Novel RNA editing composition and application thereof

Abstract

The invention discloses a novel RNA editing composition and application thereof. The present invention relates to a composition comprising: a TaqTth protein or a polynucleotide encoding the protein; the oligonucleotide probe is composed of two parts, one part is a guide sequence capable of being complementary with a target gene, and the other part is a probe sequence capable of being complementary with a target gene; the other part has a nucleic acid secondary structure; and the oligonucleotide probe is a DNA probe or an RNA probe. Compared with an existing RNA editing tool, the tool has the advantages of being capable of being mediated by a DNA probe or an RNA probe, small in relative size, free of PFS limitation, free of incidental cleavage activity, low in off-target rate and high in specificity. The RNA editing composition can be used for gene editing and preparation of a gene editing reagent, and can also be used for preparing a medicine for treating diseases caused by gene mutation, and the diseases comprise Alzheimer's disease.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a novel RNA editing composition and application thereof. Background Art

[0002] Alzheimer's disease (AD) is the neurodegenerative disease with the highest incidence. The common drugs currently used to treat AD are symptomatic chemotherapy or monoclonal antibody drugs, which can relieve symptoms to a certain extent, but cannot delay the course of the disease and have adverse reactions caused by multiple medications.

[0003] At present, biological allele therapy methods based on RNA editing technology have made it possible to improve the current situation of AD's "lack of medical care and drugs". For example, targeting the amyloid precursor protein mutant gene (APPswe) can knock down the production of APPswe protein, thereby reducing the production of β-amyloid protein (Aβ) in the brain.

[0004] Current RNA editing technologies include classic RNA interference (RNAi) and CRISPR technologies represented by Cas13 and Cas7-11. However, the relevant patents are basically in the hands of foreign companies and experts, and the patent rights are not autonomous; CRISPR technology almost all relies on PFS sequence positioning, which limits the anchoring range; important nucleases (such as RNA editor Cas7-11) have too large molecular weight, far exceeding the load of many delivery vectors (such as AAV); can only rely on RNA guide probes, etc. Although it has been modified, if it still revolves around the CRISPR system, it may still not be able to get rid of the inherent problems of Cas protein, and may even add additional unfavorable factors.

[0005] In specific AD treatment, targeting APP swe CRISPR / Cas9 targeting genomic DNA can damage the patient's genetic material, raising safety concerns; targeting APP swe mRNA is safer, but the corresponding CRISPR / Cas13 and RNAi technologies are not specific enough and may accidentally damage non-pathogenic wild-type APP wt (APP wt With APP swe There is only a difference of 2 bases, which can easily go off-target), affecting the normal function of nerve cells.

[0006] Therefore, there is an urgent need to develop a new type of RNA editing composition that can target and eliminate pathogenic mutant mRNA with high specificity, and then use it to prepare therapeutic drugs for Alzheimer's disease, so as to contribute to improving the medical status of chronic diseases in the elderly in my country. Summary of the invention

[0007] Purpose of the invention: The purpose of the present invention is to provide a novel RNA editing composition and its application that can be mediated by RNA probe, is independent of PFS sequence, has small volume and high specificity, in view of the deficiencies of the prior art. The composition of the present invention can be used to achieve genetic intervention in Alzheimer's disease. Therefore, the RNA editing composition of the present invention can be used to prepare a drug for treating Alzheimer's disease.

[0008] The inventors have disclosed "A composition and method for editing any nucleic acid" (CN202010157724.2). The application discloses the cutting effect of a FEN1-like functional protein and a DNA probe composition on nucleic acid substances. Different from this, in the present invention, the RNA editing composition disclosed by the inventors is a composition formed by another non-FEN1 family functional protein and an RNA probe, which is used to cut endogenous or exogenous nucleic acid substances in cells or animals.

[0009] Technical solution: The purpose of the present invention is achieved through the following technical solution:

[0010] The present invention provides a novel RNA editing composition, which comprises:

[0011] Component (i): TaqTth protein or a polynucleotide encoding the protein;

[0012] Component (ii): at least one oligonucleotide probe, the oligonucleotide probe consisting of two parts, one part being a guide sequence capable of complementing the target gene; and the other part having a nucleic acid secondary structure;

[0013] The oligonucleotide probe is a DNA probe or an RNA probe:

[0014] The TaqTth protein or the polynucleotide encoding the protein can not only recognize the nucleic acid secondary structure of the oligonucleotide probe, thereby binding to the probe, but also cut the target RNA substrate.

[0015] In component (i), the TaqTth protein is selected from any one of the following:

[0016] (1) Partial functional domains or complete enzyme fragments of Thermus aquaticus DNA polymerase or its mutants;

[0017] (2) Partial functional domains or complete enzyme fragments of Thermus thermophilus DNA polymerase or its mutants;

[0018] (3) Fusions of the complete enzyme or fragments of Thermus aquaticus DNA polymerase and / or Thermus thermophilus DNA polymerase.

[0019] A preferred embodiment of the present invention is that the TaqTth protein is a chimeric functional protein formed by fusing parts of Thermus aquaticus DNA polymerase and Thermus thermophilus DNA polymerase, and its nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0020] The TaqTth protein molecule contains one or more nuclear export signals at the C-terminus or N-terminus; the polynucleotide encoding the TaqTth protein molecule is DNA or RNA.

[0021] In component (ii), the oligonucleotide probe is a chemically synthesized oligonucleotide probe, or a plasmid constructed by inserting into a plasmid backbone.

[0022] The nucleic acid secondary structure of the oligonucleotide probe contains a 3' end hairpin structure.

[0023] The present invention also provides the use of the novel RNA editing composition in gene editing and the preparation of gene editing reagents.

[0024] The RNA editing composition degrades exogenous genes and endogenous gene mRNA in eukaryotic cells and reduces the expression of corresponding proteins. The degradation is one or more single-strand breaks introduced into the genomic RNA and mRNA of the target gene.

[0025] The present invention also provides the use of the novel RNA editing composition in the preparation of therapeutic drugs for diseases caused by gene mutations, wherein the diseases include Alzheimer's disease.

[0026] The RNA editing composition is selected from any of the following forms: a TaqTth-3'hpRNA composition, a TaqTth-3'hpDNA composition, a TaqTth-3'hpRNA single plasmid system or an AAV-TaqTth-3'hRNA vector.

[0027] The TaqTth-3'hpRNA single plasmid system is based on the transformation of the recombinant adeno-associated virus rAAV shuttle plasmid, which is driven by the CAG promoter to express EGFP and TaqTth protein respectively and cascaded with the U6 promoter to drive the expression of targeted APP. swe 3'hpRNA single plasmid.

[0028] The AAV-TaqTth-3'hRNA vector replaces the CAG promoter in the TaqTth-3'hpRNA single plasmid with the neuron-specific promoter Syn, and packages it into AAV through the AAV auxiliary plasmid of serotype 9.

[0029] When the RNA editing composition of the present invention is used for intervention of Alzheimer's disease, the RNA editing composition is delivered by AAV vector to target the amyloid precursor protein mutant gene (APP swe ), thereby knocking down APP swe Protein production, thereby reducing the production of beta-amyloid protein (Aβ) in the brain; at the same time, it will not accidentally damage the non-pathogenic wild-type gene APP wt , without affecting normal function; in addition, taking advantage of the small size of the new RNA editing composition, assembling a beneficial gene APOE2 in the same AAV vector can simultaneously knock down the mutant APP swe The expression level of protein and expression of the protective APOE2 gene.

[0030] The present invention also provides an AAV vector constructed by connecting an RNA editing composition and APOE2 in series. The APOE2 gene is cloned downstream of the HA-tagged TaqTth, the two proteins are connected by T2A, and the vector is packaged into AAV9 using an AAV helper plasmid of serotype 9 and named AAV-TaqTth-T-APOE2.

[0031] Beneficial effects:

[0032] First, the protein molecules in the novel RNA editing composition of the present invention are much smaller than the protein molecular weight in existing gene editing tools, which is conducive to the loading of AAV vectors.

[0033] Second, the novel RNA editing composition of the present invention is not restricted by the sequence of the target substrate when cleaving the target substrate.

[0034] Third, the novel RNA editing composition of the present invention has no incidental cutting activity, can distinguish single-base difference targets, and has high safety and specificity.

