JEV detection nucleic acid combination, kit and method based on CRISPR-Cas12a system

Abstract

The invention discloses a JEV detection nucleic acid combination based on a CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-associated 12a) system, a kit and a method. The nucleic acid combination comprises a fluorescent reporter probe, crRNA and a primer group, wherein the nucleotide sequence of the crRNA is shown as any one of SEQ ID NO: 6 and SEQ ID NO: 8. According to the nucleic acid combination, the kit or the method, Cas12a protein specific recognition is guided through crRNA, a target nucleic acid sequence is cut, a fluorescence signal amplification mechanism is combined, rapid, sensitive and specific detection of the JEV is achieved, and a new technical means is provided for rapid diagnosis and monitoring of the arthroviruses.

Description

Technical Field

[0001] The present application relates to the field of molecular diagnostic technology, and to a JEV detection nucleic acid combination, kit and method based on a CRISPR-Cas12a system. Background Art

[0002] Due to the unpredictable outbreak and spread of arboviruses, many arboviruses can cause serious human diseases. These viruses are usually transmitted by vector insects such as mosquitoes and ticks, and their outbreaks are often accompanied by changes in the ecological environment, such as climate warming and poor water resource management. In addition, the acceleration of globalization and the increase in international travel have also provided convenient conditions for the spread of arboviruses. The symptoms caused by most arboviruses are not obviously specific, and often manifest as flu-like symptoms such as fever, headache, and muscle pain, which makes early diagnosis extremely challenging and easily confused with other diseases. Especially in areas with limited resources, the lack of rapid, sensitive and specific detection methods has led to great difficulties in the control and prevention of arboviruses. Therefore, it is particularly important to improve the detection capabilities of arboviruses, which can not only improve the accuracy of early diagnosis of diseases, but also effectively control the outbreak and spread of epidemics.

[0003] Epidemic Japanese encephalitis (abbreviated as "JE"), also known as Japanese encephalitis, is an acute infectious disease that causes central nervous system damage caused by the Japanese Encephalitis Virus (JEV). JE is widespread, causing tens of thousands of cases of encephalitis each year, many of which occur in children. JE is highly pathogenic, with a mortality rate of 20% to 30%, and about 30% to 50% of survivors may suffer from severe neurological sequelae, such as mental retardation, abnormal behavior, language disorders, and movement disorders. Culex mosquitoes, the main vector of JE virus, usually breed in humid environments such as ponds, ponds, or irrigated rice fields. The spread of JE virus has obvious seasonality, and it often breaks out after the rainy season when mosquitoes are active. Humans are generally susceptible to JE virus, and most symptoms after infection are mild, with only a few showing typical JE symptoms, which makes early identification and treatment difficult.

[0004] The incubation period of Japanese encephalitis is 4-14 days. The initial symptoms are mainly acute encephalitis symptoms, such as fever, headache, nausea, vomiting and lethargy. If the patient fails to receive standardized treatment in time, he may experience severe symptoms such as impaired consciousness, convulsions or seizures, and respiratory failure within 2-3 days. Japanese encephalitis virus belongs to the genus Flavivirus of the family Flaviviridae and is a single-stranded positive-strand RNA virus. Its genome is about 11,000 nucleotides long and contains only one open reading frame, encoding 3 structural proteins (Capsid protein C, pre-membrane protein PrM / membrane protein M, envelope protein E) and 7 non-structural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b, NS5). The viral genome contains 5' and 3' non-coding regions on both sides.

[0005] At present, the main methods for detecting arboviruses can be divided into three categories: serological testing, virus isolation and identification, and molecular biological diagnosis. Serological detection techniques include complement fixation test, neutralization test, hemagglutination inhibition test and enzyme-linked immunosorbent assay (ELISA), which mainly detect IgM and IgG specific antibodies. IgM antibodies can be detected 3-5 days after arbovirus infection, while IgG can be detected 7-10 days after infection. Therefore, IgM is mainly used as a marker for acute infection, while IgG is used as a marker for late infection and secondary infection.

[0006] Among the existing arbovirus detection technologies, although serological detection, virus isolation and identification, and molecular biological diagnostic methods each have their own advantages, there are still some technical problems that need to be solved urgently. First, although serological detection technology is mature and widely used, it mainly relies on the detection of IgM and IgG antibodies. IgM antibodies can be detected 3-5 days after infection, while IgG will not appear until 7-10 days after infection, which may cause false negative results in serological detection in early infection. In addition, the detection time of serological detection is long and cannot meet the needs of rapid diagnosis. Secondly, as the gold standard for etiological diagnosis, although virus isolation and identification has high specificity and can provide comprehensive virus information, its operation is complicated, time-consuming, and requires high laboratory conditions. This limits its application in on-site detection and also increases the cost of detection. Thirdly, although molecular biological diagnostic methods such as gene chips and qPCR technology have high sensitivity and specificity, they also have some problems. The sensitivity and specificity of gene chips depend on probe design, and the cost is high, which is not suitable for large-scale promotion. Although qPCR technology is accurate in quantification, it requires strict experimental operations and expensive instruments and equipment, which makes it difficult to use in areas with limited resources and in on-site testing.

[0007] Molecular biological diagnostic methods include gene chips and qPCR technology. The detection principle of gene chips is to first fix the probe on the support, then hybridize the sample molecule with the probe, and obtain the content and sequence information of the sample molecule by detecting the hybridization signal intensity of each probe molecule. Gene chip technology is suitable for large-scale screening and gene expression analysis, but its sensitivity and specificity depend on probe design and the cost is relatively high. qPCR technology amplifies the target nucleic acid sequence through specific primers, and uses fluorescent dyes or probes to monitor the accumulation of amplification products in real time, thereby achieving quantitative analysis of specific DNA or RNA sequences. qPCR technology has the advantages of high sensitivity, high specificity and accurate quantification, but it requires strict experimental operations and instruments and equipment, and the detection cost is relatively high.

