-2 receptor complex, which can be used to study the interaction between IL-2 and IL-2 receptor in vitro, as well as to immunize animals to prepare antibodies or to screen antibodies in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The map of the empty vector lenti-CMV-MCS-PGK-Puro used for the construction of the recombinant plasmid in Example 1 of the present invention; Figure 2 The map of the empty vector lenti-CMV-MCS-PGK-Blasticidin used for the construction of the recombinant plasmid in Example 1 of the present invention; Figure 3 The double enzyme digestion verification diagram of the four recombinant plasmids in Example 1 of the present invention; Figure 4 This is a well plate layout diagram for the Nanoluc reporter gene detection test of the reporter gene cell line in Example 3 of the present invention; Figure 5 This is the reporter gene detection result of the U2OS IL2RB (p.1to270)-LgBiT / IL2RG (p.1to290)-SmBiT dimerization cell line in Example 3 of the present invention; Figure 6 This is the reporter gene detection result of the U2OS IL2RB (p.1to270)-SmBiT / IL2RG (p.1to290)-LgBiT dimerization cell line in Example 3 of the present invention; Figure 7 This is a well plate arrangement diagram of U2OS IL2RB-SmBiT / IL2RG-LgBiT dimer cells in the IL2 drug assay detection experiment in the experimental example of the present invention; Figure 8 The results of reporter gene detection in a single-point time of 5 minutes in the IL2 drug assay of U2OS IL2RB-SmBiT / IL2RG-LgBiT dimer cells are shown. DETAILED DESCRIPTION

[0021] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0022] The target genes of the present application are H_IL2RB (p.1to270) and H_IL2RG (p.1to290). Among them, H_IL2RB (p.1to270) is a truncated version of H_IL2RB (UniProt: P14784 1990-04-01v1); H_IL2RG (p.1to290) is a truncated version of H_IL2RG (UniProt: P31785 1993-07-01v1).

[0023] The reporter gene fragment provided in this application has a nucleotide sequence as shown in Table 1: Table 1. Nucleotide sequences of reporter gene fragments The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0024] Example 1 This example is the construction of H_IL2RB (p.1to270) and H_IL2RG (p.1to290) lentiviral plasmids: (1) H_IL2RB (p.1to270) and H_IL2RG (p.1to290) were selected as target genes, and they were connected to protein tags SmBiT and LgBiT for artificial synthesis (synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.) to obtain reporter gene fragments: H_IL2RB (p.1to270)-SmBiT, H_IL2RG (p.1to290)-LgBiT, H_IL2RG (p.1to290)-SmBiT, H_IL2RB (p.1to270)-LgBiT, whose nucleotide sequences are shown in Table 1.

[0025] (2) Double digest the lenti-CMV-MCS-PGK-Puro vector with EcoRI and BamHI, double digest the gene H_IL2RB (p.1to270)-SmBiT with EcoRI and BamHI and ligate it into the linear lenti-CMV-MCS-PGK-Puro vector (such as Figure 1 The sequence of the inserted gene H_IL2RB(p.1to270)-SmBiT was the same as that shown in SEQ ID NO:1.

[0026] Wherein, the primer sequences for the above sequencing are shown in Table 2: Table 2. Primer sequences Primers sequence serial number PTRE2-F TCGTTTAGTGAACCGTCAGA SEQ ID NO.5 PGK-R CTACACAAGTGGCCTCTGGC SEQ ID NO.6 (3) Double digest the lenti-CMV-MCS-PGK-Blasticidin vector with EcoRI and BamHI, double digest the gene H_IL2RG (p.1to290)-LgBiT sequence with EcoRI and BamHI and ligate it into the linear lenti-CMV-MCS-PGK-Blasticidin vector (such as Figure 2 As shown in Figure 2, it is from Jiman Biotechnology (Shanghai) Co., Ltd.) and is named lenti-CMV-H_IL2RG(p.1to290)-LgBiT-PGK-Blasticidin. The PTRE2-F and PGK-R primer sequences were used for sequencing. The sequencing results showed that the inserted gene sequence H_IL2RB(p.1to270)-SmBiT was the same as the sequence shown in SEQ ID NO:2.

[0027] (4) The vector lenti-CMV-MCS-PGK-Puro was double-digested with EcoRI and BamHI, and the gene H_IL2RG (p.1to290)-SmBiT sequence was double-digested with EcoRI and BamHI and connected to the linear lenti-CMV-MCS-PGK-Puro vector after digestion, named lenti-CMV-H_IL2RG (p.1to290)-SmBiT-PGK-Puro. Sequencing was performed using the PTRE2-F and PGK-R primer sequences, and the sequencing results showed that the inserted gene sequence H_IL2RG (p.1to290)-SmBiT was the same as the sequence shown in SEQ ID NO: 3.