[0035] Fourth, the RNA editing system of the present invention is small in size and can simultaneously knock down the expression level of mutant APP and express the protective APOE2 gene. Therefore, the present invention is the first to use the AAV system to simultaneously target APP and APOE2, which is highly innovative in drug research for AD gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The WB result diagram of TaqTth protein expression and the immunofluorescence co-localization result diagram of Example 1;

[0037] Figure 2 It is a schematic diagram of the composition of the 3'hpRNA probe of Example 1 and the principle of binding to the target;

[0038] Figure 3 It is a schematic diagram of the experimental design of the TaqTth-3'hpRNA composition targeting the exogenous target gene EGFPmRNA in eukaryotic cells and a diagram of the down-regulation results of the transcription level in Example 1;

[0039] Figure 4 The results of down-regulating the transcription levels of the endogenous target genes KRAS mRNA and PPIB mRNA in eukaryotic cells by the TaqTth-3'hpRNA composition of Example 1 are as follows;

[0040] Figure 5 This is a diagram showing the analysis result of the preference of the TaqTth-3'hpRNA composition of Example 1 for the target substrate sequence;

[0041] Figure 6 This is a graph comparing the cytotoxicity and efficiency of the TaqTth-3'hpRNA composition and siRNA in Example 2;

[0042] Figure 7 This is a comparison result of the off-target effects of the TaqTth-3'hpRNA composition and siRNA in Example 2;

[0043] Figure 8 It is a schematic diagram and result diagram of the experimental design of the probe screening for specific knockout of APPswe mRNA using the TaqTth-3'hpRNA composition of Example 3;

[0044] Fig. 9 This is a comparison result diagram of the specificity of the TaqTth-3'hpRNA composition and siRNA used to knock out APPswe mRNA in a stable cell line in Example 3;

[0045] Fig.10 This is a result diagram of the in vitro test of the TaqTth-3'hpDNA composition of Example 4 for cutting target RNAs of different sequences;

[0046] Fig.11 This is a result diagram of the TaqTth-3'hpDNA composition of Example 4 cleaving the target RNA at the in vitro test tube level without producing incidental cleavage;

[0047] Fig.12It is a diagram of the action principle of the TaqTth-3'hpDNA composition of Example 5 targeting the endogenous target genes CXCR4mRNA, KRAS mRNA, and PPIB mRNA in eukaryotic cells and a diagram of the down-regulation results of the transcription level;

[0048] Fig.13 This is a result diagram of Example 6 in which DNP targets the endogenous target gene KRAS mRNA in eukaryotic cells and is compared with siRNA and RNP;

[0049] Fig.14 This is a graph showing the silencing efficiency and specificity of the TaqTth-T single plasmid in Example 7 for overexpressing APPswe mRNA in HEK 293T cells;

[0050] Fig.15 It is a schematic diagram of the experimental design and effect results of the AAV-TaqTth-T knockout APPswe mRNA in the 5×FAD transgenic mouse model of Example 8;

[0051] Fig.16 This is a result diagram regarding the effect of APPswe mRNA on the body weight and brain weight of mice in the AAV-TaqTth-T knockout 5×FAD transgenic mouse model of Example 9;

[0052] Fig.17 This is a diagram showing the effect of APPswe mRNA on improving the spatial learning and memory function of mice in the AAV-TaqTth-T knockout 5×FAD transgenic mouse model of Example 10;

[0053] Fig.18 This is a diagram showing the effect of APPswe mRNA on the pathological characteristics of mice in the AAV-TaqTth-T knockout 5×FAD transgenic mouse model of Example 11;

[0054] Fig.19 This is a schematic diagram of the design of constructing an AAV vector using TaqTth-T and APOE2 in tandem in Example 12;

[0055] Fig. 20 This is a graph comparing the results of Example 13 in terms of the effects of AAV-TaqTth-T-APOE2 and AAV-TaqTth-T in inhibiting AD pathology. DETAILED DESCRIPTION

[0056] The technical solution of the present invention is described in detail below through specific embodiments, but the protection scope of the present invention is not limited to the embodiments.

[0057] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0058] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0059] Example 1 RNA probe mediates TaqTth protein cleavage of mammalian cell mRNA

[0060] In order to investigate whether TaqTth protein can cut target mRNA in human cells, we need to exclude genomic DNA from the investigation space. It is known that there is mRNA but no genomic DNA in the cytoplasm, so we inserted the coding sequence encoding TaqTth recombinant protein (nucleotide sequence as shown in SEQ ID NO.1, encoded amino acid sequence as shown in SEQ ID NO.2) into the commercial eukaryotic cell expression vector pcDNA3.1+N-HA (purchased from GenScript), and added a nuclear export sequence (NES, nucleotide sequence is 5'-CTTCAACTGCCTCCACTTGAAAGACTGACACTG, amino acid sequence is LQLPPLERLTL) at the C-terminus or N-terminus, respectively, to construct the recombinant protein plasmids pcDNA3.1-N-HA-NES-TaqTth and pcDNA3.1-N-HA-TaqTth-NES to ensure that the TaqTth recombinant protein can be expressed in the cytoplasm. At the same time, we also constructed pcDNA3.1-N-HA-TaqTth without NES as a reference. The above three recombinant plasmids were transfected into HepG2 cells (purchased from ATCC), and nuclear localization confocal and WB experiments were performed through HA tag (nucleotide sequence 5'-TACCCATACGATGTTCCAGATTACGCT, amino acid sequence YPYDVPDYA), proving that they can be fully expressed in the cytoplasm of HepG2 cells. Then, targeted probes were designed to cut the mRNA of endogenous genes and detect efficiency.

[0061] SEQ ID NO.1:

[0062] atgcctaagaagaagcggaaggtgggcggtagtatgagggggatgctgcccctctttgagcccaagggccgggtcctcctggtggacggccaccacct

[0063] ggcctaccgcaccttccacgccctgaagggcctcaccaccagccggggggagccggtgcaggcggtctacggcttcgccaagagcctcctcaaggcc

[0064] ctcaaggaggacggggacgcggtgatcgtggtctttgacgccaaggccccctccttccgccacgaggcctacggggggtacaaggcgggccgggccc

[0065] ccacgccggaggactttccccggcaactcgccctcatcaaggagctggtggacctcctggggctggcgcgcctcgaggtcccgggctacgaggcgga

[0066] cgacgtcctggccagcctggccaagaaggcggaaaaggagggctacgaggtccgcatcctcaccgccgacaaagacctttaccagctcctttccgacc

[0067] gcatccacgccctccaccccgagggctacctcatcaccccggcctggctttgggaaaagtacggcctgaggcccgaccagtgggccgactaccgggcc

[0068] ctgaccggggacgagtccgacaaccttcccggggtcaagggcatcggggagaagacggcgaggaagcttctggaggagtgggggagcctggaagc

[0069] cctcctcaagaacctggaccggctgaagcccgccatccgggagaagatcctggcccacatggacgatctgaagctctcctgggacctggccaaggtgc

[0070] gcaccgacctgcccctggaggtggacttcgccaaaaggcgggagcccgaccgggagaggcttagggcctttctggagaggcttgagtttggcagcctc

[0071] ctccacgagttcggccttctggaaagccccaaggccctggaggaggccccctggcccccgccggaaggggccttcgtgggctttgtgctttcccgcaag

[0072] gagcccatgtgggccgatcttctggccctggccgccgccagggacggccgggtgcaccgggcagcagaccccttggcggggctaaaggacctcaag

[0073] gaggtccggggcctcctcgccaaggacctcgccgtcttggcctcgagggaggggctagacctcgtgcccggggacgaccccatgctcctcgcctacct

[0074] cctggacccctccaacaccacccccgagggggtggcgcggcgctacgggggggagtggacggaggacgccgcccaccgggccctcctctcggaga

[0075] ggctccatcggaacctccttaagcgcctcgagggggaggagaagctcctttggctctaccacgaggtggaaaagcccctctcccgggtcctggcccaca

[0076] tggaggccaccggggtacggcgggacgtggcctaccttcaggccctttccctggagcttgcggaggagatccgccgcctcgaggaggaggtcttccgc

[0077] ttggcgggccaccccttcaacctcaactcccgggaccagctggaaagggtgctctttgacgagcttaggcttcccgccttggggaagacgcaaaagaca

[0078] ggcaagcgctccaccagcgccgcggtgctggaggccctacgggaggcccaccccatcgtggagaagatcctccagcaccgggagctcaccaagctc

[0079] aagaacacctacgtggaccccctcccaagcctcgtccacccgaggacgggccgcctccacacccgcttcaaccagacggccacggccacggggagg

[0080] cttagtagctccgaccccaacctgcagaacatccccgtccgcacccccttgggccagagaatccgccgggccttcatcgccgaggaggggtggctattg

[0081] gtggccctggactatagccagatagagctcagggtgctggcccacctctccggcgacgagaacctgatccgggtcttccaggaggggcgggacatcca

[0082] cacggagaccgccagctggatgttcggcgtcccccgggaggccgtggaccccctgatgcgccgggcggccaagaccatcaacttcggggtcctctac

[0083] ggcatgtcggcccaccgcctctcccaggagctagccatcccttacgaggaggcccaggccttcattgagcgctactttcagagcttccccaaggtgcggg

[0084] cctggattgagaagaccctggaggagggcaggaggcgggggtacgtggagaccctcttcggccgccgccgctacgtgccagacctagaggcccggg

[0085] tgaagagcgtgcgggaggcggccgagcgcatggccttcaacatgcccgtccagggcaccgccgccgacctcatgaagctggctatggtgaagctcttc

[0086] cccaggctggaggaaatgggggccaggatgctccttcaggtccacgacgagctggtcctcgaggccccaaaagagagggcggaggccgtggcccggctggccaaggaggtcatggagggggtgtatcccctggccgtgcccctggaggtggaggtggggataggggaggactggctctccgccaaggagtga。SEQ ID NO.2:

[0087] .

