Recombinant polymerase amplification primer of staphylococcus epidermidis and detection method

Abstract

The invention provides a recombinant polymerase amplification primer of staphylococcus epidermidis and a detection method. The recombinant polymerase amplification primer comprises an upstream primer with a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID No. 2. According to the invention, a recombinant polymerase amplification primer of staphylococcus epidermidis is designed and can be used for performing RPA amplification on the staphylococcus epidermidis and then detecting an amplification product, so that staphylococcus epidermidis detection can be performed quickly, sensitively and highly specifically, and macroscopic detection is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a recombinant polymerase amplification primer and a detection method for Staphylococcus epidermidis. Background Art

[0002] Recombinase Polymerase Amplification (RPA) is a nucleic acid amplification technology proposed by the British company TwistDx in 2006. This technology uses a variety of enzymes to simulate the DNA replication system in T4 bacteriophage in vitro and achieve amplification under constant temperature conditions. RPA and PCR have a similarity in that they use two opposite primers to achieve amplification, which makes it more advantageous in primer design compared to constant temperature amplification technology. Other isothermal amplification technologies such as LAMP require complex primer design, which is also one of the reasons for non-specific amplification. The PCR reaction relies on a high-temperature resistant DNA polymerase, and the reaction process requires a complex temperature change program to achieve amplification, while the RPA constant temperature amplification reaction process requires more enzyme participation. With recombinase (UvsX), DNA single-strand binding protein (SSB) and strand displacement DNA polymerase as core enzymes, the amplification principle is that the recombinase UvsX protein forms a nucleoprotein complex with the oligonucleotide primer with the assistance of loading factor (T4 UvsY). The complex searches for homologous sequences in the double-stranded DNA template and forms a D-loop through the primer at the homologous site for strand exchange. One side of the D-loop is a double-stranded structure formed by hybridization of the primer and the template chain, and the other side is the unwound complementary chain. The single-strand binding protein then binds to the complementary chain to prevent the primer from dissociating. After the recombinase disintegrates from the nucleoprotein structure, the new primer initiates another strand displacement reaction in the presence of dNTPs. The DNA polymerase binds to one end of the primer for extension, and exponential amplification is achieved through the cyclic process. It is a new type of isothermal amplification technology. This technology does not rely on thermal cycling to amplify the template sequence, and can be carried out at a temperature of 37℃-42℃, and the template can be amplified in large quantities in a short time. In addition, this technology has low hardware requirements, simple operation, good specificity, and low sensitivity, and is particularly suitable for rapid in vitro detection. However, due to its own characteristics, RPA primers are often not compatible with PCR primers, and screening suitable primers becomes the key to successful amplification. In the existing technology, RPA technology has not yet been applied to the detection of Staphylococcus epidermidis. Summary of the invention

[0003] In view of this, the present invention aims to propose a recombinant polymerase amplification primer and a detection method for Staphylococcus epidermidis, which is based on the recombinase polymerase amplification reaction (RPA) and combined with lateral flow chromatography test paper, and can detect Staphylococcus epidermidis quickly, sensitively and highly specifically, and realize visible detection.

[0004] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0005] In a first aspect, the present invention provides a recombinant polymerase amplification primer for Staphylococcus epidermidis, wherein the recombinant polymerase amplification primer comprises an upstream primer having a nucleotide sequence as shown in SEQ ID No.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID No.2.

[0006] Furthermore, the 5' end of the upstream primer is modified with Biotin.

[0007] Further, SEQ ID No. 1: 5′-(Biotin)GTG TCA ATG ACA CAA CGACAC ATG CAGCCG AA, -3′;

[0008] Furthermore, the 5' end of the downstream primer is FITC modified.

[0009] Further, SEQ ID No. 2: 5'-(FITC)CTT GTG AAG ATG TTG TAG CAATAT CTT GTGCA, -3'.

