Detection method and detection system for detecting serum HBV pg-RNA and application of detection method and detection system

Abstract

The invention relates to the technical field of nucleic acid detection, in particular to a detection method and a detection system for detecting serum HBVpg-RNA and application of the detection method and the detection system. The detection system comprises a DNA probe and a lateral flow immunochromatography test strip, the DNA probe comprises a probe H1 and a probe H2, the sequence of the probe H1 is as shown in SEQ ID NO.1, and the 5'end is modified with digoxin; the sequence H2 is as shown in SEQ ID NO.2, and the 5'end is modified with biotin; the lateral flow immunochromatography test strip comprises a sample pad, a combination pad, a nitrocellulose membrane and an absorption pad. According to the detection system provided by the invention, the DNA probe and the target RNA are mixed to catalyze the hairpin self-assembly reaction and are combined with the immunochromatography test strip, so that professional personnel do not need to operate equipment for detection, the operation is simple, the consumed time is short, and the detection cost is obviously reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and in particular to a detection method and a detection system for detecting serum HBVpg-RNA and applications thereof. Background Art

[0002] HBV is an enveloped double-stranded DNA virus belonging to the genus Orthohepadnavirus of the family Hepadnaviridae. It can infect and attack human liver cells and cause acute or chronic hepatitis B. If not diagnosed and treated in time, it can lead to serious consequences such as liver fibrosis, liver failure, and liver cancer. Compared with other traditional diagnostic markers, serum HBVpg-RNA is considered to be a promising alternative marker for screening, diagnosis and monitoring of hepatitis B. At present, the detection method of serum HBVpg-RNA is mainly reverse transcription quantitative polymerase chain reaction (RT-qPCR), which is time-consuming, expensive equipment, and high detection cost. Summary of the invention

[0003] In view of the deficiencies of the prior art, the object of the present invention is to provide a detection method, a detection system and applications thereof for detecting serum HBV pg-RNA, which can detect HBV pg-RNA rapidly, with high sensitivity and high specificity.

[0004] The purpose of the present invention can be achieved through the following technical solutions:

[0005] A detection system for detecting serum HBVpg-RNA, the detection system comprising:

[0006] DNA probes and lateral flow immunochromatographic test strips;

[0007] The DNA probe includes probe H1 and probe H2, wherein the sequence of H1 is as shown in SEQ ID NO.1, and the 5' end is modified with digoxigenin; the sequence of H2 is as shown in SEQ ID NO.2, and the 5' end is modified with biotin;

[0008] The lateral flow immunochromatography test strip comprises a sample pad, a conjugate pad, a nitrocellulose membrane and an absorption pad.

[0009] Furthermore, the conjugate pad of the lateral flow immunochromatographic test strip is coated with nano-microspheres double-labeled with AlexaFluor647 fluorescein and avidin.

[0010] Furthermore, the nitrocellulose membrane of the lateral flow immunochromatography test strip is marked with a detection line and a quality control line; the detection line is sprayed with anti-digoxigenin monoclonal antibody, and the quality control line is sprayed with biotin.

[0011] A detection system for detecting serum HBVpg-RNA is used for the detection and screening of hepatitis B virus.

[0012] A method for detecting HBVpg-RNA, comprising the following steps:

[0013] S1. Designing the DNA probe according to claim 1 according to the RNA sequence of the target virus;

[0014] S2. preparing the lateral flow immunochromatographic test strip according to claim 1;

[0015] S3, adding the target RNA to the detection tube containing the DNA probe, mixing and incubating, to form a sample with the DNA probe;

[0016] S4, dripping the sample onto the lateral flow immunochromatographic test strip, and after 5-10 minutes, inserting the analysis test strip into the fluorescence detector to read the fluorescence values ​​of the test line and the quality control line.

[0017] Furthermore, the RNA sequence of the target virus is shown in SEQ ID NO.3.

[0018] Furthermore, in step S3, the concentration of the DNA probe in the detection tube is 5 nM.