[0008] In recent years, CRISPR-Cas12a technology has shown great potential in virus detection. Its unique trans-cutting properties and high sensitivity make it a new tool for rapid detection of pathogens. In the detection of SARS-CoV-2 (new coronavirus), the SHERLOCK detection system developed by CRISPR-Cas12a can accurately identify viral RNA in a short time with a sensitivity as high as single copy level. Similarly, the application of CRISPR-Cas12a in HPV (human papillomavirus) detection has also shown its advantages of high specificity and rapid detection. These success stories show that CRISPR-Cas12a not only performs well in laboratory environments, but also has great potential for point-of-care testing (POCT) applications.

[0009] In summary, although the existing serological detection, virus isolation and identification, and molecular biological diagnostic methods have their own advantages, they still have certain limitations. These detection technologies have limitations in terms of sensitivity, specificity, detection time, and operational complexity, and it is difficult to fully meet the needs of rapid, sensitive, and specific detection of arboviruses. Rapid and sensitive detection methods for JEV still need to be developed and improved. Therefore, the development of a detection method that can simplify the operating process, shorten the detection time, and has high sensitivity and high specificity has become the key to solving the problems of the existing technology. Summary of the invention

[0010] Based on this, it is necessary to provide at least one JEV detection nucleic acid combination, kit and method based on the CRISPR-Cas12a system.

[0011] In the first aspect of the present application, a nucleic acid product is provided, which comprises one or more of the following 1) and 2): 1) a fluorescent reporter probe and a crRNA having a nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8; and 2) a primer set; wherein the sequences of the primers in the primer set are as shown in SEQ ID NO: 4 and SEQ ID NO: 5; and the fluorescent reporter probe comprises the following sequence: 5'-CCCCCCCC-3'.

[0012] In a second aspect of the present application, a kit for detecting Japanese encephalitis virus is provided, which comprises the nucleic acid product as described in the first aspect.

[0013] In the third aspect of the present application, a method for detecting Japanese encephalitis virus is provided, which comprises using the nucleic acid product described in the first aspect, or the kit described in the second aspect to detect a sample.

[0014] Using the nucleic acid product in this application or a kit containing the same to detect JEV has at least the following advantages:

[0015] The instrument requirements are simple: RT-RAA detection and CRISPR-Cas12a detection can use a constant temperature fluorescence detection device, and it is not necessary to use a variable temperature PCR amplifier. It is suitable for various models of miniaturized constant temperature fluorescence detectors.

[0016] High sensitivity: The minimum detection sensitivity can reach 10 copies / μL, that is, each cycle can detect JE virus RNA with a concentration as low as 10 copies, realizing trace low-copy detection of JE virus.

[0017] Good specificity: It can specifically detect the nucleic acid of Japanese encephalitis virus, and has no detection signal for the nucleic acid of other viruses such as dengue virus, West Nile virus, yellow fever virus, Zika virus, and chikungunya virus.

[0018] Good repeatability: for a concentration of 1.0×10 5 copies / μL and 1.0×10 1 The JEV target nucleic acid detection template with a concentration of 20 copies / μL was tested 10 times and the results were all positive.

[0019] In summary, the present application at least provides a detection method that simplifies the operation process, shortens the detection time, has high sensitivity and high specificity, and has good potential for field application. In addition, by optimizing the design of crRNA and the integration of the detection system, a new solution is provided for the rapid diagnosis and monitoring of insect-borne viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the implementation methods and examples of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for use in the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0021] Figure 1 This is a graph showing the results of screening three candidate crRNAs using the CRISPR fluorescence method in one embodiment of the present application.

[0022] Figure 2 This is a comparison chart of the fluorescence values ​​of three crRNAs containing Japanese encephalitis virus at 15 minutes in one embodiment of the present application.

[0023] Figure 3 This is a fluorescence graph of the CRISPR-Cas12a detection sensitivity of crRNA03 containing Japanese encephalitis virus in one embodiment of the present application.

[0024] Figure 4 This is a comparison chart of the CRISPR-Cas12a detection sensitivity results of crRNA03 containing Japanese encephalitis virus at 15 minutes in one embodiment of the present application.

[0025] Figure 5 In one embodiment of the present application, crRNA03 containing Japanese encephalitis virus does not show cross-reaction fluorescence when detecting other pathogens.

[0026] Figure 6 This is a comparison chart of the results of one embodiment of the present application showing that crRNA03 containing the Japanese encephalitis virus at 15 minutes did not show cross-reaction when detecting other pathogens.

[0027] Figure 7 This is a comparison chart of the repeatability results of CRISPR-Cas12a detection of crRNA03 containing different concentrations of Japanese encephalitis virus at 15 minutes in one embodiment of the present application. DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present application belongs. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0030] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and the like, when used in other ways to mean "one or more", are also understood in the same way unless otherwise specified.

[0031] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.

[0032] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. is based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0033] In this application, "further", "further", "particularly", "for example", "such as", "example", "for example", etc. are used for descriptive purposes, indicating that the previous and subsequent different technical solutions are related in terms of the content covered, but should not be understood as a limitation on the previous technical solution, nor can it be understood as a limitation on the protection scope of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0034] In this application, "optionally", "optional", and "optional" mean optional, that is, any one of the two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent. Unless otherwise specified, the descriptions of "optionally include", "optionally contain", etc. in this application, taking "optionally include" as an example, mean "may include or not include".

[0035] The terms "contain", "include" and "include" used in this application are synonymous, which are inclusive or open-ended and do not exclude additional, uncited members or features. Members or features include materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, states, etc.