[0010] In a second aspect, the present invention provides a kit, comprising any of the recombinant polymerase amplification primers described above.

[0011] Furthermore, the concentrations of the upstream primer and the downstream primer in the kit are both ≥0.625 μM; preferably 0.625 μM-5 μM; further preferably 0.625 μM-1.5 μM, for example, 0.625 μM, 0.65 μM, 0.675 μM, 0.7 μM, 0.725 μM, 0.75 μM, 0.775 μM, 0.8 μM, 0.825 μM, 0.85 μM, 0.875 μM, 0.9 ... M, 0.95μM, 0.975μM, 1μM, 1.025μM, 1.05μM, 1.075μM, 1.1μM, 1.125μM, 1.15μM, 1.175μM, 1.2μM, 1.22 5μM, 1.25μM, 1.275μM, 1.3μM, 1.325μM, 1.35μM, 1.375μM, 1.4μM, 1.425μM, 1.45μM, 1.475μM, 1.5μM.

[0012] Furthermore, the kit includes a nucleic acid detection test paper for detecting the amplification product of the recombinant polymerase.

[0013] Furthermore, the nucleic acid detection test paper includes an antibody that binds to the upstream primer labeled Biotin and an antibody that binds to the downstream primer labeled FITC group.

[0014] Furthermore, the kit includes reagents for extracting DNA from the sample to be tested.

[0015] In a third aspect, the present invention provides use of any of the above-described recombinant polymerase amplification primers or any of the above-described kits in the preparation of any of the following products:

[0016] (1) Products that identify or assist in the identification of Staphylococcus epidermidis;

[0017] (2) A product for identifying or assisting in identifying whether the bacteria to be tested are Staphylococcus epidermidis;

[0018] (3) Products for identifying or assisting in identifying whether a sample is infected with or contains Staphylococcus epidermidis.

[0019] In a fourth aspect, the present invention provides a method for detecting Staphylococcus epidermidis, using any of the above-described recombinant polymerase amplification primers or any of the above-described kits, the detection method comprising the following steps:

[0020] (1) Extracting DNA from the sample to be tested;

[0021] (2) using the DNA of the sample to be tested as a template, performing a recombinant polymerase amplification reaction using an upstream primer having a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer having a nucleotide sequence as shown in SEQ ID No. 2 to obtain an amplified product;

[0022] (3) Detect the amplified product.

[0023] Furthermore, the step (3) comprises the following steps:

[0024] The amplification product is detected using a nucleic acid detection test paper for detecting the amplification product of the recombinant polymerase;

[0025] If the nucleic acid test paper is positive, the sample to be tested contains or is likely to contain Staphylococcus epidermidis nucleic acid or is infected or is likely to be infected with Staphylococcus epidermidis;

[0026] If the nucleic acid test paper shows negative color, the sample to be tested does not contain or is not likely to contain Staphylococcus epidermidis nucleic acid or is not infected or is not likely to be infected with Staphylococcus epidermidis.

[0027] Furthermore, the reaction system of the recombinant polymerase amplification reaction is 50 μL, including: 2.4 μL of upstream primer; 2.4 μL of downstream primer; 29.5 μL of primer-free re-swelling buffer; 13.2 μL of template and distilled water; Mg 2+ Solution 2.5 μL.

[0028] Furthermore, the Mg2+ The solution is magnesium acetate solution.

[0029] Furthermore, the reaction temperature of the recombinant polymerase amplification reaction is 30°C-41°C, for example, it can be 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, preferably 38-40°C, and more preferably 39°C, and the reaction time is 10-45min, for example, it can be 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, preferably 15-25min, and more preferably 20min.

[0030] Furthermore, the sample includes but is not limited to blood, plasma, alveolar lavage fluid, sputum, urine, cerebrospinal fluid, punctured tissue, pus, and wound secretions.