[0028] (5) The vector lenti-CMV-MCS-PGK-Blasticidin was double-digested with EcoRI and BamHI, and the gene H_IL2RB (p.1to270)-LgBiT sequence was double-digested with EcoRI and BamHI and connected to the linear lenti-CMV-MCS-PGK-Puro vector after digestion, named lenti-CMV-H_IL2RB (p.1to270)-LgBiT-PGK-Blasticidin. Sequencing was performed using the PTRE2-F and PGK-R primer sequences, and the sequencing results showed that the inserted gene sequence H_IL2RB (p.1to270)-LgBiT was identical to the sequence shown in SEQ ID NO: 4.

[0029] The plasmid obtained in steps (2)-(5) was determined by plasmid size and double enzyme digestion. The double enzyme digestion gel image is shown in Figure 2 : In the figure, 1 represents the double restriction enzyme map of lenti-CMV-H_IL2RB (p.1to270)-SmBiT-PGK-Puro plasmid, 2 represents the double restriction enzyme map of lenti-CMV-H_IL2RG (p.1to290)-LgBiT-PGK-Blasticidin, 3 represents the double restriction enzyme map of lenti-CMV-H_IL2RG (p.1to290)-SmBiT-PGK-Puro, and 4 represents the double restriction enzyme map of lenti-CMV-H_IL2RB (p.1to270)-LgBiT-PGK-Blasticidin. The results show that the recombinant vectors obtained above are all of the correct length.

[0030] Example 2 This example is virus packaging: 1. Lentivirus packaging cells use 293T anchorage-dependent epithelial cells, and the growth medium is DMEM (containing 10% FBS). One day before transfection, the grown cells are subcultured in a 10cm culture dish at an appropriate ratio, and transfection is prepared when the cells grow to 70%-80%. 1-2h before transfection, the cells to be transfected are replaced with fresh culture medium, 12mL / 10cm dish. Take a sterile 1.5mL EP tube, DMEM 1ml, plasmid 10μg, 10μL Lenti-HG Mix and HG transgene reagent 60μL, mix them, place them at room temperature for 15min-20min, and evenly add them to the culture dish that has been replaced with liquid in advance, and then place them in a CO2 incubator for culture. After transfection for 10-12h, evenly add 100×Enhancing buffer (120μL / dish) to promote transfection. After transfection for 18-20h, aspirate the cell culture medium, add 15mL fresh cell culture medium and continue to culture.

[0031] 2. Virus collection: 48 hours after the fluid change, aspirate the cell supernatant into a 50mL centrifuge tube, centrifuge at 4℃4500g for 5 minutes, filter the supernatant with a 0.45μm filter and transfer it to a new centrifuge tube. Finally, transfer the filtrate to a concentration device in batches, centrifuge at 4℃4500g for 10 minutes, discard the lower layer of liquid into a waste liquid cup filled with disinfectant, and centrifuge at 4℃4500g for the last time for 20 minutes. At this time, the liquid in the upper layer of the filter is the virus concentrate.

[0032] 3. Lentivirus titer determination: (1) Digest 293T cells in the logarithmic growth phase with cell trypsin, inoculate 96-well plates at 8,000 cells / well, and culture overnight at 37 degrees. When infected on the second day, the cells grow to a fusion density of 30-50%. The virus solution is gradiently diluted using cell culture medium containing 10% FBS. Select the required cell wells, aspirate 90 μL of culture medium, take 90 μL of mixed lentivirus dilution and add it to each well of cells, and culture in a cell culture incubator at 37°C overnight. On the third day, remove the culture medium containing lentivirus and add 100 μL of complete culture medium. On the fifth day, use RT-PCR to measure the virus titer. Among them, the dilution method is specifically as follows: Dilution No. 1: 10 μL virus solution + 90 μL virus dilution medium; Dilution No. 2: 10 μL dilution No. 1 + 90 μL virus dilution medium.

[0033] (2) RT-PCR titer measurement system is shown in Table 3: Table 3. (3) The procedure for RT-PCR titer measurement is shown in Table 4: Table 4. (4) The primers used for RT-PCR titer measurement are shown in Table 5: Table 5. (5) Titer results are shown in Table 6: Table 6. As can be seen from Table 6, the lentivirus obtained in this example has a relatively high titer, indicating that the lentivirus is packaged successfully.