[0036] In this application, the technical features or technical solutions described in an open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.

[0037] In the present application, exemplary descriptions such as "in some implementation modes (or examples)" and "in one implementation mode (or example)" may include but are not limited to the following meanings: these solutions may be combined with other solutions in a suitable manner to form new technical solutions.

[0038] In the present application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0039] In the present application, when it comes to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to an integer in the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0040] In this application, if there are multiple steps involved in the method flow, unless there is a clear different description in this document, there is no strict order restriction for the execution of these steps, and they can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0041] This application innovatively designs a specific crRNA sequence based on the CRISPR-Cas12a system, a nucleic acid combination containing it, and a detection kit. The kit guides the Cas12a protein to specifically recognize and cut the JEV nucleic acid sequence through crRNA, and combines the fluorescence signal amplification mechanism to achieve rapid, sensitive and specific detection of JEV. Compared with traditional technologies, the method of this application can significantly simplify the operation process, shorten the detection time, and greatly improve the sensitivity and specificity of the detection, and has good potential for field application. On the whole, this application is superior to serological detection, virus isolation and identification, and molecular biological diagnostic methods in terms of ease of operation, detection efficiency, and accuracy, and can improve the detection efficiency and accuracy of arboviruses, providing a new solution for the rapid diagnosis and monitoring of arboviruses; It provides a more efficient and reliable technical means for the rapid diagnosis and detection of JEV. In addition, there is no patent for CRISPR detection technology specifically for JEV. This application fills this gap and proposes a JEV detection kit and crRNA sequence based on the CRISPR-Cas12a system, which provides a new technical approach for the specific detection of JEV.

[0042] The patent of this invention "A JEV detection kit and crRNA sequence based on CRISPR-Cas12a" amplifies the JEV virus through reverse transcription-recombinase-mediated strand displacement nucleic acid amplification (Reverse Transcription-Recombinase-aidedAmplification, RT-RAA), and then uses CRISPR-Cas12a technology to detect the amplified product. Its basic principle is as follows: First, RNA is reverse transcribed into cDNA by reverse transcriptase, and then the recombinase binds to the primer DNA fragment at room temperature to form a recombinase / primer complex and invade the RNA-cDNA double-stranded nucleic acid template. At the invasion site, the recombinase unwinds the double strand, and the single-stranded binding protein (SSB) binds to the unwound single strand to maintain the open-strand state of the double-stranded template. At this time, the recombinase / primer complex scans the template to find a complementary sequence that completely matches the primer. Once a matching complementary sequence is found, the recombinase / primer complex dissociates, and the strand displacement DNA polymerase immediately performs a strand exchange reaction, initiates DNA synthesis, and exponentially amplifies the target area. After the target amplification is completed, LbCas12a forms a ternary complex with the designed crRNA and target sequence that specifically targets the target sequence, and non-specifically cuts the single-stranded DNA fluorescent reporter probe (ssDNA 8C-FQ) in the reaction system to generate a fluorescent signal. By detecting the intensity of the fluorescent signal, the presence and concentration of the target nucleic acid can be indicated.

[0043] In the first aspect of the present application, a nucleic acid product is provided, which comprises one or more of the following 1) and 2): 1) a fluorescent reporter probe and a crRNA having a nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8; and 2) a primer set; wherein the sequences of the primers in the primer set are as shown in SEQ ID NO: 4 and SEQ ID NO: 5; and the fluorescent reporter probe comprises the following sequence: 5'-CCCCCCCC-3'.

[0044] In some embodiments, the nucleic acid product comprises the crRNA, the primer set, and the fluorescent reporter probe.

[0045] In some embodiments, the fluorescent reporter probe is labeled with a fluorescent group and a quencher group. In some embodiments, the 5' end (or 3' end) of the fluorescent reporter probe carries a fluorescent group. In some embodiments, the 3' end (or 5' end) of the fluorescent reporter probe carries a quencher group.

[0046] The fluorescent group in the present application can be a conventional fluorescent group in the art. For example, the fluorescent group is, for example, FAM, HEX, TET, VIC, JOE, ROX or Texas. Wherein, the FAM is, for example, (5(6)-FAM.

[0047] The quencher group in the present application may be a conventional quencher group in the art, for example, BHQ2 or BHQ1.

[0048] In some embodiments, the fluorescent group is (5(6)-FAM, and the quencher group is BHQ1.

[0049] In some embodiments, the fluorescent reporter probe is as follows: 5'(6)-FAM-CCCCCCCC-3'-BHQ1 (abbreviated as ssDNA8C-FQ).

[0050] The second aspect of the present application provides a kit for detecting Japanese encephalitis virus, which comprises the nucleic acid product as described in the first aspect.

[0051] In some embodiments, the kit further comprises Cas12a. Wherein, the Cas12a may be a conventional Cas12a in the art, for example, LbCas12a.

[0052] In some embodiments, the kit comprises one or more of a reverse transcription-recombinase-mediated strand displacement nucleic acid amplification (RT-RAA) unit and a CRISPR-Cas12a trans-cleavage unit.

[0053] In some embodiments, the kit comprises a reverse transcription-recombinase mediated strand displacement nucleic acid amplification (RT-RAA) unit and a CRISPR-Cas12a trans-cleavage unit.

[0054] In some embodiments, the RT-RAA unit may comprise the primer set.

[0055] In the present application, unless otherwise specified, the RT-RAA unit may be a unit that exists independently in form. For example, it may be contained in an independent small package in a kit, or in a separate partitioned space.

[0056] In the present application, the RT-RAA unit may exist as a complete unit. Exemplarily, it is a mixture of primers in a primer set, and may exist in the form of dry powder or stock solution.