[0031] Compared with the prior art, the recombinant polymerase amplification primers and detection method of Staphylococcus epidermidis described in the present invention have the following advantages:

[0032] The present invention designs recombinant polymerase amplification primers for Staphylococcus epidermidis, which can be used for RPA amplification of Staphylococcus epidermidis, and then detects the amplified product, thereby enabling rapid, sensitive and highly specific detection of Staphylococcus epidermidis, and achieving naked eye visible detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the accompanying drawings:

[0034] Figure 1 This is a schematic diagram of the test results of the nucleic acid test paper according to an embodiment of the present invention;

[0035] Figure 2 This is a schematic diagram of the positive control experimental results described in Example 2 of the present invention;

[0036] Figure 3 This is a schematic diagram of the negative control experimental results described in Example 2 of the present invention;

[0037] Figure 4 This is a schematic diagram of the detection results of amplification products at different amplification times described in Example 3 of the present invention;

[0038] Figure 5 This is a schematic diagram of the detection results of amplification products at different amplification temperatures described in Example 4 of the present invention;

[0039] Figure 6This is a schematic diagram of the specificity analysis results for detecting Staphylococcus epidermidis according to Example 5 of the present invention;

[0040] Figure 7 This is a schematic diagram of the sensitivity analysis results for detecting Staphylococcus epidermidis according to Example 6 of the present invention;

[0041] Figure 8 This is a schematic diagram of the test results of the clinical samples described in Example 7 of the present invention. DETAILED DESCRIPTION

[0042] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0043] The present invention will be described in detail below with reference to the accompanying drawings and in conjunction with embodiments.

[0044] The reagents and main instruments required in the following examples are: TwistAmp™ Basic recombinase polymerase amplification kit purchased from TwistDx, UK; D003-03 disposable nucleic acid test strip purchased from Hangzhou Ustar Biotechnology Co., Ltd.; A200 gene amplifier purchased from Hangzhou Langji Scientific Instrument Co., Ltd.; 1730R small high-speed refrigerated centrifuge (Labogene).

[0045] Example 1 Design of primers and establishment of a detection method for Gluconobacter epidermidis

[0046] 1. Primer Design

[0047] 1. Determination of specific sequence

[0048] Log in to Genebank website (www.ncbi.nlm.nih.gov) online, query and obtain the SESB gene sequence of the standard strain of Staphylococcus epidermidis. Then select a sequence with a length of 100-300bp on the sequence through the website's online BLAST nucleic acid comparison function. Then compare the sequence again with the entire gene library through the BLAST function to confirm its specificity. The specific sequence length is 300bp. The sequence is SEQ ID No.3: CTTGTGAAGATGTTGTAGCAATATCTTGTGCAACATAACATTGTCGTGTATTGAGTTGACTATATTCTCCATAATTTCCACTTTTATATAGCACCACTCCATTTTTGTATACTTTATAAGTACCGACACCTGCACCAGATTTATTATT TATATCAATTGTGAAATAATCCCTTTTATCCTTAACTTTTTTGAAATTTTGTAAGTCCGGATTGCCACCACTATTTTTCATAGCTTGAATTGCTACAGCTTGTGCATCATGAGATGTTACTTCGGCTGCATGTGTCGTTGTGTCATTGACAC.

[0049] 2. RPA primer design and synthesis

[0050] According to the sequence obtained in the previous step, upstream and downstream primers suitable for recombinase polymerase amplification are designed, and the upstream and downstream primers are respectively terminally labeled with different groups, so that both ends of the amplified product have two labeling groups at the same time (to facilitate the detection of the D003-03 type disposable nucleic acid detection test paper below); in this embodiment, in order to cooperate with the nucleic acid detection test paper, biotin (Biotin) is connected to the 5' end of the upstream primer, and fluorescein isothiocyanate (FITC) is connected to the 5' end of the downstream primer.