[0088] Specifically: (A) Construction of a recombinant plasmid for extranuclear expression of TaqTth protein

[0089] PCR primers (purchased from Shanghai Sangon Biotechnology, F: upstream primer sequence; R: downstream primer sequence):

[0090] When constructing pcDNA3.1-N-HA-NES-TaqTth:

[0091] N-TaqTth-NES-KpnI-F:

[0092] 5'-TATAGGTACCATGCTTCAACTGCCTCCACTTGAAAGACTGACACTGGGCGGTAGTATGAGGGGGATGCTGCCCCT

[0093] N-TaqTth-NotI-R:

[0094] 5'-TATAGGTACCATGAGGGGGATGCTGCCCCT

[0095] When constructing pcDNA3.1-N-HA-TaqTth-NES:

[0096] C-TaqTth-KpnI-F:

[0097] 5'-TATAGCGGCCGCTTACTCCTTGGCGGAGAGCC

[0098] C-TaqTth-NES-NotI-R:

[0099] 5'-TATAGCGGCCGCTTACAGTGTCAGTCTTTCAAGTGGAGGCAGTTGAAGACTACCGCCCTCCTTGGCGGAGAGCC

[0100] When constructing pcDNA3.1-N-HA-TaqTth:

[0101] TaqTth-KpnI-F:

[0102] 5'-TATAGGTACCATGAGGGGGATGCTGCCCCT

[0103] TaqTth-NotI-R:

[0104] 5'-TATAGCGGCCGCTTACTCCTTGGCGGAGAGCC

[0105] Amplification template: Thermus aquaticus and Thermus thermophilus genomes, purchased from ATCC, bio-110431, bio-00181.

[0106] PCR reaction system: template 1 μL, upstream and downstream primers 0.4 μL each, PrimerSTAR enzyme (Takara, Japan) 0.2 μL, Buffer (Takara, Japan) 4 μL, dNTP 1.6 μL, ddH2O to 20 μL.

[0107] PCR reaction conditions: 98°C for 3 min; (98°C for 10 s, 65°C for 5 s, 72°C for 2 min and 40 s) × 35 cycles; 4°C forever.

[0108] Enzyme digestion system: Take 1μg of the target gene fragment and backbone plasmid obtained by PCR amplification, add 1μL KpnI and NotI (Takara, Japan) at the same time, perform "double enzyme digestion", incubate at 37℃ for 1h, and after agarose gel electrophoresis shows successful enzyme digestion, use the Novozyme gel recovery kit (including Buffer GDP and Buffer GW) to recover the target gene fragment and vector backbone. Quickly cut the gel containing the target DNA fragment under ultraviolet light and weigh it. 100mg gel is equivalent to 100μL volume, which is used as a gel volume. Add an equal volume of Buffer GDP. Incubate in a water bath at 50-55℃ for 7-10min, transfer the sol to the adsorption column, and centrifuge at 12,000rpm for 30-60sec. Discard the filtrate and place the adsorption column in a collection tube. Add 300μL Buffer GDP to the adsorption column. Let stand for 1min. 12,000 rpm, centrifuge for 30 seconds, discard the filtrate, add 700 μL Buffer GW to wash twice, centrifuge at 12,000 rpm for 30 seconds each time. Let it air at room temperature for 5 minutes, add 20 μL water to elute. Use Nano Drop (Thermo Fisher Scientific, USA) to measure the concentration and set aside.

[0109] T4 ligation system: 0.3 pmoL target gene fragment, 0.03 pmoL plasmid backbone, 1 μL T4 DNA polymerase (Takara, Japan), 1 μL 10×T4 DNA Ligase Buffer (Takara, Japan), ddH2O to 20 μL, ligation at 4°C overnight.

[0110] Transformation and seed preservation: 10 μL of ligation product was added to the E. coli DH5α chemical competent cells (Nanjing Novozyme Biotechnology Co., Ltd.) thawed on ice by heat shock method, mixed evenly, ice bathed for 30 minutes, 42°C, 1min 30s, placed on ice for 2.5 minutes, added 1mL of non-antibiotic LB medium, 37°C, 220rpm, 37°C shaking culture for 50 minutes, centrifuged at 2500rpm for 5 minutes, and discarded 900 μL LB. About 100 μL of bacterial solution was applied to the surface of Kana resistant LB solid culture medium, and after the bacterial solution was absorbed by the plate, it was inverted and cultured at 37°C overnight.

[0111] After transformation, three well-growing plaques were randomly selected and added to a centrifuge tube containing 4 mL of the corresponding resistance medium. The culture was carried out at 37 °C for 12 h, and then 400 μL of the bacterial solution was aliquoted and sent to Shanghai Shenggong Biotechnology Co., Ltd. for Sanger sequencing. The sequencing results were analyzed by Snapgene to confirm that the recombinant plasmid was successfully constructed. The remaining bacterial solution was preserved with 50% glycerol and named pcDNA3.1-N-HA-NES-TaqTth; pcDNA3.1-HA-TaqTth-NES; pcDNA3.1-TaqTth-NES.

[0112] (B) Verification of extranuclear expression of recombinant plasmids in human cell lines

[0113] Plasmid transfection: Inoculate human liver cancer HepG2 cells (ATCC) into a T25 cell culture flask at an appropriate density and add 5 mL of complete culture medium (DMEM + 10% fetal bovine serum). Culture in an incubator at 37°C and 5% CO2. The cells adhere to the wall and grow, and when the cell density reaches about 90%, they are passaged. The specific passage method is as follows: First, discard the culture medium in the flask and wash away the remaining culture medium with PBS buffer. Next, add trypsin digestion solution, digest at room temperature for 1 minute, and then discard the digestion solution. After the cells become round under the microscope, add culture medium to terminate digestion. Finally, use a pipette to blow off the residual cells on the flask wall, mix the cell suspension evenly, and inoculate it into a new culture flask at a ratio of 1 to 3 to continue culturing.

[0114] Human hepatocellular carcinoma HepG2 cells were cultured at 3×10 5 The cells were seeded into a 6-well plate at a density of 100 μg / well 24 h in advance. Fresh medium was replaced 1 h before transfection. Transfection sample: 2 μg of plasmid was added to 200 μL serum-free medium, and then 6 μL TransIntro TM ELTranfection Reagent (Quanshijin Biotechnology Co., Ltd.), gently mix. Let stand at room temperature for 15 minutes, add the incubated transfection mixture to the six-well plate, and replace with fresh culture medium after 8 hours.

[0115] Immunofluorescence experimental steps:

[0116] (1) Slide: Human liver cancer HepG2 cells were seeded in a 6-well plate (a polylysine-coated round cell slide was placed in the 6-well plate), and transfected after the cell density reached 50%, and cultured for 48-72 hours. (2) Fixation: Gently rinse the slide with cells in PBS for 3 times, 5 minutes each time. Add 2 mL of 4% paraformaldehyde (in PBS) and fix at room temperature for 20 minutes. (3) Permeabilization: Gently rinse the slide in PBS for 3 times, 5 minutes each time. Permeabilize in 0.2% Triton X-100 (in PBS) in a 4°C refrigerator for 15 minutes. (4) Blocking: Gently rinse the slide in PBS for 3 times, 2 minutes each time. Block with 3% BSA (in PBS) solution for 1 hour. (5) Primary antibody binding: Dilute the HA-tag primary antibody (AE008, ABclonal) to an appropriate concentration (1 / 1000) in PBS and incubate overnight at 4°C. (6) Secondary antibody binding: Rinse the slide in PBS for 3 times, 5 minutes each time. Fluorescent secondary antibody (A-11001, Thermo Fisher Scientific) was diluted to an appropriate concentration (1 / 1000) with PBS and incubated at room temperature in the dark for 1 hour. All subsequent operations were performed in the dark. (7) Nuclear staining: Gently soak the slide in PBS 3 times, 5 minutes each time. Carefully blot the liquid on the slide with absorbent paper, add anti-fluorescence quencher containing DAPI to the four corners of the slide, carefully drain until it is evenly distributed, and cover the slide with the cell surface on the slide. (8) Photography: Fix the opposite corner of the slide, air-dry and fix it, and then shoot random fields of view with a laser confocal microscope.