[0019] Beneficial effects of the present invention:

[0020] 1. The detection system proposed in the present invention utilizes a DNA probe and a target RNA mixed to catalyze a hairpin self-assembly reaction combined with an immunochromatographic test strip. No professional personnel are required to operate the equipment for detection. The operation is simple, time-saving, and the detection cost is significantly reduced.

[0021] 2. The immunochromatographic test strip is used for serum HBVpg-RNA and has high sensitivity.

[0022] 3. The present invention is specific for the detection of HBVpg-RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 It is a schematic diagram of the catalytic hairpin self-assembly reaction principle of the present invention;

[0025] Figure 2It is a schematic diagram of the principle of the lateral flow immunochromatographic test strip of the present invention for detecting H1+H2 hybrid double chains double-modified with digoxigenin and biotin;

[0026] Figure 3 The feasibility analysis result of using the catalytic hairpin self-assembly reaction to detect HBVpg-RNA is verified by gel electrophoresis of the present invention;

[0027] Figure 4 It is the feasibility analysis result of the fluorescent system detection and verification of the catalytic hairpin self-assembly reaction for detecting HBV pg-RNA;

[0028] Figure 5 It is a schematic diagram of the sensitivity analysis results of the catalytic hairpin DNA self-assembly combined with lateral flow immunochromatographic test strip detection system of the present invention;

[0029] Figure 6 It is a schematic diagram of the specific analysis results of the catalytic hairpin DNA self-assembly combined with lateral flow immunochromatographic test strip detection system of the present invention;

[0030] Figure 7 It is the detection result of HBVpg-RNA in clinical specimens by the detection method of the catalytic hairpin DNA self-assembly combined with lateral flow immunochromatography test strip detection system of the present invention. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Example 1 Preparation of lyophilized powder of detection probe

[0033] The present invention performs multiple sequence alignment based on the published HBVpg-RNA sequence and selects a conservative sequence with a length of 24 bases as a detection target. The sequence is shown in Table 1 below:

[0034] Two probes were designed based on the conserved sequence of the HBVpg-RNA gene, denoted as H1 and H2. The 5' end of the above probe H1 was labeled with digoxin (Dig), while the 5' end of the H2 probe was modified with biotin (Biotin, Bio). The relevant sequences are shown in the table below

[0035] Table 1: Probe sequences

[0036] name Sequence (5'-3') Target RNA ACUGUUGUUAGACGACGAGGCAGG H1 CCTGCCTCGTCGTCTAACAACAGTGAGGCAGGTGAGGGTTACTGTTGTTAGACGAC H2 ACAACAGTAACCCTCACCTGCCTCACTGTTGTTAGACGACGAGGCAGGTGAGGGTT

[0037] The prepared probes were dissolved in TNaK buffer (140 mM NaCl, 5 mM KCl and 20 mM Tris, PH = 7.5) to 1 nM / L, and then annealed to keep the hairpin structure of each probe. The annealing temperature was 95°C, and the hairpins were naturally cooled to room temperature. After annealing, the hairpins were stored at -20°C.

[0038] Example 2 Electrophoresis verification of the feasibility of the catalytic hairpin self-assembly system

[0039] The system was verified by 12% non-reducing polyacrylamide gel electrophoresis. Probes H1 and H2 were annealed and diluted to 1 μM with the target detection sequence. 10 μL of probe H1, 10 μL of probe H2 and 10 μL of target sequence were mixed thoroughly and reacted in a 30°C water bath for 30 minutes.

[0040] After the mixture was diluted with 10× loading buffer, 20 μL was loaded and electrophoresed at 100 V for 90 minutes. The electrophoresis gel was stained with EB for 10 minutes and imaged by a gel imager. The gel imaging showed lanes 1-7, which were: probe H1, H2, target detection sequence, probe H1+probe H2, probe H2+target sequence mixture, probe H1+target sequence mixture, probe H1+probe H2+target sequence mixture.