[0034] Example 3 This example provides the construction and detection of reporter gene cell lines 1. Construction of reporter gene cell line: The virus solution obtained in Example 2 was used to infect U2OS cells at a virus MOI of 1:1. After two rounds of drug screening, two reporter gene cell lines, U2OS-H_IL2RB(p.1to270)-SmBiT / H_IL2RG(p.1to290)-LgBiT and U2OS-H_IL2RG(p.1to290)-SmBiT / H_IL2RB(p.1to270)-LgBiT, were obtained respectively.

[0035] 2. Cell preparation before detection: 20-24h before the experiment, digest the cells from the culture flask, resuspend the cells with fresh culture medium, detect cell viability and count. Centrifuge at 130-200×g (the speed can be adjusted according to different cells) to collect the cells, and then adjust the cell concentration to 1.0×105cells / mL with fresh culture medium. Prepare two 96-well plates, add 100μL cells / well to the middle two wells (B2, B3), and add 100μL PBS to the surrounding wells. Cover the plate and incubate overnight in the incubator. The wells are arranged as shown in the following figure. Figure 4 shown.

[0036] 3. Drug preparation: IL-2 is used at a concentration of 100 μg / mL. Prepare 2 EP tubes, add 145.2 μL Assay Buffer (basal culture medium containing 1% FBS), then pipette 1.47 μL of the sample stock solution to be tested into the EP tube, mix well, and the final concentration of the drug dilution is 1 ug / ml. Prepare 2 tubes of drug dilution solution.

[0037] 4.Nanoluc reporter gene assay: according to Live Cell Assay (Cat#N2011) reporter gene detection kit (purchased from Promega) was used for detection according to the instructions: the target cells inoculated overnight in step 1 were aspirated and 100 μL of culture medium was discarded from each well. 100 μL of the previously prepared drug dilution solution was added to each well, the detection plate cover was closed, and the plate was incubated in a 37°C CO2 incubator for 2 hours. Samples were collected for Luc detection, and 25 μL of 5X Live Cell Reagent; ELISA kinetic assay, select the internal well to be measured. Each well is tested for 6 seconds / time, for 30 minutes.

[0038] (5) Test results: like Figure 5 and Figure 6 As shown, after 10 minutes of measurement, the U2OS IL2RB-LgBiT / IL2RG-SmBiT dimer cell line modified by the present application was incubated with IL2 for 2 hours, and the measured nanoluc multiple value was 1.6 times that when no drug was added. In contrast, the nanoluc multiple value measured by the U2OS IL2RB-SmBiT / IL2RG-LgBiT dimer cell line connection method was 3.8 times that when no drug was added. Specifically, the nanoluc multiple value measured by the U2OS IL2RB-SmBiT / IL2RG-LgBiT dimer cell line connection method is significantly higher than that of the U2OS IL2RB-LgBiT / IL2RG-SmBiT dimer cell line connection method, indicating that different connection methods have different effects on IL2 signal transduction. Furthermore, these findings emphasize that by detecting the changes in luciferase fold values ​​after IL-2 drugs bind to IL-2 receptor complexes with different connection modes, it is possible to evaluate the effectiveness of treatment regimens, optimize drug delivery systems, and solve side effects. It also helps to deeply understand the signal transduction mechanism, providing important benefits for solving the above problems.

[0039] Experimental example This example provides a U2OS IL2RB-SmBiT / IL2RG-LgBiT dimer cell IL2 drug assay detection 1. Observe and confirm the cell state and fusion degree of the U2OS IL2RB-SmBiT / IL2RG-LgBiT reporter gene cell line before the experiment. The fusion rate should reach 70%-95%. One day before the experiment, place the cell culture dish in a biosafety cabinet and gently aspirate the culture medium. After adding 1-2mL PBS to rinse, gently aspirate the PBS; add 1mL 0.25% trypsin (containing EDTA) and place it in a 37°C, 5% CO2 incubator for about 2-3min to digest until the adherent cells fall off the bottom of the culture dish; add 1-2mL of complete cell culture medium, blow it evenly, transfer the cell suspension to a 15mL centrifuge tube, centrifuge at 1000rpm for 3min, and discard the supernatant; resuspend the U2OS cells after centrifugation with 1-2mL complete culture medium for cell counting. Cells were counted using a cell counter. Cell viability should be ≥80% and cell density should be ≥3E6 cells / mL.