[0051] Upstream primer: 5'-(Biotin)GTG TCA ATG ACA CAA CGA CAC ATG CAGCCG AA, -3' (SEQ ID No. 1)

[0052] Downstream primer: 5'-(FITC)CTT GTG AAG ATG TTG TAG CAA TAT CTTGTG CA, -3' (SEQ ID No. 2)

[0053] 2. Test kit for detecting Staphylococcus epidermidis

[0054] The kit for detecting Staphylococcus epidermidis includes RPA primers and nucleic acid detection test paper for detecting RPA primer amplification products; the nucleic acid detection test paper for detecting RPA primer amplification products includes an antibody that binds to the upstream primer labeled Biotin and an antibody that binds to the downstream primer labeled FITC group;

[0055] In this embodiment, a D003-03 type disposable nucleic acid detection test paper is specifically used. This type of test paper uses three antibodies: the first antibody is antibody A labeled with colloidal gold particles and adsorbed on the binding pad, which can specifically bind to the first antigen (biotin) in the sample to be detected; the second antibody is antibody B fixed on the test line (T line) and can specifically bind to the second antigen (FITC) in the sample to be detected; the third antibody is antibody C fixed on the quality control line (C line) and can specifically bind to the antigen on the colloidal gold particles.

[0056] 3. Establishment of the detection method for Staphylococcus epidermidis

[0057] This detection method designs a group of specific detection primers for Staphylococcus epidermidis suitable for recombinase polymerase amplification, wherein the upstream primer is labeled with biotin and the downstream primer is labeled with FITC. If the gene sequence of Staphylococcus epidermidis is contained in the amplification system, a product with double labels can be obtained by amplification with recombinase polymerase using this group of primers. When the product is detected by nucleic acid detection test paper, if a nucleic acid chain carries biotin that can specifically bind to antibody A and FITC that can specifically bind to antibody B at the same time, it can be bound by antibody B fixed on the T line during detection to form an antigen-antibody complex. The complex shows red because it contains colloidal gold particles, that is, the T line appears. Afterwards, the C line can be combined with the colloidal gold particles or colloidal gold-biotin complex that are not captured by the T line to make the C line appear red. If biotin and FITC are not on the same nucleic acid chain, only the C line can appear during detection. When the C line does not appear, the detection is invalid. In this embodiment, while the upstream primer is labeled with biotin, the downstream primer is labeled with FITC. When the target gene sequence exists in the system, the two antigens, biotin and FITC, can be combined on a double-stranded DNA through recombinase polymerase amplification, so that the T line and C line on the nucleic acid test paper appear red, and the result is positive. When the target gene sequence does not exist in the system, biotin and FITC cannot be combined on one chain, and the antibody B on the T line cannot capture the red colloidal gold particles, while the antibody C on the C line can specifically bind to the antigen c on the colloidal gold particles, so that the nucleic acid test paper presents a single quality control line (C line), and the result is negative, such as Figure 1 shown.

[0058] The detection method of Staphylococcus epidermidis in this embodiment is as follows:

[0059] 1. Extraction of Staphylococcus epidermidis nucleic acid

[0060] Add the sample containing Staphylococcus epidermidis to an EP tube containing 1 ml of DEPC water, mix well, heat at 100°C for 10 minutes in a thermostat, and centrifuge at 12000 r / min for 10 minutes. Take out the supernatant and transfer it to a new EP tube to obtain a crude DNA extract.

[0061] 2. RPA amplification

[0062] According to the instructions of the TwistAmp TM Basic Recombinase Polymerase Amplification Kit, the following amplification reaction system was established in a 1.5 ml EP tube pre-filled with RPA lyophilized enzyme beads:

[0063] Element volume Final concentration Upstream primer 2.4μL 0.048μM Downstream primer 2.4μL 0.048μM Primer-free reswelling buffer 29.5μL Template and distilled water 13.2μL

[0064] After adding the above ingredients, use a pipette to blow and mix repeatedly. Then add 2.5 μL of 280 mM magnesium acetate solution to the system. The reaction starts immediately after the addition of magnesium acetate solution. The reaction temperature is controlled at 39 ° C and the reaction time is 20 minutes. After the reaction is completed, the temperature of the reaction system is lowered to 4 ° C to stop the reaction and obtain the nucleic acid amplification product.