[0057] In the present application, the RT-RAA unit may also include different subunits. In one embodiment of the present application, the subunits, for example, may be different primers in the primer set described above. For example, the primer with a sequence as shown in SEQ ID NO:4 is in the form of a dry powder or a liquid storage as another subunit. The primer with a sequence as shown in SEQ ID NO:5 is in the form of a dry powder or a liquid storage as another subunit.

[0058] In some embodiments, the CRISPR-Cas12a trans-cleavage unit may include one or more of the fluorescent reporter probe, the crRNA having a nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8, and Cas12a.

[0059] Similar to the above-mentioned RT-RAA unit, unless otherwise specified in the present application, the CRISPR-Cas12a trans-cleavage unit may be a unit that exists independently in form. For example, it may be included in a separate small package in the kit, or in a separate partition space.

[0060] The third aspect of the present application provides use of the nucleic acid product as described in the first aspect in preparing a product for detecting Japanese encephalitis virus.

[0061] The fourth aspect of the present application provides a method for detecting Japanese encephalitis virus, which comprises using the nucleic acid product as described in the first aspect, or the kit as described in the second aspect to detect a sample.

[0062] In some embodiments, the method comprises: amplifying RNA of a sample using an RT-RAA system comprising the primer set to prepare an amplification product; and

[0063] The CRISPR-Cas12a trans-cleavage unit is mixed with the amplification product to form a CRISPR-Cas12a trans-cleavage system, and reacted.

[0064] In the present application, the amplification conditions of the RT-RAA system may be conventional amplification conditions in the art, as long as the nucleic acid can be effectively amplified.

[0065] In some embodiments, the amplification conditions are 37°C to 42°C, 30 min to 60 min. The temperature involved may be, for example, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, or a range or value between any two values. The amplification time involved may be, for example, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60 min, or a range or value between any two values.

[0066] In some embodiments, the amplification condition is 37° C., 30 min.

[0067] In some embodiments, in the initial reaction system of amplification, the concentration of the primer is 0.4 μM, and the minimum concentration of RNA in the sample is 50 aM.

[0068] In some embodiments, the RT-RAA system comprises 5 μL RNA sample, 1 tube of reaction dry powder, 25 μL ABuffer, 2 μL upstream primer with a concentration of 10 μM, 2 μL downstream primer with a concentration of 10 μM, and 13.5 μL RNase-free Water.

[0069] In some embodiments, the reaction conditions of the CRISPR-Cas12a trans-cleavage system may be conventional reaction conditions in the art. For example, it may be 37° C., 15 min to 40 min.

[0070] In some embodiments, in the initial system of the reaction, the concentration of the fluorescent reporter probe is 250nM to 1000nM, the concentration of the crRNA having a nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8 is 12.5nM to 250nM, the concentration of Cas12a is 250nM to 600nM, and the minimum concentration of the amplified product is 50aM.

[0071] In some embodiments, in the initial system of the reaction, the concentration of the fluorescent reporter probe is 250nM, 300nM, 350nM, 400nM, 450nM, 500nM, 550nM, 600nM, 650nM, 700nM, 750nM, 800nM, 850nM, 900nM, 950nM, 1000nM, or a range or value between any two values.

[0072] In some embodiments, in the initial system of the reaction, the concentration of the crRNA of the nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8 is 12.5 nM, 25 nM, 50 nM, 75 nM, 100 nM, 125 nM, 150 nM, 175 nM, 200 nM, 225 nM, 250 nM, or a range or value between any two values.

[0073] In some embodiments, in the initial system of the reaction, the concentration of Cas12a (eg, LbCas12a) is 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, or a range or value between any two values.

[0074] In some embodiments, the initial system of the reaction contains: 1 μL RT-RAA amplification product, 1 μL crRNA with a concentration of 250 nM, 1 μL fluorescent reporter probe with a concentration of 10 μM, 2 μL LbCas12a with a concentration of 5.7 μM, 2 μL 10×NEBuffer3.1, and 13 μL RNA-free water.

[0075] In some embodiments, the method for detecting Japanese encephalitis virus comprises the following steps:

[0076] The nucleic acid RNA in the sample to be tested is extracted, and a primer set consisting of a single-stranded DNA molecule represented by the sequence JEV-RAA-F (SEQ ID NO: 4) and the sequence JEV-RAA-R (SEQ ID NO: 5) is used to perform RT-RAA amplification on the target to obtain an RT-RAA amplification product.

[0077] Three different crRNA sequences were synthesized for the JEV target nucleic acid sequence, and the Lbcas12a trans-cleavage reaction experiment was used to screen crRNA. The crRNA with short reaction time and large fluorescence signal value was selected as the fixed component in the trans-cleavage reaction system.

[0078] Take 1 μL of the above RT-RAA amplification product and add it to the LbCas12a trans-cleavage reaction system: LbCas12a protein, the above crRNA sequence, single-stranded ssDNA-FQ fluorescent reporter probe, 10×NEBuffer3.1 reaction buffer; at the same time, the RT-RAA amplification product without RNA nucleic acid target was used as a negative control.

[0079] Place the reaction tube of the mixed CRISPR-Cas12a detection reaction system into a fluorescent quantitative PCR instrument, react at 37°C for 15 minutes, and determine whether the sample to be tested contains Japanese encephalitis virus based on the fluorescence intensity of the fluorescence curve. There are two methods for judging the results: ① If the fluorescence intensity value of the test sample detection system is more than 2 times higher than the fluorescence intensity value of the negative control within the same detection time (including the case where the fluorescence intensity value of the test sample detection system is 2 times higher than the fluorescence intensity value of the negative control), the sample to be tested contains Japanese encephalitis virus, otherwise the sample to be tested does not contain Japanese encephalitis virus; ② Select the fluorescence value of the 5th cycle as the starting fluorescence value, the fluorescence value of the 64th cycle as the end fluorescence value, calculate the end / start fluorescence ratio, and if it is greater than 2, it is determined to be a positive result.