[0117] WB experimental steps:

[0118] (1) Sample collection: HepG2 cells were cultured at 3.5×10 5Cells were inoculated at a density of 100 cells / well in a six-well plate. When the cell density reached 80%, plasmid DNA was transfected and cells were collected after 48-72 hours of culture. (2) Protein extraction: cells from the experimental group and the control group were collected, and slowly rinsed twice with PBS preheated to room temperature. PBS was discarded. After digestion, cells were collected into EP tubes. Centrifuged at 4°C 2500rpm for 5 minutes and the supernatant was discarded. An appropriate amount of protein lysis buffer (RIPA cell lysis buffer, Thermo Fisher Scientific) was added, cells were carefully resuspended, and placed on ice for 1 hour. During this period, the EP tube was flicked every 15 minutes to completely lyse the cells. Centrifuged at 4°C 14000rpm for 20 minutes, the cell lysate (supernatant) was collected and the volume was recorded, which was the total protein. (3) Protein quantification and denaturation: The protein concentration was determined by the BCA method. The quantified protein was mixed with 4× loading buffer (prepared with Tris-HCl 30mL pH 6.8, SDS 4g, bromophenol blue 0.2g, glycerol 20mL) at a volume ratio of 1 / 3, and denatured at 100℃ for 9min. After cooling, it was placed in a -20℃ refrigerator away from light. (4) Electrophoresis: Use SDS-PAGE gel (SDS-polyacrylamide gel) of appropriate concentration, add protein samples to the lanes, and record the loading order. Start at 65V for 20min, then run at 135V until the loading buffer seeps out of the gel plate to terminate the electrophoresis. (5) Transfer: After the electrophoresis procedure is completed, cut the NC membrane and Whatman filter paper of appropriate size, gently peel the polyacrylamide gel from the gel plate, and lay a layer of thick filter paper on the top and bottom, with the gel and membrane in the middle ("sandwich" structure), with the membrane at the positive electrode and the gel at the negative electrode. Use a glass rod to gently push to remove the bubbles between the gel and the membrane. The entire transfer operation is performed in the transfer buffer. Carefully place the transfer device in the transfer tank, use wet transfer, and use a constant current of 250mA. Heat will be generated during transfer. Place an ice brick on one side of the transfer tank to cool it down. The transfer time is generally 2h. (6) Ponceau red staining: Immerse the nitrocellulose membrane with protein in the Ponceau red working solution, stain it thoroughly, rinse it with ultrapure water, observe the transfer situation, cut the NC membrane at the position of the target protein into strips, and rinse it with PBS 3 times until it is decolorized. (7) Blocking: Immerse the band containing the target protein in the freshly prepared 3.3% BSA (1g BSA + 30mL PBST) solution, place it on a decolorizing shaker, and shake gently at room temperature for 1 hour. (8) Binding antibody: HA-tag primary antibody (AE008, ABclonal) was diluted to an appropriate concentration (1 / 1000) with 3.3% BSA solution, and incubated overnight with gentle shaking at 4°C. After incubation with the primary antibody, the NC membrane was rinsed with PBST three times, each time for 8 minutes. The secondary antibody (AS061, ABclonal) was diluted to an appropriate concentration (1 / 10000) with PBST and incubated on a shaker at room temperature for 1 hour.(9) Blot detection: Rinse with PBST three times, 8 min each time. After rinsing, add ECL fluorescent substrate at 0.1 mL / cm. 2 The reagent dosage was 1:1, and solution A and solution B were mixed evenly to prepare the exposure solution. The bands were exposed and analyzed by Amersham Imager 600 (GE Healthcare).

[0119] The experimental results are as follows Figure 1 As shown: WB experiments have shown that compared with the negative control group without the expression plasmid, NES can detect the efficient expression of the target protein regardless of whether it is inserted into the N-terminus or the C-terminus of the TaqTth protein (see Figure 1 Immunofluorescence experiments have shown that whether NES is inserted at the N-terminus or C-terminus of TaqTth protein, the target protein can be expressed normally and efficiently in the cytoplasm. On the contrary, if there is no NES, it will be partially expressed in the nucleus (see Figure 1 B).

[0120] (C) RNA probe plasmid construction

[0121] Design RNA probe plasmid pU6-target, its basic sequence and structure are shown in Figure 2 As shown, it contains a guide region complementary to the target and a hairpin stem-loop structure, and the hairpin is a fixed structure (5'-AAAGTCGGCCGAAAGGCCGACTTTTTT). Such an RNA probe is referred to as a 3'hpRNA probe, and its sequence is mediated by the U6 promoter on the vector plasmid pU6-gRNA (purchased from Shanghai Haijihaoge Company) in the cell for transcription initiation. In order to obtain an RNA probe plasmid for a specific mRNA sequence, different primers are designed, and after annealing the upstream and downstream primers, they are inserted into the vector plasmid pU6-gRNA backbone.

[0122] Specifically:

[0123] Design primers: Select the mRNA sequence you want to target, and add bases at the 5' and 3' ends of the sense strand that are complementary to the sticky ends of the vector plasmid pU6-gRNA after enzyme digestion (the upstream primer has CACC at the 5' end and AGCT at the 3' end), and synthesize them in the form of an oligonucleotide chain.

[0124] Enzyme digestion system: Take 1 μg of the vector plasmid pU6-gRNA backbone plasmid, add 1 μL Sac I and 1 μL Bbs I (Takara, Japan), perform "double enzyme digestion", incubate at 37°C for 1 hour, and after agarose gel electrophoresis shows successful enzyme digestion, use the Novozyme gel recovery kit to recover the vector backbone.

[0125] Enzyme ligation system: dilute the two synthesized oligonucleotides with water to 10 μM, then prepare a 10 μL system in a 1:1 ratio for annealing (95°C, 5 min) to form a double-stranded DNA fragment with sticky ends. The product is diluted for use. 0.3 pmoL target gene fragment, 0.03 pmoL plasmid backbone, 1 μL T4 DNA polymerase (Takara, Japan), 1 μL 10×T4 DNA Ligase Buffer (Takara, Japan), ddH2O to 20 μL, ligation at 4°C overnight. The steps of gel excision recovery, transformation and seed preservation are detailed in Example 1.

[0126] (D) Cleavage of mammalian cell transcripts

[0127] First, the ability of the RNA probe to mediate the cleavage of the green fluorescent protein (EGFP) mRNA by the TaqTth protein was tested. Figure 3 As shown in A, cells were cultured at 8×10 4 The cells were inoculated at a density of 100 / well in a 24-well plate, and the recombinant plasmid of TaqTth protein and the RNA probe plasmid were transferred into the cells 24 hours later.

[0128] Transfection samples: In 50 μL serum-free culture medium, the amount of EGFP fluorescent protein plasmid, RNA probe plasmid, and TaqTth protein recombinant plasmid added was 0.20 μg, 0.90 μg, and 0.60 μg, respectively. The plasmids were co-transfected into cells, and 0.20 μg of EGFP-expressing plasmid (purchased from Miaoling Biotechnology Co., Ltd.), 0.60 μg of TaqTth protein recombinant plasmid, and 0.90 μg of RNA probe plasmid (targeting site is EGFP mRNA T2 in Table 1) were added. Then 5 μL TransIntro TM EL Tranfection Reagent, gently mix. Let stand at room temperature for 15 minutes. Add the incubated transfection mixture to the 24-well plate, and replace with fresh medium after 8 hours. Harvest the cells after 72 hours, and then use flow cytometry to detect the EGFP expression level. Figure 3 As shown in B, in the NES-TaqTth group (NES at the N-terminus of TaqTth), the percentage of EGFP-positive cells decreased from 22.7% to 14.8% compared with the NT (non-targeted) control group. In contrast, no similar decrease was observed in the TaqTth-NES group. This indicates that NES should be added to the N-terminus of TaqTth to mediate the degradation and downregulation of exogenous mRNA. Figure 3As shown in Figure C, when the 3'hpRNA probe was anchored to different sites of EGFP mRNA (T1, T2, T3, T4 and T5 sites, see Table 1), the relative expression levels of EGFP in the transfected NES-TaqTth and hpRNAs groups were 0.604, 0.395, 0.507, 0.618 and 0.485, respectively, relative to the NT control group. The percentage of EGFP-positive cells decreased from 22.4% in the NT control group to 14.2%, 11.2%, 15.8%, 16.2% and 14.0%, respectively. When a mixture of hpRNAs was used to inhibit the expression of EGFP, 64% inhibition was mediated.