[0065] 3. Test paper detection

[0066] Take 10 μl of the nucleic acid amplification product obtained in step 2 above and drop it on the sample pad of the D003-03 disposable nucleic acid test paper. Add 100 μl of test paper buffer to the microplate, and insert the sample pad of the disposable nucleic acid test paper downward into the buffer. After 15 minutes, read the result based on the color of the test paper.

[0067] Positive (+): Two red stripes appear in the reading area of ​​the test strip, one in the quality control area (C line) and the other in the test area (T line). A positive result indicates that the sample being tested contains target nucleic acid fragments, and the number of these fragments is greater than or equal to the minimum detection amount of the test strip.

[0068] Negative (-): Only a red band appears in the quality control area (C line) in the test strip reading area, and no band appears in the test area (T line). A negative result indicates that the sample does not contain the target nucleic acid fragment to be detected, or its amount is less than the minimum detection amount of the test strip.

[0069] Invalid: No bands appear in the quality control area (C line) and the test area (T line) in the test strip reading area. Invalid results indicate that the test strip and / or amplification reagent used in the test may be damaged, ineffective, or there is an error in the operation. In this case, the test steps should be checked and amplification and measurement should be repeated.

[0070] If the test strip is positive, the sample to be tested contains or is a candidate for containing Staphylococcus epidermidis nucleic acid or the sample to be tested is infected or is a candidate for being infected with Staphylococcus epidermidis;

[0071] If the test paper shows negative color, the sample to be tested does not contain or the candidate does not contain Staphylococcus epidermidis nucleic acid or the sample to be tested is not infected or the candidate is not infected with Staphylococcus epidermidis.

[0072] Therefore, RPA amplification primers and nucleic acid detection test strips can be used together to detect whether the sample contains Staphylococcus epidermidis nucleic acid or is infected with Staphylococcus epidermidis.

[0073] Example 2 Determination of primer concentration

[0074] Positive control experiment: DNA extracted from the standard strain of Staphylococcus epidermidis was used as a template, and the experiment was carried out according to the method of step 2 of Example 1, wherein the concentration of the primers in the amplification reaction system was diluted 2, 4, 8, 16, and 32 times based on 10 μM, respectively, to the following different concentrations: 5 μM, 2.5 μM, 1.25 μM, 0.625 μM, and 0.3125 μM. The amplified product was detected with a nucleic acid detection test strip. The results are as follows Figure 2 As shown, from left to right, the corresponding primer concentrations of the test strips are 10μM, 5μM, 2.5μM, 1.25μM, 0.625μM and 0.3125μM respectively; it can be seen that when the concentrations of the primers are 5μM, 2.5μM, 1.25μM and 0.625μM respectively, the nucleic acid detection test strip results are positive, and the primer concentration is 0.3125μM, and the detection is inaccurate;

[0075] Negative control experiment: Using pure water as template, the experiment was carried out according to the method of step 2 of Example 1, wherein the concentrations of the upstream primer and the downstream primer in the amplification reaction system were diluted 2, 4, and 8 times respectively, and the concentrations were as follows: 10μM, 5μM, 2.5μM, and 1.25μM. The amplification product was detected with a nucleic acid detection test paper. The results are as follows Figure 3 As shown, from left to right, the corresponding primer concentrations of the test strips are 10μM, 5μM, 2.5μM, and 1.25μM. It can be seen that when the primer concentrations are 10μM, 5μM, and 2.5μM, the nucleic acid test strip results are positive, which is a false positive result, and the primer concentration is 1.25μM, which is a true negative result. Combined with the positive control experiment, the primer concentration is determined to be 1μmol / mL.

