Method for identifying geographical population specificity of different scylla paramamosain in Hangzhou bay and Zhangzhou bay and application
By PCR amplification and sequencing of the genomic DNA of the simile blue crab, the difference in CC peak signal in the sequencing peak chart was used to distinguish Hangzhou Bay and Zhangzhou Bay blue crab, which solved the problem of appearance distinction, and achieved accurate identification and selection of blue crabs. , providing important molecular technical support for the breeding industry.
Patent Information
- Application Number
- CN202411682856.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-01-10
AI Technical Summary
It is impossible to effectively distinguish the green crabs in Hangzhou Bay and Zhangzhou Bay in appearance, which makes it difficult to study the differences in growth performance and stress resistance and breeding of good varieties.
By designing specific primers, PCR amplification and sequencing of the genomic DNA of the simula blue crab, the signal of the pre-CC peak in the sequencing peak map was enhanced or weakened, and the number of green crabs in the Hangzhou Bay and Zhangzhou Bay was distinguished.
It has achieved accurate, efficient and specific distinction between Hangzhou Bay and Zhangzhou Bay green crabs, and provided molecular identification methods for breeding and breeding industry development, which is of great value.
Smart Images
Figure CN119287037A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular identification, and in particular to a method and application for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay. Background Art
[0002] Scylla paramamosain belongs to the family Portunidae and the genus Scylla. It is mainly distributed in coastal areas such as Zhejiang, Fujian, Guangdong, Guangxi, and Hainan in my country. Blue crabs are rich in nutrients, have delicious meat, and have a large market demand. They are important marine economic crabs in my country. my country's blue crab production is mainly based on breeding. According to the "China Fisheries Statistical Yearbook", the total output of blue crab breeding in my country in 2023 was 157,000 tons, an increase of 1.52% over 2022. Blue crab breeding has become one of the pillar industries of agriculture in many places.
[0003] In 2023, the blue crab farming area in Zhangzhou City reached 26,000 mu, with a production of 20,300 tons and an output value of 2.96 billion yuan, ranking among the top in the country. The blue crabs farmed in Zhangzhou Bay are bright in color, thin in shell, large in claws, and full in body. The blue crabs in Hangzhou Bay are characterized by excellent quality, fast growth, and strong resistance to adversity (disease).
[0004] In order to study the differences in growth performance and stress (disease) resistance of mud crabs in Hangzhou Bay and Zhangzhou Bay, the mud crab populations from the two regions were reared in four adjacent earthen ponds in Sanmen County for comparative experiments. Since it is impossible to effectively distinguish the two in appearance, it is necessary to explore specific molecular markers of mud crabs in Hangzhou Bay and Zhangzhou Bay. Establishing molecular technology methods for specific identification of mud crabs in Hangzhou Bay and Zhangzhou Bay is of great value and significance for the future breeding and aquaculture industry development of mud crabs in Hangzhou Bay and Zhangzhou Bay. Summary of the invention
[0005] The invention provides a method for specific identification of different geographical populations of mud crabs in Hangzhou Bay and Zhangzhou Bay and application thereof, so as to solve the problem that mud crabs in Hangzhou Bay and Zhangzhou Bay cannot be distinguished in appearance.
[0006] To achieve the above object, on the one hand, the present invention provides a method for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay, comprising the following steps:
[0007] S1. Using the genomic DNA of Scylla parasitica as a template, PCR amplification was performed on the extracted genomic DNA using the identification primers of Scylla parasitica;
[0008] The identification primer pair is Sp-F and Sp-R, the nucleotide sequence of Sp-F is shown in SEQ ID NO.2, and the nucleotide sequence of Sp-R is shown in SEQ ID NO.3;
[0009] S2, using Sp-F to perform gene sequencing on the PCR amplification product obtained in step S1 and establish a sequencing peak graph;
[0010] In the Hangzhou Bay Scylla pseudoburrowing crab sequencing peak graph, there is a CC peak with enhanced sequencing signal before the GGGGG sequence;
[0011] In the sequencing peak graph of the mud crab Pseudomonas aeruginosa in Zhangzhou Bay, there is a CC peak with weakened sequencing signal before the GGGGG sequence.