[0129] Next, the ability of RNA probe to mediate TaqTth protein cleavage of endogenous gene mRNA was tested. Six RNA probe plasmids targeting different positions of the endogenous gene KRAS mRNA were designed (see Table 1) to mediate TaqTth protein cleavage of the target gene mRNA. Cells were cultured at 8×10 4 The cells were inoculated at a density of 100 / well in a 24-well plate, and the recombinant plasmid of TaqTth protein and the RNA probe plasmid were transferred into the cells 24 hours later.

[0130] Transfection sample: Add 0.8 μg TaqTth protein recombinant plasmid and 1.0 μg RNA probe plasmid to 50 μL serum-free medium. Then add 5 μL TransIntro TM EL Tranfection Reagent, gently mix. Let stand at room temperature for 15 minutes. Add the incubated transfection mixture to a 24-well plate and replace with fresh culture medium after 8 hours. After 72 hours, harvest the cells, extract RNA (Vazyme, R701-01 / 02), reverse transcribe into cDNA (Vazyme, R312-01), and then use real-time qPCR (Vazyme-MR101-01) to absolutely quantify the transcription amount of KRAS (see Table 2 for qPCR primer sequences), and analyze the changes in KRAS mRNA abundance by qPCR. Figure 4 As shown in A, compared with the control group of irrelevant probe plasmids, the experimental group reduced the abundance of KRAS mRNA expression, among which the T4 probe with the best effect had a silencing efficiency of about 71%. Similarly, targeted editing of PPIB mRNA (see Table 1) showed the following results: Figure 4 As shown in B (qPCR primer sequences are shown in Table 2), the silencing efficiency mediated by the best T5 probe was about 62%.

[0131] Table 1 Selection of EGFP, KRAS, and PPIB targeting sites

[0132] Locus 5'-3'sequence egfp mRNA T1 GAGCUGGACGGCGACGUAAACGGC egfp mRNA T2 AAGUUCAGCGUGUCCGGCGAGGGC egfp mRNA T3 ACGGCAACUACAAGACCCGCGCCG egfp mRNA T4 CGCGCCGAGGUGAAGUUCGAGGGC egfp mRNA T5 ACGAGAAGCGCGAUCACAUGGUCC kras mRNA T1 AUGACUGAAUAUAAACUUGU kras mRNA T2 UCCUACAGGAAGCAAGUAGU kras mRNA T3 AAAUCAUUUGAAGAUAUUCACCAUUAUA kras mRNA T4 GAAAUAAAUGUGAUUUGCCU kras mRNA T5 GAGGAUGCUUUUUAUACAUU kras mRNA T6 AAAAAUGCAUUAUAAUGUAA ppib mRNA T1 AUGCUGCGCCUCUCCGAACG ppib mRNA T2 GCCCAAAGUCACCGUCAAGG ppib mRNA T3 ACAGCAAAUUCCAUCGUGUAAUCAAGGA ppib mRNA T4 GCGCUUCCCCGAUGAGAACUUCAAACUG ppib mRNA T5 UCUUCAUCACGACAGUCAAG ppib mRNA T6 UUGCCAUCGCCAAGGAGUAG

[0133] Table 2 qPCR primers for endogenous genes KRAS and PPIB

[0134] <![CDATA[Name a ]]> Sequence(5'-3') KRAS-F ACAGTAGACACAAAACAGGCTCAGG KRAS-R CCTCCACTCTCTGTCTTGTCTTTGC PPIB-F AGGAGGAAAGAGCATCTACGGTGAG PPIB-R CAGGCTGTCTTGACTGTCGTGATG GAPDH-F TAGTGGAAGGACTCATGACC GAPDH-R TCCACCACCCTGTTGCTGTA

[0135] (E) Base matching pattern of RNA probe-mediated TaqTth protein cleavage of mRNA

[0136] To determine the potential sequence requirements for RNA probe-mediated TaqTth protein cleavage of mammalian cell transcripts, we analyzed the frequency of the four bases at positions 1-4 of the 5' end of the targeting site (corresponding to the position of the PFS in CRISPR / Cas13a), such as Figure 5 As shown, blue, orange, gray, and yellow represent the probability of occurrence of A, C, G, and U, respectively, and the four circular circles from the inside to the outside indicate the base distribution at the 1st, 2nd, 3rd, and 4th sites of the 5' wing. The statistical results show that the distribution probabilities of the four bases A, C, G, and U at the 5' wing of site 1 are 35%, 29%, 18%, and 18%, respectively; the distribution probabilities of the four bases A, C, G, and U at the 5' wing of site 2 are 35%, 23%, 18%, and 24%, respectively; the distribution probabilities of the four bases A, C, G, and U at the 5' wing of site 3 are 35%, 23%, 18%, and 24%, respectively; the distribution probabilities of the four bases A, C, G, and U at the 5' wing of site 4 are 35%, 24%, 29%, and 12%, respectively; no obvious sequence preference was observed. Unlike the reported Cas13a, and similar to Cas13d, our TaqTth-3'hpRNA strategy did not show an obvious sequence-fixed base pairing pattern.

[0137] The above results demonstrate the ability of the TaqTth-3'hpRNA strategy to cleave mammalian mRNA, and the TaqTth-3'hpRNA strategy does not require a fixed base pairing pattern for the target sequence.

[0138] Example 2 Comparison of RNA probe-mediated TaqTth protein composition and siRNA

[0139] To further explore whether the TaqTth-3'hpRNA composition would cause severe cytotoxicity and off-target effects, we compared it with siRNA (see Table 3) at the same target site.

[0140] Specifically:

[0141] (A) Comparison of toxicity between TaqTth-3'hpRNA composition and siRNA

[0142] HEK293T cells (ATCC) were cultured at 8×10 3The cells were inoculated into a 96-well plate at a density of 100 μg / well 24 h in advance, and fresh culture medium was replaced 30 min after transfection. For the combined enzyme group, 0.12 μg of TaqTth protein recombinant plasmid and 0.08 μg of probe plasmid were added to 10 μL serum-free culture medium; 0.65 μL TransIntro TM EL Tranfection Reagent, gently mix. When transfecting siRNA, add 10pmol siRNA (Sangon Biotechnology) and 0.65μL TransIntro TM ELTranfection Reagent, gently mix. Let stand at room temperature for 15 minutes, add the incubated transfection mixture to the 96-well plate, and replace with fresh culture medium after 8 hours. After the transfected cells are cultured for 48 hours, the CCK-8 kit is used to detect the proliferation ability of cells in the treatment group and the control group using irrelevant probes (the irrelevant probe here is a probe that has no correlation with the target sequence, which is the probe of the control NT group, and its amino acid sequence is: GCATATTTCATGAGAGCATCTAAAGTCGGCCGAAAGGCCGACTTTTTT). Add 800μL CCK8 solution to 8mL complete culture medium to prepare a proliferation detection solution. When testing, add 100μL of this proliferation detection solution to the cell wells of the 96-well plate. Set up 5 blank wells and add 100μL of this proliferation detection solution as the background for subsequent OD value measurement. Incubate in a 37℃, 5% CO2 incubator for 1 hour, and measure the absorbance at 450nm with an enzyme reader. Calculate the cell survival rate compared with the control group transfected with irrelevant probes. Cell survival rate: Subtract the background OD value (blank group) from the OD value of each test well, and take the average ± SD of the OD values ​​of each replicate well. Cell survival rate % = (experimental cell OD / control cell OD) × 100%.

[0143] like Figure 6 As shown in A, when EGFP mRNA was knocked down in HEK293T cells, similar reduction levels were observed with TaqTth-3'hpRNA and siRNA strategies, which were 43.9% and 49.5% relative to their respective control groups, respectively. Meanwhile, the cell toxicity was evaluated by CCK8 assay, and the viability of cells treated with TaqTth-3'hpRNA and siRNA strategies was 96.1% and 81.5%, respectively.