[0080] Some examples are provided below.

[0081] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance given in the present application, and can also be based on the experimental manual or normal conditions in the art, or can also be based on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0082] If no specific techniques or conditions are specified in the examples, all the methods are carried out according to the techniques described in the literature in the field (e.g., "Molecular Cloning Experiment Guide" by J. Sambrook et al., translated by Huang Peitang et al., 3rd edition, Science Press) or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0083] The quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0084] The reagents and their sources involved in the following examples are as follows:

[0085] Fast Pure Plasmid Mini Kit (Vazyme, DC201-01), Ampicillin Sodium Salt (BioFroxx, 69-52-3), Phanta Super-Fidelity DNA Polymerase (Vazyme, P501-d1), 2×Phanta Max Master Mix (Vazyme, P515-01), dNTP Mix (10 mM each), Agarose (Biomed, SH441-01), Gel Red (APExBIO, A8746), Universal DNA Purification Kit (TIANGEN, DP214-03), T7 RNA Polymerase (NEB, 50 U / μL, M0251L), 10×RNA Polymerase Reaction Buffer (NEB, B9012S), NTP Mix (10 μM) (BBI, B600056-0500), Recombinant RNase Inhibitor (TaKaRa, 40U / μL, 2313A), Recombinant DNaseI (TaKaRa, 5U / μL, 2270A), 10×DNase I Buffer (TaKaRa, AL62500A), RNA Clean&Concentrator TM-5 (ZYMO RESEARCH, R1016), RT-RAA nucleic acid amplification reagent (Zhongce Biological, S003ZC), 10×NEBuffer3.1 (NEB, B7203S).

[0086] Single-stranded ssDNA-FQ fluorescent reporter probe: The sequence is 5'(6)-FAM-CCCCCCCC-3'-BHQ1, synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0087] The other five viruses are dengue virus (Dengue virus, GeneBank: OQ821371.1), Zika virus (Zika virus, GeneBank: OQ661917.1), Chikungunya virus CHIKV (Genebank: OR037305.2), Japanese encephalitis virus JEV (Genebank: MT134112.1), West Nile virus WNV (Genebank: JX442281.1), and yellow fever virus YFV (Genebank: MN119486.1). The virus plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0088] Example 1 Japanese encephalitis virus nucleic acid detection kit and detection method based on CRISPR-Cas12a system

[0089] (I) Preparation of JEV viral RNA

[0090] 1. Plasmid sequence

[0091] The nucleic acid sequence of Japanese encephalitis virus (JEV) was searched in the Genebank database, and part of the sequence was selected as the JEV target sequence fragment (GeneBank: MT134112.1) and inserted into the pUC57 vector to construct a recombinant plasmid, which was synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0092] The JEV target nucleic acid sequence (SEQ ID NO: 1) is as follows:

[0093] TGCCACAAAACAATCTGTCGTAGCTCTTGGGTCACAGGAGGGAGGCCTCCACCAAGC

[0094] GTTGGCAGGAGCCATCGTGGTGGAGTACTCGAGCTCAGTGAAGTTGACATCAGGCCAC

[0095] CTGAAATGCAGGCTAAAAAATGGACAAACTGGCTCTGAAGGGCACGACTTATGGCATGT

[0096] GTACAGAGAAATTCTCGTTCGCAAAAAATCCAGCGGACACAGGCCATGGAACAGTTGT

[0097] CATTGAGCTCACATACTCTGGAAGTGATGGTCCCTGTAAAATTCCGATTGTCTCAGTCG

[0098] CGAGCTTAAACGACATGACCCCTGTGGGGAGGCTGGTAACAGTAAACCCCTTCGTCGC

[0099] GACATCTAGCTCCAACTCAA

[0100] 2. Plasmid extraction

[0101] Take 5 μL of the glycerol bacteria of the required plasmid obtained from the above company and spread it on the ampicillin-resistant plate, pick the monoclonal colony on the plate and inoculate it in 5mL of LB culture medium containing ampicillin resistance, and shake the bacteria at 37°C and 220rpm overnight. The overnight cultured bacterial solution was divided into 2mL centrifuge tubes, centrifuged at 13000rpm for 2min, discarded the supernatant, and then turned upside down on absorbent paper to absorb the residual liquid. Add 250μL Buffer P1 (RNase A enzyme has been added) to the centrifuge tube with bacterial sediment, and mix it thoroughly with a pipette or vortex oscillator. Add 250μL Buffer P2 and gently turn it upside down for 10-15 times to fully lyse the bacteria. The time used should not exceed 5min. Then add 350μL Buffer P3 and immediately turn it upside down for 10-15 times to form a white flocculent precipitate, and then centrifuge it at 13000rpm for 10min. Place the FastPure DNA Mini Columns adsorption column in the 2mL Collection Tub e In the collection tube, carefully transfer the supernatant after centrifugation to the adsorption column with a pipette, be careful not to absorb the precipitate, centrifuge at 13000rpm for 1min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 500μL Buffer PW1 to the adsorption column, centrifuge at 13000rpm for 1min, discard the waste liquid, and put the adsorption column back into the collection tube. Add 600μL Buffer PW2 (diluted with anhydrous ethanol) to the adsorption column, centrifuge at 13000rpm for 1min, discard the waste liquid, and put the adsorption column back into the collection tube. Repeat this step once. Put the above adsorption column back into the collection tube, centrifuge at 13000rpm for 5min to dry the adsorption column. Place the adsorption column in a new sterilized 1.5mL centrifuge tube, add 100μL sterilized water to the center of the adsorption column membrane, let it stand at room temperature for 2min, centrifuge at 13000rpm for 1min, measure the concentration with a UV spectrophotometer, and store at -20℃. At this time, the target plasmid pUC57-JEV was obtained.