[0076] Example 3 Determination of the amplification time of Staphylococcus epidermidis

[0077] The detection method of Staphylococcus epidermidis in Example 1 was used to conduct an experiment, wherein nucleic acid of Staphylococcus epidermidis standard bacteria was extracted, the primer concentration was 1 μM, and the amplification time was set to 5 min, 10 min, 15 min, 20 min, 25 min, 35 min, and 50 min, respectively, to obtain amplification products with different amplification times.

[0078] The amplification products at different amplification times were tested with nucleic acid test strips. The results were as follows: Figure 4 As shown, from left to right the test strips are 5min, 10min, 15min, 20min, 25min, 35min, 50min, and negative control, so the minimum amplification time is 15 minutes.

[0079] Example 4 Determination of the amplification temperature for detecting Staphylococcus epidermidis

[0080] The experiment was carried out using the detection method for Staphylococcus epidermidis in Example 1, wherein nucleic acid of the Staphylococcus epidermidis standard bacteria was extracted, the primer concentration was 1 μM, and the amplification temperatures were set to 15°C, 20°C, 30°C, 39°C, 41°C, 43°C, and 45°C, respectively, to obtain amplification products at different amplification temperatures.

[0081] The amplification products at different amplification temperatures were tested using nucleic acid test strips. The results were as follows: Figure 5 As shown, the test strips from left to right are 15°C, 20°C, 30°C, 39°C, 41°C, 43°C, and 45°C, so the amplification temperature is 30°C to 41°C.

[0082] Example 5 Specificity analysis for detecting Staphylococcus epidermidis

[0083] The detection method of Staphylococcus epidermidis in Example 1 was used to conduct an experiment, and nucleic acids of Staphylococcus epidermidis standard strain (purchased from Beina Biotechnology Co., Ltd.), Staphylococcus epidermidis clinical strain 1, Staphylococcus epidermidis clinical strain 2, Staphylococcus aureus clinical strain, Escherichia coli clinical strain, Candida albicans clinical strain, Streptococcus pneumoniae clinical strain, and Pseudomonas aeruginosa clinical strain were extracted as templates; the primer concentration was 1 μM; and amplification products of different templates were obtained.

[0084] Use nucleic acid test strips to detect different amplification products. The results are as follows Figure 6 As shown, from left to right, the test strips are nucleic acids of Staphylococcus epidermidis standard strain, Staphylococcus epidermidis clinical strain 1, Staphylococcus epidermidis clinical strain 2, Staphylococcus aureus, Escherichia coli, Candida albicans, Streptococcus pneumoniae, and Pseudomonas aeruginosa. Only the nucleic acid amplification products of Staphylococcus epidermidis standard strain, Staphylococcus epidermidis clinical strain 1, and Staphylococcus epidermidis clinical strain 2 are positive, and the rest are negative. Therefore, the primers and detection methods of the present invention have high specificity.

[0085] Example 6 Sensitivity analysis of detection of Staphylococcus epidermidis

[0086] The detection method of Staphylococcus epidermidis in Example 1 was used to conduct the experiment. The standard Staphylococcus epidermidis bacteria were subcultured, counted, and then graded diluted to 1×10 8 cfu / mL, 1×10 7 cfu / mL, 1×10 6 cfu / mL, 1×10 5 cfu / mL, 1×10 4 cfu / mL, 1×10 3 cfu / mL, 1×10 2 cfu / mL, 1×10 1 cfu / mL, 1 cfu / mL, respectively, extracted nucleic acids as templates, and then subjected to isothermal amplification by recombinant polymerase to obtain amplified products.