[0144] Similar investigations were performed on the knockdown of endogenous KRAS and PPIB mRNA. Figure 6As shown in B, when targeting the endogenous KRAS gene locus-1, the knockdown efficiency of TaqTth-3'hpRNA was 68.66%, the knockdown efficiency of siRNA was 56.23%, the cell survival rate of the TaqTth-3'hpRNA treatment group was 102.75%, and the cell survival rate of the siRNA treatment group was 63.33%; when targeting the endogenous KRAS gene locus-2, the knockdown efficiency of TaqTth-3'hpRNA was 71.87%, the knockdown efficiency of siRNA was 31.20%, the cell survival rate of the TaqTth-3'hpRNA treatment group was 92.66%, and the cell survival rate of the siRNA treatment group was 74.81%. Figure 6 As shown in Figure C, when targeting the endogenous PPIB gene locus-1, the knockdown efficiency of TaqTth-3'hpRNA was 17.77%, the knockdown efficiency of siRNA was 21.90%, the cell survival rate of the TaqTth-3'hpRNA treatment group was 89.99%, and the cell survival rate of the siRNA treatment group was 97.85%; when targeting the endogenous PPIB gene locus-2, the knockdown efficiency of TaqTth-3'hpRNA was 66.32%, the knockdown efficiency of siRNA was 28.79%, the cell survival rate of the TaqTth-3'hpRNA treatment group was 28.79%, and the cell survival rate of the siRNA treatment group was 64.99%.

[0145] Overall, the TaqTth-3'hpRNA strategy showed similar knockdown efficiency as siRNA, but with better cell survival and less cytotoxicity.

[0146] Table 3 siRNA sequences

[0147] Locus 5'-3'sequence egfp mRNA T1 GAGCUGGACGGCGACGUAAACGGC kras mRNA T1 AUGACUGAAUAUAAACUUGU ppib mRNA T1 AUGCUGCGCCUCUCCGAACG siRNA-egfp AAGTTCAGCGTGTCCGGCGAGGGC siRNA-kras AAATCATTTGAAGATATTCACCATTATA siRNA-ppib GCGCTTCCCCGATGAGAACTTCAAACTG

[0148] (B) Comparison of off-target effects of TaqTth-3' hpRNA composition and siRNA

[0149] To further detect the incidental cleavage effects and off-target effects of TaqTth-3'hpRNA and siRNA, we performed total RNA integrity analysis and transcript RNA-seq analysis on HepG2 cells transfected with TaqTth-3'hpRNA and treated with siRNA, respectively.

[0150] When performing total RNA integrity analysis: after total RNA was extracted from the samples of the TaqTth-3'hpRNA treatment group and the samples of the siRNA treatment group, equal amounts of samples were loaded on 1% non-denaturing agarose gel, and the integrity of RNA was detected by electrophoresis.

[0151] For transcript RNA-seq analysis: Extract total RNA from cells. Use 1.00 μg RNA per sample as input material for RNA-seq sample preparation. Use VAHTSTM mRNA-seq V2 Library Prep Kit for Illumina (NEB, USA). Library preparation Sequencing libraries were prepared and index codes were added to the attribute sequences of each sample. In order to optimize cDNA fragments of 150-200 bp in length, library fragments were purified using the AMPure XP system (Beckman Coulter, Beverly, USA). After purification, PCR and PCR product purification were performed, and the library quality was assessed on the Agilent Bioanalyzer 2100 system. The libraries were then quantified and merged. Paired-end sequencing of the libraries was performed on a NovaSeq sequencer (Illumina, San Diego, CA). TPM (transcripts per million) eliminates the effects of gene length and sequencing differences, enabling direct comparison of gene expression between samples. DESeq2 (version 1.12.4) was used to determine differentially expressed genes (DEGs) between two samples. q-value ≤ 0.001, |FoldChange| ≥ 2, genes were considered to be significantly differentially expressed. When the normalized expression of a gene between two samples was 0, its expression was adjusted to 0.01 (because 0 cannot be plotted on a logarithmic graph). If the normalized expression of a gene in both libraries was lower than 1, further differential expression analysis was performed without that gene. Gene expression differences were visualized using volcano plots.

[0152] First, a significant decrease in RNA integrity was observed in total RNA from the siRNA-treated group ( Figure 7 A), while the TaqTth-3'hpRNA treatment group did not have this phenomenon. Compared with siRNA, TaqTth-3'hpRNA caused fewer off-target genes (26 vs 2194) ( Figure 7 B). Unlike the TaqTth-3'hpRNA group, we also observed extensive off-target transcript degradation in the siRNA-treated group ( Figure 7 C), about 1084 and 1110 genes showed significant off-target up-regulation and off-target down-regulation trends, respectively. Further analysis showed that these off-target genes were highly distributed in various biological processes, including growth, movement, metabolic processes, etc. These results are consistent with previous reports that siRNA-induced degradation of a large number of host transcripts can lead to slow cell growth. This shows that the TaqTth-3'hpRNA strategy has lower incidental cleavage and off-target degradation and better specificity.

[0153] In addition, we analyzed eight potential off-target gene sites that had sequence similarity to PPIB mRNA, such as Figure 7 D, The siRNA group generally has different degrees of off-target knockdown, but the TaqTth group has better specificity. Given the partial homology between TaqTth and FEN1, we infer that the TaqTth-3'hpRNA strategy has a mismatch-sensitive "seed region", especially the bases near the hairpin region. Several potential off-target gene sites have mismatches in this region, and the tolerance rate is very low, which helps to reduce the off-target rate and avoid continuous annealing between potential off-target sites and bases near the "stem-loop" structure in the guide sequence.

[0154] The above results indicate that TaqTth-3'hpRNA is less toxic and has fewer off-target effects than siRNA.

[0155] Example 3 RNA probe-mediated TaqTth protein composition specifically knocks out APP mutant gene at the cellular level

[0156] In order to give full play to its specific advantages, we chose to knock out the APP mutant gene (abbreviated as APP swe ), thereby inhibiting the production of APP protein and reducing the production of Aβ in the brain. swe mRNA and APP wild gene (abbreviated as APP wt ) differ by only two bases.

[0157] Specifically:

[0158] (A) Screening of highly efficient and specific probes

[0159] In order to screen efficient and highly specific probes, we designed a fluorescent reporter system, such as Figure 8 As shown, the APP swe or APP wt Coding sequence (APP swe The nucleotide sequence is shown in SEQ ID NO.3, APP wt The nucleotide sequence is shown in SEQ ID NO.4) and fused to the EGFP or mCherry coding gene, respectively, to construct a fluorescent reporter plasmid, which was then transferred into HepG2 cells to screen for a guide sequence of appropriate length (see Table 4 for the guide sequence). The fluorescence intensity can be used to reflect the expression of APP swe or APP wt Knockdown level of mRNA.

[0160] SEQ ID NO.3:

[0161] atgctggccccggtttggcactgctcctgctggccgcctggacggctcgggcgctgggaggtacccactgatggtaatgctggcctgctggctgaaccccaga

[0162] ttgccatgttctgtggcagactgaacatgcacatgaatgtccagaatgggaagtgggattcagatccatcagggaccaaaacctgcattgataccaaggaa

[0163] ggcatcctgcagtattgccaagaagtctaccctgaactgcagatcaccaatgtggtagaagccaaccaaccagtgaccatccagaactggtgcaagcggg

[0164] gccgcaagcagtgcaagacccatccccactttgtgattccctaccgctgcttagttggtgagtttgtaagtgatgcccttctcgttcctgacaagtgcaaattct

[0165] tacaccaggagaggatggatgtttgcgaaactcatcttcactggcacaccgtcgccaaagagacatgcagtgagaagagtaccaacttgcatgactacgg

[0166] catgttgctgccctgcggaattgacaagttccgaggggtaggtttgtgtgttgcccactggctgaagaaagtgacaatgtggattctgctgatgcggagga

[0167] ggatgactcggatgtctggtggggcggagcagacacagactatgcagatgggagtgaagacaaagtagtagaagtagcagaggaggaagaagtggct

[0168] gaggtggagaagaagaagccgatgatgacgaggacgatgaggatggtgatgaggtagaggaagaggctgaggaaccctacgaagaagccacaga

[0169] gagaaccaccagcattgccaccaccaccaccaccaccacagagtctgtggaagaggtggttcgagaggtgtgctctgaacaagccgagacggggccgt

[0170] gccgagcaatgatctcccgctggtactttgatgtgactgaagggaagtgtgccccattcttttacggcggatgtggcggcaaccggaacaactttgacacag

[0171] aagagtactgcatggccgtgtgtggcagcgccatgtcccaaagtttactcaagactacccaggaacctcttgcccgagatcctgttaaacttcctacaacag

[0172] cagccagtacccctgatgccgttgacaagtatctcgagacacctggggatgagaatgaacatgcccatttccagaaagccaaagagaggcttgaggcca

[0173]

[0174] SEQ ID NO.4:

[0175]

[0176] HepG2 cells were cultured at 8×10 4 The cells were inoculated at a density of 100 μg / well in a 24-well plate. After 24 h, 0.20 μg of two fluorescent reporter plasmids were added to 50 μL serum-free medium, followed by 0.80 μg of TaqTth protein recombinant plasmid and 1.00 μg of targeted APP. swe pU6-gRNA plasmids of different lengths of mRNA (primer sequences required for constructing probes are shown in Table 5). Then add 5 μL TransIntro TM EL Tranfection Reagent, gently mix. Let stand at room temperature for 15 minutes. Add the incubated transfection mixture to the 24-well plate, and replace with fresh medium after 8 hours. Harvest the cells after 72 hours, and then use flow cytometry to detect the expression levels of EGFP and mCherry. The results are shown in Figure 8 As shown, when the length of the 3'hpRNA guide sequence is 12-bp, TaqTth-3'hpRNA shows a strong affinity for APP. swe The efficiency of mRNA cleavage is low, which has a great impact on APP wt However, several other probes, namely 3'hpRNAs with 14, 16, 18, and 20-bp guide sequences, could knock down APP swe , without losing sight of the APP wt , with good specificity.