[0102] 3. PCR Amplification

[0103] The above-mentioned plasmid pUC57-JEV was used as the target, and JEV-PCR-F (sequence 2: TGCCACAAAACAA TCTGTCGTAGC, SEQ ID NO: 2) and JEV-PCR-R (sequence 3: TTGAGTTGGAGCT AGATGTCGCG, SEQ ID NO: 3) were used as primer sets for PCR amplification experiments. The PCR experiment reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 s, annealing at 57°C for 25 s, and extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for another 2 min, and storage of the PCR product at 4°C (as shown in Table 1).

[0104] Table 1 shows the PCR amplification system used to prepare the JEV target nucleic acid sequence.

[0105]

[0106] 4.PCR product gel recovery

[0107] 1) Add 5 μL 10× DNA loading buffer to each tube of 50 μL PCR product, mix well and perform agarose gel electrophoresis.

[0108] 2) Prepare 1.5% agarose gel, add the above-mentioned test sample into the gel reaction well, perform electrophoresis at a voltage of 120V, a current of 150mA, and a time of 30min to observe the electrophoresis bands, and cut the gel to recover the target nucleic acid bands.

[0109] 3) First place the adsorption column CB2 in a collection tube, then add 500μL of balancing solution BL, centrifuge at 12000rpm for 1min, and then discard the waste liquid in the collection tube. Add an equal volume of solution PC to the gel block (add 100μL PC solution to 0.1g gel block), place it in a 55℃ water bath for about 10min, and constantly and gently turn the centrifuge tube up and down until the gel block is completely dissolved. Add the above solution to the treated adsorption column CB2, let it stand at room temperature for 2min, then centrifuge at 12000rpm for 1min, and then discard the waste liquid in the collection tube. Add 600μL of rinse solution PW to the adsorption column CB2, centrifuge at 12000rpm for 1min, and then discard the waste liquid in the collection tube. Repeat this step once more. Then place the adsorption column in a collection tube and centrifuge at 13000rpm for 5min to dry the adsorption column. Finally, place the adsorption column CB2 in a new 1.5 mL centrifuge tube, add 60 μL ddH2O to the center of the column membrane, let it stand at room temperature for 2 minutes, then centrifuge at 13,000 rpm for 1 minute, measure the concentration with a UV spectrophotometer, and store at 4°C.

[0110] 5. Transcription

[0111] 1) All the products recovered from the JEV PCR gel were converted into RNA. The T7 polymerase transcription reaction system used was shown in Table 2 below. The reaction conditions were 37° C. for 12 h.

[0112] Table 2 T7 polymerase transcription system

[0113]

[0114] 2) Add 1 / 10 volume of 3M sodium acetate (pH 5.2) to the above transcription reaction system, then add 2 times volume of anhydrous ethanol, and let stand at -20℃ for 30min. Then centrifuge at 15000g for 10min at 4℃ and discard the supernatant. Add 500μL 75% ethanol to the centrifuge tube, blow with a pipette tip 15-20 times until the precipitate is completely dissolved, centrifuge at 15000g for 10min at 4℃ and discard the supernatant, and repeat this step once. Then let stand at room temperature for 15min, add 90μL of RNase-free water at 50-60℃ to completely dissolve the precipitate, then add 10μL of 10×DNaseI Buffer and 2μL DNaseI enzyme (Takara), mix well and react at 37℃ for 1h to completely digest the DNA template.

[0115] 3) RNA recovery: (Use RNA Clean & Concentrator-5 Kit, Zymo) to recover RNA

[0116] Add 2 volumes of RNA Binding Buffer to the above reaction system, then add an equal volume of anhydrous ethanol, mix well and place in a Zymo IC column. Place at room temperature for 2 minutes, centrifuge at 12000g for 2 minutes at 4°C and discard the waste liquid in the collection tube. Add 400μL RNA Prep Buffer to the column, centrifuge at 12000g for 1 minute and discard the waste liquid in the collection tube. Add 700μL RNA Wash Buffer to the column, centrifuge at 12000g for 1 minute and discard the waste liquid in the collection tube. Repeat this step once. Then put the column back into the collection tube, centrifuge at 12000g for 2 minutes to dry the adsorption column, and then place the adsorption column in a new sterile 1.5mL centrifuge tube and place at room temperature for 5 minutes. Add 50μL RNase-free Water to the center of the adsorption column membrane and place at room temperature for 2 minutes. Centrifuge at 10000g for 40s at 4°C to obtain the recovered RNA sample. Measure the concentration with a UV spectrophotometer and store at -80°C.

[0117] (II) RT-RAA amplification of JEV virus nucleic acid target reaction

[0118] 1. Synthesis of RT-RAA Primers

[0119] According to the target nucleic acid sequence of JEV (GeneBank: MT134112.1) and the RT-RAA primer design principles, the RT-RAA primer set sequences constructed and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis were: JEV-RAA-F: CCTGAAATGCAGGCTAAAAATGGACAAACTGG (SEQ ID NO: 4); JEV-RAA-R: ATGACAACTGTTCCATGGCCTGTGTCCGCTGG (SEQ ID NO: 5).

[0120] 2. Preparation of RT-RAA reaction system

[0121] Take the recovered Japanese encephalitis virus RNA sample as the isothermal amplification target template and add it to the RT-RAA amplification reaction system (as shown in Table 3). Add the mixed 47.5 μL solution to the centrifuge tube containing the lyophilized powder to fully and evenly dissolve the lyophilized powder. Add 2.5 μL Buffer B solution (magnesium acetate solution) to each centrifuge tube, close the tube cap, spin and mix evenly, react at 37°C for 30 minutes to obtain the RAA amplification product, and store it at 4°C for subsequent experiments. Replace the RNA sample with in the RT-RAA amplification reaction system shown in Table 3 below, and keep other components unchanged as a negative control.