[0041] like Figure 3 As shown, the 4th lane shows that when there is no target RNA, the two probes H1 and H2 almost do not spontaneously bind, the 6th lane shows that the target RNA can open the hairpin of probe H1 to form probe H1 + target RNA, and the 7th lane shows that when probe H1, probe H2 and target RNA are added, H1 + H2 hybrid double strands can be formed.

[0042] Example 3 Fluorescence system verifies the feasibility of the catalytic hairpin self-assembly system

[0043] Probe H2 was labeled with a fluorescent group (FAM) and a quenching group (BHQ1) and was synthesized and purified by Shanghai Shenggong Biotechnology Co., Ltd. Take 10 μL of 1 nmol / L H1, 1 nmol / L H2, and 1 nmol / L target RNA, set the reaction temperature to 30°C, cycle once every 30 seconds, and perform 50 cycles in total, and detect using 7500 Real Time PCR system (Thermo Fisher Scientific).

[0044] like Figure 4As shown, the real-time fluorescence quantitative curve shows that when there is no target RNA, the background fluorescence value formed by H1+H2 is low. When the target sequence and the probe are present at the same time, the probe H1 and H2 hairpins are opened in turn, and finally a large number of H1+H2 hybrid double strands are formed, thereby producing an obvious fluorescence curve.

[0045] Example 4 Lateral flow immunochromatographic test strip

[0046] The preparation materials of the lateral flow immunochromatography test strip include a sample pad, a conjugation pad, a nitrocellulose membrane and an absorption pad, wherein the conjugation pad is coated with nano-microspheres double-labeled with AlexaFluor647 fluorescein and avidin; the nitrocellulose membrane is marked with a detection line and a quality control line; the detection line is sprayed with anti-digoxigenin monoclonal antibody, and the quality control line is sprayed with biotin.

[0047] Example 5: Sensitivity analysis of HBV pg-RNA method using catalytic hairpin self-assembly system combined with lateral flow immunoassay test strips

[0048] According to the target detection sequence, a DNA target chain is synthesized (the DNA target chain is a single strand), and the synthesized DNA target chain is

[0049] Dissolve it in TNaK+Mg2+ buffer to 100nM, and dilute it with normal human serum as diluent, with the concentration diluted from 10nM to 100fM;

[0050] Take 100 μL of the DNA target strand solution and mix it thoroughly with the appropriate concentrations of probe H1 (10 nmol / L) and probe H2 (10 nmol / L), and react in a 30°C water bath for 30 minutes to obtain a reaction solution;

[0051] 100 μL of the reaction solution was added dropwise to the lateral flow immunochromatography test strip, and the fluorescence values ​​at the test line and the quality control line were read on a fluorescence detector after 15 minutes.

[0052] Fluorescence results such as Figure 5 As shown, as the target RNA concentration decreases, the fluorescence value also decreases. The lowest detectable target RNA concentration in this study is 1 pmol / L. It was found that there was a good linear relationship between the fluorescence value (Y) and the target RNA concentration (X). The linear equations were: Y=0.249*X+2.196 (R2=0.9283), and the cutoff value (the mean value of negative samples plus 3×standard deviation) was 581.

[0053] Example 6 Specificity analysis of HBV pg-RNA method using catalytic hairpin self-assembly system combined with lateral flow immunoassay test strips

[0054] According to the target RNA, single base mismatch target (SMT), single base addition target (SIT), single base deletion target (SDT), double base mismatch target (SMT) double base addition target (DIT), double base deletion target (DDT) are designed, and the sequences are shown in Table 2:

[0055] Table 2: Base mutation sequences

[0056] name Sequence (5'-3') SMT ACUGUUGUUAGAGGACGAGGCAGG SIT ACUGUUGUUAGAUCGACGAGGCAGG SDT ACUGUUGUUAGAGACGAGGCAGG DMT ACUGUAGUUAGACGUCGAGGCAGG DIT ACUGUUGUGUAGACGACAGAGGCAGG DDT ACUGUGUUAGACGACGAGCAGG

[0057] The six base mutation sequences were diluted to 1 nmol / L with normal human serum, and 100 μL of mutant RNA was mixed with 100 μL of probe H1 (10 nmol / L) and 100 μL of probe H2 (10 nmol / L) and reacted in a 30°C water bath for 15 minutes to obtain a reaction solution;

[0058] Take 100 μL of the reaction solution and add it dropwise to the immunochromatographic test strip. After 15 minutes, read the fluorescence values ​​at the test line and the quality control line on the immunochromatographic quantitative analyzer.