[0040] 2. Adjust the U2OS viable cell density to 1.0×10 with complete culture medium. 5 cells / mL. According to the table below, add cells to the middle well by pipetting 100μL cells / well. Add 100μL PBS to the surrounding wells. Cover the plate and incubate overnight in a 37℃ CO2 cell culture incubator. Remove the plate that has been incubated overnight and add 100μL / well of the prepared gradient dilution solution. The final concentration of IL2 drug in each well sample is as follows: Figure 7 Cover the plate and incubate in a 37°C, CO2 incubator for 2 h.

[0041] 3. Collect samples for Luc detection and add 25 μL of 5X Live Cell Reagent; ELISA kinetic assay, select the internal well to be measured. Each well is tested for 6 seconds / time, for 30 minutes.

[0042] Test results such as Figure 8 As shown: The 5-minute single-point reading value was selected for plotting analysis. The results showed that the half effective concentration (EC50) of the IL2 activation effect of the tested drug was 0.01969, indicating that the drug had a high IL2 activation factor. This shows that the reporter gene dimer cells constructed using this connection method (IL2RB-SmBiT / IL2RG-LgBiT) have better sensitivity than the Yoshiman monoclonal product (product number GM-C29054) at the pool cell stage.

[0043] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A method for preparing a reporter gene cell line based on IL2 receptor dimerization, characterized in that: It includes: H_IL2RB (p.1to270) and H_IL2RG (p.1to290) were selected as target genes, and they were connected to protein tags SmBiT and LgBiT for artificial synthesis to obtain reporter gene fragments; The reporter gene fragment was inserted into the empty vector of lentiviral plasmid using EcoRI and BamHI, and sequenced using PTRE2-F and PGK-R primer sequences to obtain a recombinant plasmid; Transfecting the recombinant plasmid into lentiviral packaging cells to obtain recombinant virus; The recombinant virus is transferred into host cells and screened to obtain a reporter gene cell line based on IL2 receptor dimerization.

2. The method for preparing a reporter gene cell line based on IL2 receptor dimerization according to claim 1, characterized in that: The reporter gene fragments are: H_IL2RB(p.1to270)-SmBiT, H_IL2RG(p.1to290)-LgBiT, H_IL2RG(p.1to290)-SmBiT, H_IL2RB(p.1to270)-LgBiT.

3. The method for preparing a reporter gene cell line based on IL2 receptor dimerization according to claim 2, characterized in that: The nucleotide sequences of the reporter gene fragments are: The nucleotide sequence of H_IL2RB(p.1to270)-SmBiT is shown in SEQ ID NO.1; The nucleotide sequence of H_IL2RG(p.1to290)-LgBiT is shown in SEQ ID NO.2; The nucleotide sequence of H_IL2RG(p.1to290)-SmBiT is shown in SEQ ID NO.3; The nucleotide sequence of H_IL2RB(p.1to270)-LgBiT is shown in SEQ ID NO.

4.

4. The method for preparing a reporter gene cell line based on IL2 receptor dimerization according to claim 1, characterized in that: The empty lentiviral plasmid vectors are lenti-CMV-MCS-PGK-Puro and lenti-CMV-MCS-PGK-Blasticidin.

5. The method for preparing a reporter gene cell line based on IL2 receptor dimerization according to claim 4, characterized in that: In the process of obtaining the recombinant plasmid, the amino acid sequence of the PTRE2-F primer is shown as SEQ ID NO.5; the amino acid sequence of the PGK-R primer is shown as SEQ ID NO.

6.

6. The method for preparing a reporter gene cell line based on IL2 receptor dimerization according to claim 1, characterized in that: The lentiviral packaging cells include Escherichia coli stbl3 or 293T anchorage-dependent epithelial cells.

7. The method for preparing a reporter gene cell line based on IL2 receptor dimerization according to claim 1, characterized in that: The host cell includes any one of human osteosarcoma cells U2OS, HEK-293 cells and CHO-K1 cells.

8. A reporter gene cell line based on IL2 receptor dimerization, characterized in that: The reporter gene cell line is prepared by the preparation method according to any one of claims 1 to 7.

9. The reporter gene cell line based on IL2 receptor dimerization according to claim 8, characterized in that: The reporter gene cell lines are U2OS-H_IL2RB(p.1to270)-SmBiT / H_IL2RG(p.1to290)-LgBiT and U2OS-H_IL2RG(p.1to290)-SmBiT / H_IL2RB(p.1to270)-LgBiT.

10. Use of the reporter gene cell line based on IL2 receptor dimerization according to claim 8 or 9 in any of the following (1)-(3): Application in the study of the interaction between IL-2 and IL-2 receptor; Application in the preparation of antibodies in immunized animals; Application in in vitro screening of antibodies.

Images