[0122] Table 3 shows the RT-RAA amplification reaction system

[0123] name volume RNA samples 5μL Reaction dry powder 1 tube A Buffer 25μL JEV-RAA-F (10 μM) 2μL JEV-RAA-R (10μM) 2μL RNase-free Water 13.5μL

[0124] (III) CRISPR-LbCas12a trans-cleavage detection reaction

[0125] 1. Synthesis of crRNA sequences

[0126] According to the selected target nucleic acid sequence of Japanese encephalitis virus, three different crRNAs were designed, among which positions 1-19 were anchor sequences binding to LbCas12a, and positions 20-42 were guide sequences targeting the target sequence of Japanese encephalitis virus JEV. The specific sequences are as follows:

[0127] JEV-crRNA01 (SEQ ID NO: 6): AAUUUCUACUCUUGUAGAUGCAGG

[0128] AGCCAUCGUGGUGGAGUA

[0129] JEV-crRNA02 (SEQ ID NO: 7): AAUUUCUACUCUUGUAGAUAGCCU

[0130] GCAUUUCAGGUGGCCUGA

[0131] JEV-crRNA03 (SEQ ID NO: 8): AAUUUCUACUCUUGUAGAUUCUGU

[0132] ACACAUGCCAUAAGUCGU

[0133] 2. Preparation of LbCas12a trans-cleavage system

[0134] 1 μL of the RT-RAA product after reverse transcription-isothermal amplification was added to the LbCas12a trans-cleavage system shown in Table 4 below, and the above three different crRNAs were added to the trans-cleavage system respectively to screen out the crRNA with the shortest reaction time, the strongest fluorescence signal and the best sensitivity. In the LbCas12a trans-cleavage system shown in Table 4 below, the RT-RAA amplification product of the nucleic acid target was replaced by sterile water as a negative control.

[0135] Table 4 LbCas12a trans-cleavage system

[0136]

[0137] Place the mixed reaction tube in a real-time fluorescence quantitative PCR instrument, set the excitation light wavelength of the FAM channel to 490 nm, the emission light wavelength to 520 nm, collect the fluorescence signal every 15 seconds, react at 37°C for 15 minutes, and monitor the changes in the fluorescence signal intensity in the system.

[0138] 3. Determination of fluorescence curve results

[0139] 1) Within the same testing time, if the fluorescence intensity value of the experimental group is more than 2 times higher than that of the negative control, it is judged as a positive result, that is, the sample to be tested contains Japanese encephalitis virus nucleic acid; otherwise, it is a negative result, that is, the sample to be tested does not contain Japanese encephalitis virus nucleic acid.

[0140] 2) The fluorescence value of the 5th cycle was selected as the starting fluorescence value, and the fluorescence value of the 64th cycle was selected as the end fluorescence value. The end / start fluorescence ratio was calculated. If it was greater than 2, it was determined to be a positive result.

[0141] Example 2 Screening of superior crRNA in the method for detecting Japanese encephalitis virus nucleic acid based on CRISPR-Cas12a system

[0142] 1. According to the method in (iii) of Example 1, three crRNAs were synthesized and prepared, and were named JEV-crRNA01, JEV-crRNA02, and JEV-crRNA03 respectively.

[0143] 2. Take the RT-RAA amplification product in Example 1 (ii), perform a trans-cleavage reaction according to Example 1 (iii), add different crRNAs thereto, observe the changes in the fluorescence curve and compare the fluorescence values, and use sterile water instead of the RT-RAA amplification product of the nucleic acid target as a negative control.

[0144] 3. Experimental results are as follows Figure 1 As shown, compared with the other two crRNAs, the fluorescence curve of the reaction group containing JEV-crRNA03 has a faster peak speed, a shorter time, and a higher sensitivity. Figure 2 As shown, when the same concentration of JEV target nucleic acid was used as the detection template, the fluorescence value of JEV-crRNA03 detected at 15 min was the highest, so JEV-crRNA03 was selected as the preferred crRNA for the method of the present invention.

[0145] Example 3 Sensitivity detection of Japanese encephalitis virus nucleic acid based on CRISPR-Cas12a system

[0146] The Japanese encephalitis virus JEV target RNA template obtained in Example 1 was gradiently diluted to obtain RNA solutions containing nucleic acid fragments of different concentrations, and JEV-crRNA03 was used as the selected crRNA in the trans-cleavage system to detect the sensitivity of the method of the present invention. The specific steps are as follows:

[0147] 1. The RNA template obtained in Example 1 (I) was diluted with sterile water to obtain RNA solutions containing nucleic acid fragments at different concentrations, with the concentrations being 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0148] 2. Perform RT-RAA amplification according to step (ii) in Example 1 to obtain RT-RAA amplification products;

[0149] 3. Take 1 μL of the above RT-RAA amplification product and perform Lbcas12a trans-cleavage reaction according to step (iii) in Example 1. At the same time, set the amplification product with sterile water as the template as a negative control, and the crRNA is JEV-crRNA03.

[0150] 4. According to the experimental results Figure 3As shown in the figure, when JEV-crRNA03 is used to detect JEV template in the CRISPR-Cas12a detection system, although the fluorescence signal is 10 6 -10 0 The concentration of copies / μL decreased continuously, but it was significantly different from the negative control group. Figure 4 As shown, the JEV target at a concentration of 10 copies / μL can be effectively detected within 15 minutes after the start of the reaction, and the sensitivity can reach 10 copies (10 copies / μL).