[0059] Test results such as Figure 6 As shown, the fluorescence values ​​of several mutant RNAs were significantly reduced and there was a 4* gap with the target RNA, indicating that this detection method has excellent selectivity and high identification ability for HBVpg-RNA.

[0060] Example 7 Catalytic hairpin self-assembly system combined with lateral flow immunoassay test strips for detection of clinical samples

[0061] Five HBVpg-RNA PCR positive specimens and five negative specimens were collected. 100 μL of serum from each sample was thoroughly mixed with appropriate concentrations of probe H1 (10 nmol / L) and probe H2 (10 nmol / L), and reacted in a 30°C water bath for 30 minutes to obtain a reaction solution.

[0062] Take 100 μL of the reaction solution and add it dropwise to the lateral flow immunochromatography test strip. After 15 minutes, read the fluorescence values ​​at the test line and the quality control line on the fluorescence detector.

[0063] The results are as follows Figure 7 As shown in the figure, the average fluorescence value of 5 HBV pg-RNA positive samples was 898.40±246.99, while the average fluorescence value of 5 HB pg-RNA negative samples was 231.87±59.25. The fluorescence values ​​of positive samples were statistically different from those of the control group (P<0.001). According to the cutoff value, the result with a fluorescence value greater than 581 was positive, and the result less than 581 was negative. After qualitative analysis, the result was compared with the RTPCR test results, and the consistency rate reached 100%. The results show that this detection method can be used to detect HBV pg-RNA clinical specimens.

[0064] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0065] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.

Claims

1. A detection system for detecting serum HBV pg-RNA, characterized in that: The detection system comprises: DNA probes and lateral flow immunochromatographic test strips; The DNA probe includes probe H1 and probe H2, wherein the sequence of H1 is as shown in SEQ ID NO.1, and the 5' end is modified with digoxigenin; the sequence of H2 is as shown in SEQ ID NO.2, and the 5' end is modified with biotin; The lateral flow immunochromatography test strip comprises a sample pad, a conjugate pad, a nitrocellulose membrane and an absorption pad.

2. A detection system for detecting serum HBV pg-RNA according to claim 1, characterized in that: The conjugate pad of the lateral flow immunochromatography test strip is coated with nano-microspheres double-labeled with AlexaFluor647 fluorescent pigment and avidin.

3. A detection system for detecting serum HBV pg-RNA according to claim 1, characterized in that: The nitrocellulose membrane of the lateral flow immunochromatography test strip is marked with a detection line and a quality control line; the detection line is sprayed with anti-digoxin monoclonal antibody, and the quality control line is sprayed with biotin.

4. The detection system for detecting serum HBV pg-RNA as claimed in any one of claims 1 to 3 is used for the detection and screening of hepatitis B virus.

5. A method for detecting HBVpg-RNA, characterized in that: The detection method comprises the following steps: S1. Designing the DNA probe according to claim 1 according to the RNA sequence of the target virus; S2. preparing the lateral flow immunochromatographic test strip according to claim 1; S3, adding the target RNA to the detection tube containing the DNA probe, mixing and incubating, to form a sample with the DNA probe; S4, dripping the sample onto the lateral flow immunochromatographic test strip, and after 5-10 minutes, inserting the analysis test strip into the fluorescence detector to read the fluorescence values ​​of the test line and the quality control line.

6. A method for detecting HBV pg-RNA according to claim 5, characterized in that: The RNA sequence of the target virus is shown in SEQ ID NO.

3.

7. The method for detecting HBV pg-RNA according to claim 5, characterized in that: The concentration of the DNA probe in the detection tube in step S3 is 5 nM.

Images