[0012] Preferably, in step S1, extracting the genomic DNA of mud crab comprises: extracting the genomic DNA of muscle tissue of mud crab of Hangzhou Bay and mud crab of Zhangzhou Bay using a tissue genomic DNA rapid extraction kit.
[0013] Preferably, in step S1, the PCR amplification conditions are:
[0014] 95℃, 5min; 95℃, 15sec, 55℃, 30sec, 72℃, 30sec, 35cycles; 72℃, 10min.
[0015] Preferably, in step S1, the size of the PCR amplified fragment is 205 bp.
[0016] On the other hand, the present invention provides an application of the above identification method in the breeding of improved varieties of the Hangzhou Bay mud crab and the Zhangzhou Bay mud crab.
[0017] The invention discloses a method and application for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay, which has the following technical effects:
[0018] (1) It can accurately, efficiently and specifically distinguish mud crabs from Hangzhou Bay and Zhangzhou Bay;
[0019] (2) Provide molecular identification methods for the breeding of improved species of mud crabs in Hangzhou Bay and Zhangzhou Bay;
[0020] (3) It has important value and significance for the breeding of high-quality mud crabs and the development of aquaculture industry in Hangzhou Bay and Zhangzhou Bay.
[0021] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is a 1.5% agarose gel electrophoresis result of the PCR product obtained by amplifying the Hangzhou Bay Scylla scylla genome template using the identification primers of the present invention;
[0023] Figure 2This is a 1.5% agarose gel electrophoresis result of the PCR product obtained by amplifying the genome template of the Zhangzhou Bay Scylla scylla using the identification primers of the Scylla scylla in the present invention;
[0024] Figure 3 The peak graphs of the sequencing of Scylla parasitica in Hangzhou Bay and Zhangzhou Bay, among which A~D are the peak graphs of the sequencing of Scylla parasitica in Hangzhou Bay, and E~H are the peak graphs of the sequencing of Scylla parasitica in Zhangzhou Bay; Figure 3 The middle arrows indicate the specific sequencing peaks of mud crabs in Hangzhou Bay and Zhangzhou Bay. DETAILED DESCRIPTION
[0025] In order to make the purpose, technical scheme and advantages disclosed in the embodiments of the present invention more clearly understood, the embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the embodiments of the present invention and are not intended to limit the embodiments of the present invention. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.
[0026] Embodiment 1
[0027] A method for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay, comprising:
[0028] (1) After extensive screening, the PCR amplification region sequence was determined to be as shown in SEQ ID NO. 1:
[0029] TCTTTCAGAGTTGTTGTTGTGTACTTCCACATTCCATGGAGACAGGTTTTTCCTTCACTTTTCACCAATTAAAAAGTGATAATTTCAACAGGATGCTTGAGCTGTCACGGTGCTGCTGCTGCTGTTGTCTGCCATCCCCCTGACACAGACCACCCTGCAGACCACCTTCATC CTGGGTGCCACACGTCACTGCTGCTACAACTCAGAGCAACTGGAGCGCAAACCAGGAAGGGAAATGGTAACTTCTCACTTAATTTGTTGTTTATTTGAGGGCCTAATGACAAAGACATAATGGAATGAGTATTTGTGAATGTTTGTTTATATCTAGATACACCATTCACATATCT.
[0030] According to the PCR amplification region sequence, primer pairs were designed and screened, and the best primer pairs were finally determined to be Sp-F and Sp-R.
[0031] The nucleotide sequence of Sp-F is shown in SEQ ID NO. 2, which is: 5′TGTGTACTTC CACATTCCATGGA 3′;
[0032] The nucleotide sequence of Sp-R is shown in SEQ ID NO. 3, which is: 5′CGCTCCAGTT GCTCTGAGTTGTA 3′. The size of the amplified fragment is 205 bp.
[0033] (2) Genomic DNA from the muscle tissue of mud crabs from Hangzhou Bay and Zhangzhou Bay was extracted using a tissue genomic DNA rapid extraction kit (Zhejiang Easyside Biotechnology Co., Ltd., catalog number DR0307250).
[0034] The blue crab samples included 12 each of the Hangzhou Bay blue crab and the Zhangzhou Bay blue crab, which were collected from wild-caught blue crabs in Hangzhou Bay, Zhejiang Province and Zhangzhou Bay, Fujian Province, respectively, half of which were male and half were female.