[0087] Use nucleic acid test strips to detect different amplification products. The results are as follows Figure 7 As shown, the test strips from left to right are 1×10 8 cfu / mL, 1×10 7 cfu / mL, 1×10 6 cfu / mL, 1×10 5 cfu / mL, 1×10 4 cfu / mL, 1×10 3 cfu / mL, 1×10 2 cfu / mL, 1×10 1 cfu / mL, 1 cfu / mL nucleic acid of different concentrations of Staphylococcus epidermidis standard strains, 1×10 8 cfu / mL to 1×10 5 cfu / mL is a positive result, 1×10 4 cfu / mL and 1×10 3 cfu / mL is a weak positive result, and a lower concentration is a negative result. Therefore, the detection limit for Staphylococcus epidermidis is 1×10 5 cfu / mL.

[0088] Example 7 Accuracy of Detection of Staphylococcus epidermidis

[0089] Five clinical samples (secretions) were collected to verify the clinical application value of the recombinant polymerase isothermal amplification technology. The detection method of Staphylococcus epidermidis in Example 1 was used for detection and compared with the bacterial culture results. Figure 8As shown, the first three cases were bacterial culture-positive specimens, and the last two cases were bacterial culture-negative specimens, indicating that this Staphylococcus epidermidis detection method has good consistency with the gold standard method of bacterial culture, and compared with traditional bacterial culture, it takes less time, only 20 minutes.

[0090] The embodiments described above are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work shall all fall within the scope of protection of the present invention.

Claims

1. A recombinant polymerase amplification primer for Staphylococcus epidermidis, characterized in that: The recombinant polymerase amplification primers include an upstream primer whose nucleotide sequence is shown as SEQ ID No.1 and a downstream primer whose nucleotide sequence is shown as SEQ ID No.

2.

2. The recombinant polymerase amplification primer according to claim 1, characterized in that: The 5' end of the upstream primer is modified with Biotin.

3. The recombinant polymerase amplification primer according to claim 1, characterized in that: The 5' end of the downstream primer is FITC modified.

4. A kit, characterized in that: The kit comprises the recombinant polymerase amplification primers as described in any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that: The kit comprises a nucleic acid detection test paper for detecting a product amplified by the recombinant polymerase.

6. Use of the recombinant polymerase amplification primer according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 5 in the preparation of any of the following products: (1) Products that identify or assist in the identification of Staphylococcus epidermidis; (2) A product for identifying or assisting in identifying whether the bacteria to be tested are Staphylococcus epidermidis; (3) Products for identifying or assisting in identifying whether a sample is infected with or contains Staphylococcus epidermidis.

7. A method for detecting Staphylococcus epidermidis, using the recombinant polymerase amplification primers as described in any one of claims 1 to 3 or the kit as described in any one of claims 4 to 5, characterized in that: The detection method comprises the following steps: (1) Extracting DNA from the sample to be tested; (2) using the DNA of the sample to be tested as a template, performing a recombinant polymerase amplification reaction using an upstream primer having a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer having a nucleotide sequence as shown in SEQ ID No. 2 to obtain an amplified product; (3) Detect the amplified product.

8. The detection method according to claim 7, characterized in that: The step (3) comprises the following steps: The amplification product is detected using a nucleic acid detection test paper for detecting the amplification product of the recombinant polymerase; If the nucleic acid test paper is positive, the sample to be tested contains or is likely to contain Staphylococcus epidermidis nucleic acid or is infected or is likely to be infected with Staphylococcus epidermidis; If the nucleic acid test paper shows negative color, the sample to be tested does not contain or is not likely to contain Staphylococcus epidermidis nucleic acid or is not infected or is not likely to be infected with Staphylococcus epidermidis.

9. The detection method according to claim 7, characterized in that: The reaction system of the recombinant polymerase amplification reaction is 50 μL, including: 2.4 μL of upstream primer; 2.4 μL of downstream primer; 29.5 μL of primer-free re-swelling buffer; 13.2 μL of template and distilled water; Mg 2+ Solution 2.5 μL.

10. The detection method according to claim 7, characterized in that: The reaction temperature of the recombinant polymerase amplification reaction is 30° C.-41° C., and the reaction time is 10-45 min.

Images