[0151] Example 4 Specific detection of Japanese encephalitis virus nucleic acid based on CRISPR-Cas12a system

[0152] 1. Using the pathogenic nucleic acid RNA of Chikungunya virus (CHIKV), dengue virus (DENV), West Nile virus (WNV), yellow fever virus (YFV), and Zika virus (ZIKA) as detection templates, RT-RAA amplification was performed according to step (ii) of Example 1 to obtain RT-RAA amplification products of different viruses.

[0153] 2. Take 1 μL of the RT-RAA amplification products of the above different viruses respectively and add them to the LbCas12a trans-cutting system. According to step (iii) in Example 1, the Lbcas12a trans-cutting reaction is performed. At the same time, the amplification product in which sterile water is used instead of the template is set as a negative control, and the crRNA is JEV-crRNA03.

[0154] 3. According to the experimental results Figure 5 As shown in the figure, the fluorescence signal of the experimental group containing the Japanese encephalitis virus JEV target nucleic acid increased rapidly after the reaction started, while the fluorescence intensity of the negative control group and the experimental group containing other viral nucleic acids hardly increased over time. Figure 6 As shown, 15 minutes after the start of the reaction, the fluorescence intensity value of the experimental group containing JEV target nucleic acid is significantly higher than that of the negative control and other pathogen experimental groups, indicating that the detection method of the present invention has high specificity and there is no cross reaction during the detection process.

[0155] Example 5 Repeatability detection of Japanese encephalitis virus nucleic acid based on CRISPR-Cas12a system

[0156] 1. 10 1 copies / μL, 10 5 The Japanese encephalitis virus RNA at a concentration of copies / μL was used as a detection template, and RT-RAA amplification was performed according to step (ii) in Example 1, and each concentration was repeated 10 times;

[0157] 2. Take 1 μL of the RT-RAA amplified product of the above-mentioned Japanese encephalitis virus with different concentrations and add it to the LbCas12a trans-cutting system. According to step (iii) in Example 1, the Lbcas12a trans-cutting reaction is performed. At the same time, the amplified product in which sterile water is used instead of the template is set as a negative control, and the crRNA is JEV-crRNA03.

[0158] 3. Take 1 μL of the RT-RAA amplification products of the above different viruses respectively and add them to the LbCas12a trans-cutting system. According to step (iii) in Example 1, the Lbcas12a trans-cutting reaction is performed. At the same time, the amplification product in which sterile water is used instead of the template is set as a negative control, and the crRNA is JEV-crRNA03.

[0159] 4. According to the experimental results Figure 7 As shown in the figure, at 15 minutes after the start of the reaction, the fluorescence values ​​of the 10 repeated experiments of the two different concentrations of JEV target nucleic acid were relatively concentrated. 1 The fluorescence signal intensity of the experimental group with 40 copies / μL was significantly higher than that of the negative control group, which further verified the high sensitivity and accuracy of the method of the present invention.

[0160] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0161] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the contents of the claims.

Claims

1. A nucleic acid product, characterized in that: It includes one or more of the following 1) and 2): 1) a fluorescent reporter probe and a crRNA having a nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8; and 2) a primer set; Wherein, the sequences of the primers in the primer set are shown in SEQ ID NO:4 and SEQ ID NO:5; the sequence of the fluorescent reporter probe comprises the following sequence: 5'-CCCCCCCC-3'; Optionally, the fluorescent reporter probe is labeled with a fluorescent group and a quencher group; the fluorescent group is optionally selected from the group consisting of FAM, HEX, TET, VIC, JOE, ROX and Texas, and the quencher group is optionally selected from the group consisting of BHQ2 and BHQ1.

2. A kit for detecting Japanese encephalitis virus, characterized in that: It comprises the nucleic acid product as claimed in claim 1.

3. The kit according to claim 2, characterized in that It also contains Cas12a; optionally, LbCas12a.

4. The kit according to claim 3, characterized in that The kit comprises one or more of a reverse transcription-recombinase-mediated strand displacement nucleic acid amplification (RT-RAA) unit and a CRISPR-Cas12a trans-cleavage unit.

5. The kit according to claim 4, characterized in that The RT-RAA unit comprises the primer set; or / and, The CRISPR-Cas12a trans-cleavage unit comprises the fluorescent reporter probe, a crRNA with a nucleic acid sequence as shown in any one of SEQ ID NOs: 6 to 8, and Cas12a.

6. Use of the nucleic acid product according to claim 1 in the preparation of a product for detecting Japanese encephalitis virus.

7. A method for detecting Japanese encephalitis virus, characterized in that: The method comprises using the nucleic acid product according to claim 1 or the kit according to any one of claims 2 to 5 to detect a sample.

8. The method according to claim 7, characterized in that The method comprises: amplifying RNA of a sample using an RT-RAA system comprising the primer set to prepare an amplification product; and, The CRISPR-Cas12a trans-cleavage unit is mixed with the amplification product to form a CRISPR-Cas12a trans-cleavage system, and reacted.

9. The method according to claim 8, characterized in that The amplification satisfies one or two of the following conditions 1) to 2): 1) The amplification conditions are 37°C to 42°C for 30 min to 60 min; and, 2) In the initial reaction system of amplification, the concentration of the primer is 0.4 μM, and the minimum concentration of the RNA of the sample is 50 aM.

10. The method according to claim 8 or 9, characterized in that The reaction satisfies one or two of the following conditions i) to ii): i) the reaction conditions are 37° C., 15 min to 40 min; and, ii) In the initial system of the reaction, the concentration of the fluorescent reporter probe is 250nM to 1000nM, the concentration of the crRNA having a nucleic acid sequence as shown in any one of SEQID NOs: 6 to 8 is 12.5nM to 250nM, the concentration of the Cas12a is 250nM to 600nM, and the minimum concentration of the amplified product is 50aM.

Images