[0035] The obtained genomic DNA was used as a template and PCR amplification was performed using the identification primer pair of Scylla pseudoburrowing.
[0036] PCR parameters were: 95°C, 5 min, 95°C, 15 sec, 55°C, 30 sec, 72°C, 30 sec; 35 cycles; 72°C, 10 min.
[0037] The PCR product was subjected to 1.5% agarose gel electrophoresis to determine the molecular weight of the amplified band. The 205 bp PCR amplification product was sent to Zhejiang Shangya Biotechnology Co., Ltd. for gene sequencing using Sp-F primers, and the sequencing peak graph was analyzed using chromas software.
[0038] The results of 1.5% agarose gel electrophoresis of the PCR products after the Hangzhou Bay Scylla scylla genome template was amplified by the primers for identification of Scylla scylla. Figure 1 The 1.5% agarose gel electrophoresis results of the PCR products after the identification primers of the mud crab were amplified from the genome template of the mud crab in Zhangzhou Bay are shown in Figure 2 It was found that the PCR products could not effectively distinguish the mud crabs of Hangzhou Bay and Zhangzhou Bay.
[0039] The sequencing peak graphs of four samples of Hangzhou Bay mud crab and Zhangzhou Bay mud crab are displayed. The sequencing peak graphs of Hangzhou Bay mud crab samples 1 to 4 are as follows: Figure 3 As shown in A to D in the figure, the sequencing peak diagrams of samples 1 to 4 of the Zhangzhou Bay mud crab are as follows: Figure 3 As shown in E to H, Figure 3 The middle arrows point to the specific sequencing peaks of the Hangzhou Bay mud crab and the Zhangzhou Bay mud crab.
[0040] The sequencing peak graph of the mud crab in Hangzhou Bay was found to be double-peaked, and there was a CC peak with enhanced sequencing signal before the GGGGG sequence in the sequencing peak graph. The sequencing peak graph of the mud crab in Zhangzhou Bay was double-peaked, but there was a CC peak with weakened sequencing signal before the GGGGG sequence in the sequencing peak graph.
[0041] Therefore, by analyzing the sequencing peak graph of the amplification product of the identification primers of the pseudo-burrowing mud crab, the pseudo-burrowing mud crab can be judged as the Hangzhou Bay pseudo-burrowing mud crab or the Zhangzhou Bay pseudo-burrowing mud crab by the enhancement or weakening of the CC peak graph before the GGGGG sequence in the sequencing peak graph.
[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.
Claims
1. A method for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay, characterized in that: The steps include: S1. Using the genomic DNA of Scylla parasitica as a template, PCR amplification was performed on the extracted genomic DNA using the identification primers of Scylla parasitica; The identification primer pair is Sp-F and Sp-R, the nucleotide sequence of Sp-F is shown in SEQ ID NO.2, and the nucleotide sequence of Sp-R is shown in SEQ ID NO.3; S2, using Sp-F to perform gene sequencing on the PCR amplification product obtained in step S1 and establish a sequencing peak graph; In the Hangzhou Bay Scylla pseudoburrowing crab sequencing peak graph, there is a CC peak with enhanced sequencing signal before the GGGGG sequence; In the sequencing peak graph of the mud crab Pseudomonas aeruginosa in Zhangzhou Bay, there is a CC peak with weakened sequencing signal before the GGGGG sequence.
2. A method for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay according to claim 1, characterized in that: In step S1, extracting the genomic DNA of mud crab comprises: extracting the genomic DNA of muscle tissue of mud crab of Hangzhou Bay and mud crab of Zhangzhou Bay by using a tissue genomic DNA rapid extraction kit.
3. A method for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay according to claim 1, characterized in that: In step S1, the PCR amplification conditions are: 95℃, 5min; 95℃, 15sec, 55℃, 30sec, 72℃, 30sec, 35cycles; 72℃, 10min.
4. The method for specific identification of different geographic populations of mud crabs in Hangzhou Bay and Zhangzhou Bay according to claim 1, characterized in that: In step S1, the size of the PCR amplified fragment is 205 bp.
5. Use of the identification method according to any one of claims 1 to 4 in the breeding of improved varieties of mud crabs in Hangzhou Bay and Zhangzhou Bay.