[0177] Table 4 Targeting sequences of RNA probes of different lengths

[0178] Locus 5'-3'sequence 12bp UCUGGAUGCAGA 14bp UCUGGAUGCAGAAU 16bp UCUGGAUGCAGAAUUC 18bp UCUGGAUGCAGAAUUCCG 20bp UCUGGAUGCAGAAUUCCGAC

[0179] Table 5 Construction of targeted APPs of different lengths swe Primer sequences required for RNA probes of mRNA

[0180]

[0181] Note: a, F represent upstream primers, R represent downstream primers.

[0182] b, The bold part is the stem-loop structure sequence, and the underlined part is the sticky end.

[0183] (B) and targeting APP swe Comparison of siRNA Methods

[0184] For further study, HEK293T cells were stably transfected with APP wt Genes and APP swe Gene, obtained two stable transfected cell lines HEK293T-APP swand HEK293T-APP we , used to replace the previous fluorescent reporter plasmid system. A 20-bp 3' hpRNA was selected to target APP swe Comparison of siRNA methods with the same sequence (e.g. Fig. 9 A).

[0185] HEK293T-APP swe Stable cells with HEK293T-APP wt Stably transfected cells were 8×10 4 The cells were inoculated at a density of 100 μg / well in a 24-well plate. After 24 h, 0.80 μg of the recombinant plasmid of TaqTth protein and 1.00 μg of the targeted APP were added to 50 μL of serum-free medium. swe The mRNA guide sequence length is 20-bp pU6-gRNA plasmid. The pU6-gRNA plasmid targeting sequence and siRNA sequence are shown in Table 6. Another component of the RNA probe transcribed from the pU6-gRNA plasmid is a hairpin structure, which is a fixed sequence of AAAGTCGGCCGAAAGGCCGACTTTTTT. Then add 5 μL TransIntro TM EL Tranfection Reagent, gently mix. When transfecting siRNA, add 50pmol siRNA and 2.5μL TransIntro TM ELTranfection Reagent, gently mix. The above transfection mixture was allowed to stand at room temperature for 15 minutes, and the incubated transfection mixture was added to 24-well plates of different stable transfected cells. Fresh culture medium was replaced after 8 hours. RNA was extracted after 72 hours, reverse transcribed into cDNA, and then qPCR was used to analyze the changes in APP mRNA abundance (primers were APP-F / R, internal reference gene was Gapdh, internal reference primer was Gapdh-F / R, primer sequences were shown in Table 7, and related steps were the same as in the previous embodiment).

[0186] like Fig. 9 As shown in B, for HEK293T-APP swe Compared with the control group (NT) transfected with an irrelevant probe (amino acid sequence: GCATATTTCATGAGAGCATCTAAAGTCGGCCGAAAGGCCGACTTTTTT), the APP expression in the experimental group (T) was observed to be significantly higher than that in the control group (NT) transfected with an irrelevant probe (amino acid sequence: GCATATTTCATGAGAGCATCTAAAGTCGGCCGAAAGGCCGACTTTTTT). swe The RNA level was significantly downregulated, with the efficiency of the TaqTth-3'hpRNA method being about 41% and the efficiency of the siRNA method being about 51%. wtIn the stable transfected cells, a 43% downregulation was also observed in the siRNA group, while TaqTth-3'hpRNA showed a significant effect on APP. wt The mRNA was not down-regulated, showing good specificity.

[0187] Further investigation of protein levels, such as Fig. 9 As shown in C, for HEK293T-APP swe Cells, TaqTth-3'hpRNA group had about 51% down-regulation, siRNA group had about 28% down-regulation; for HEK293T-APP wt Cells, siRNA group about 25% down-regulation, TaqTth-3'hpRNA group no down-regulation was observed.

[0188] Table 6 Sites and siRNA sequences targeting HEK293T-APPswe

[0189] Locus 5'-3'sequence APP mRNA UCUGGAUGCAGAAUUCCGAC siRNA-APP TCTGGATGCAGAATTCCGAC

[0190] Table 7 qPCR primer sequences of target genes and internal reference genes

[0191] Locus 5'-3'sequence APP-F GAAGTGGCTGAGGTGGAAGAAGAAG APP-R AGACTCTGTGGTGGTGGTGGTG GAPDH-F TAGTGGAAGGACTCATGACC GAPDH-R TCCACCACCCTGTTGCTGTA

[0192] The above results show that TaqTth-3'hpRNA has better specificity than siRNA and can be used to knock out the APP mutant gene of amyloid precursor protein APP swe , thus having the potential to achieve in vivo APP protein inhibition and reduce the generation of Aβ in the brain.

[0193] Example 4 DNA probe mediates TaqTth protein composition to cleave RNA substrate in vitro

[0194] The above embodiments all involve RNA probes mediating TaqTth protein. In the following embodiments, we will disclose methods for DNA probes mediating TaqTth protein. First, we will examine the cleavage of RNA substrates by DNA probe-mediated TaqTth protein compositions at the test tube level. The sequences of the relevant substrates and probes are shown in Table 8.

[0195] We designed the RNA substrate ssRNA-1 and the corresponding DNA probe 3'hpDNA-1, and labeled the 5' end of the target RNA substrate with fluorescent FAM. The reaction conditions are: 10pmoL 3'hpDNA-1, 5pmoL ssRNA-1 substrate and MOPS (Thermo Fisher Scientific, 10mM), 0.05% Tween-20, 0.01% nonidet P-40 (Thermo Fisher Scientific), MgCl2 (7.5mM) were thoroughly mixed, TaqTth protein was added, the volume was made up to 10μL with ultrapure water, and the reaction was carried out at 37°C for 2h. After the reaction was completed, the reaction products were separated by 20% denatured urea polypropylene gel, and the results were analyzed using the multifunctional gel imager Amersham Imager 600 (GE Healthcare). Fig.10 As shown in A, when 3'hpDNA and TaqTth protein exist at the same time, there is an obvious cleavage band in the lane, indicating that TaqTth protein can successfully cleave the target RNA under the mediation of 3'hpDNA.

[0196] Next, in order to verify whether TaqTth protein can cleave target RNA substrates of different sequences under the mediation of DNA probes, we designed RNA substrates ssRNA-2 and ssRNA-3, and the corresponding DNA probes 3'hpDNA-2 and 3'hpDNA-3. Fig.10 As shown in B, when 3'hpDNA and TaqTth protein exist at the same time, there is an obvious cleavage band in the lane, indicating that TaqTth protein successfully cleaves target RNA substrates with different sequences under the mediation of 3'hpDNA.

[0197] To further verify whether the cleavage of RNA substrates is sequence-free, Fig.11 As shown in A, we continuously moved the binding area of ​​the hpDNA probe along ssRNA-2 and found that all of them could be cut by the TaqTth protein combination. To investigate whether the TaqTth protein combination has incidental cutting phenomenon like the CRISPR / Cas13a system, we mixed the RNA substrates ssRNA-2, ssRNA-3 and the DNA probe 3'hpDNA-1 for reaction. The results are shown in Fig.11 As shown in B, only ssRNA-2 was cleaved, without inducing non-specific incidental cleavage of ssRNA-3.

[0198] Table 8 Sequences of related substrates and probes

[0199]

[0200]

[0201] The above results demonstrate that, at the test tube level, the DNA probe can mediate the cleavage of the RNA substrate by the TaqTth protein composition, and there is no requirement for a fixed base pairing pattern for the target sequence.

[0202] Example 5 TaqTth protein can cleave endogenous gene RNA in human cells under the guidance of DNA probe

[0203] In order to investigate whether TaqTth protein can edit the mRNA of endogenous genes in cells under the guidance of DNA probes, Fig.12 As shown, we transfected the recombinant plasmids of DNA probe (referred to as 3'hpDNA) and TaqTth protein into cells, targeted the target mRNA, and detected the knockdown efficiency.

[0204] Specifically:

[0205] (A) Design of TaqTth-3'hpDNA strategy

[0206] A DNA probe was designed for the mRNA of the target endogenous gene in the cell. The DNA probe, like the RNA probe, is also assembled from two parts, namely a stem-loop hairpin structure and a guide region complementary to the target. Among them, the hairpin is a fixed structure (AGAGTCGGCCTTTTGGCCGACTCTC). The recombinant plasmid of TaqTth is the same as pcDNA3.1-N-HA-NES-TaqTth in Example 1.

[0207] (B) TaqTth-3'hpDNA cleaves endogenous gene RNA in human cells

[0208] We designed 3'hpDNA probes for CXCR4, KRAS and PPIB, see Table 9.

[0209] Specifically, HepG2 cells were cultured at 8×10 4 The cells were seeded at a density of 100 μg / well in a 24-well plate and transfected 24 hours later. The system configuration was as follows: 0.80 μg TaqTth protein recombinant plasmid was added to 50.00 μL serum-free culture medium, and then 2.40 μL TransIntro TM EL Tranfection Reagent, gently mix. Let stand at room temperature for 15 minutes. Add the incubated transfection mixture to a 24-well plate, replace with fresh culture medium after 8 hours, and after 48 hours when TaqTth protein is expressed, add 600 pmol DNA probe to 50 μL serum-free culture medium. Then add 1.80 μL TransIntro TMEL Tranfection Reagent, gently mix. Stand at room temperature for 15 minutes, add the incubated transfection mixture to a 24-well plate, replace with fresh medium after 8 hours, and harvest the cells after 24 hours. Extract RNA and analyze the changes in KRAS mRNA abundance by qPCR. The specific steps are the same as in the previous example.

[0210] like Fig.12 As shown, compared with the control group with irrelevant probe plasmid (NT), the experimental group reduced the abundance of CXCR4 mRNA, among which the best T1 and T4 probes mediated TaqTth silencing efficiency of about 50%. Similarly, for targeted editing of KRAS and PPIB mRNA, the silencing efficiency of TaqTth-3'hpDNA on the mRNA of the above two genes can also reach about 40%.

[0211] Table 9 Sequences of related substrates and probes

[0212] Locus 5'-3'sequence KRAS mRNA T2 UCCUACAGGAAGCAAGUAGU KRAS mRNA T6 AAAAAUGCAUUAUAAUGUAA PPIB mRNA T4 GCGCUUCCCCGAUGAGAACUUCAAACUG PPIB mRNA T6 UUGCCAUCGCCAAGGAGUAG CXCR4 mRNA T1 AUGUCCAUUCCUUUGCCUCU CXCR4 mRNA T4 AUAUAUCUGUGACCGCUUCU

[0213] The above results demonstrate that, at the cellular level, the DNA probe can mediate the knockdown of the mRNA substrate cleavage of the endogenous gene by the TaqTth protein composition.

[0214] Example 6 TaqTth protein edits endogenous gene RNA in human cells in the form of DNP and compares it with siRNA and RNP of CRISPR system

[0215] It is reported that there are multiple options for the delivery mode of Cas effector proteins, among which the ribonucleoprotein complex (RNP) delivery mode is safer than the plasmid or mRNA delivery mode. Therefore, RNP is more conducive to its application in clinical gene therapy. However, in addition to the Cas effector protein, another component of RNP is the crRNA probe, and the RNA probe is very easy to degrade. For this reason, people chemically modify crRNA to ensure its stability, and the cost increases a lot. If the RNA probe can be replaced with a DNA probe, the stability will be greatly improved and the production cost will be reduced. Therefore, we tried to explore a deoxyribonucleoprotein complex (DNP) composed of TaqTth protein and 3'hpDNA probe, such as Fig.13 As shown in A, DNP was used to knock down the mRNA of endogenous genes in cells.

[0216] Specifically, the TaqTth protein expression sequence was inserted into the prokaryotic expression vector pET28a+ (GenScript Biotech), and a nuclear export sequence (NES) was added to ensure that the TaqTth protein was in the cytoplasm rather than the nucleus. The recombinant plasmid pET28a-NES-TaqTth(NB) was constructed, and the NES-TaqTth(NB) protein was expressed and purified, with a molecular weight of approximately 95 kDa, and was proven to be able to enter cells ( Fig.13 B).

[0217] Next, different DNA probes were designed to target the endogenous gene KRAS mRNA in human cells. The DNA probes can be incubated with NES-TaqTth(NB) protein in vitro to form a "protein-DNA probe complex" DNP. At the same time, the "protein-RNA probe complex" RNP of CRISPR / Cas13d was designed at the above-mentioned target site, and parallel experiments were performed to compare the knockdown efficiency.

[0218] 293T cells (ATCC) were cultured at 8×10 4 The cells were inoculated with a density of 1000 cells / well in a 24-well plate 24 hours in advance, and fresh culture medium was replaced half an hour before transfection. We transferred the DNP complex into cells through TransIntroTM EL Tranfection Reagent. Transfection samples: TaqTth protein: probe in a ratio of 2:1 was added to 50μL serum-free culture medium, keeping the total amount of protein and probe at about 800ng, incubated at 25℃ for 15min, and 2.4μL TransIntro TM EL Tranfection Reagent, gently mix, and let stand at room temperature for 15 minutes. Add the incubated mixture to a 24-well plate and replace with fresh medium after 8 hours. Collect cells after 48 hours and 72 hours, extract RNA, and analyze the changes in the abundance of endogenous gene target mRNA by qPCR. We found that Fig.13 As shown in C, compared with the control group transfected with TaqTth protein and irrelevant probe to form DNP complex, in 293T cells, the 48h experimental group reduced the KRAS mRNA expression level to 70% of the original level, and the 72h experimental group reduced the KRAS mRNA expression level to 40% of the original level. Compared with siRNA and RNP of CRISPR / Cas9 system, the effect is comparable. Fig.13 As shown in D, after being stored at -20°C for one month, the effect was comparable to that of the RNP of the CRISPR / Cas9 system.

[0219] The above results prove that TaqTth protein can act on the expression of mRNA silencing genes in the form of DNP under the guidance of DNA probe.

[0220] Example 7 TaqTth-3'hpRNA single plasmid system for APP and APP swe The impact of expression

[0221] In order to expand the application range of TaqTth-3'hpRNA, we constructed a recombinant adeno-associated virus (rAAV) shuttle plasmid that was driven by the CAG promoter to express EGFP and TaqTth protein respectively and linked to the U6 promoter to express the targeted APP. swe 3'hpRNA single plasmid (TaqTth-T) (nucleotide sequence as shown in SEQ ID NO.5) or U6 promoter driven expression of non-targeted APP swe 3'hpRNA control single plasmid (TaqTth-NT) (nucleotide sequence as shown in SEQ ID NO.6) ( Fig.14 A).

[0222] SEQ ID NO.5:

[0223]

[0224] SEQ ID NO.6:

[0225] ccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccrggsggggsggggsggggsgrggggsggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcg

[0226] tgaaagccttgaggggctccgggagggccctttgtgcggggggagcggctcggggctgtccgcggggggacggctgccttcgggggggacggggc

[0227] agggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggt

[0228] tattgtgctgtctcatcattttggcaaagaattggatccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg

[0229] gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatttgcaccaccgg

[0230] caagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttc

[0231] aagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcga

[0232] caccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaac

[0233] gtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccacta

[0234] ccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaag

[0235] cgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagttcgaaggcagtggagagggcagagg

[0236] aagtctgctaacatgcggtgacgtcgaggagaatcctggcccagctagcgagctcaccggtgccaccatggtttacccatacgatgttccagattacgctg

[0237] gtaccatgcttcaactgcctccacttgaaagactgacactgggcggtagtatgagggggatgctgcccctctttgagcccaagggccgggtcctcctggtg

[0238] gacggccaccacctggcctaccgcaccttccacgccctgaagggcctcaccaccagccggggggagccggtgcaggcggtctacggcttcgccaaga

[0239] gcctcctcaaggccctcaaggaggacggggacgcggtgatcgtggtctttgacgccaaggccccctccttccgccacgaggcctacggggggtacaag

[0240] gcgggccgggcccccacgccggaggactttccccggcaactcgccctcatcaaggagctggtggacctcctggggctggcgcgcctcgaggtcccgg

[0241] gctacgaggcggacgacgtcctggccagcctggccaagaaggcggaaaaggagggctacgaggtccgcatcctcaccgccgacaaagacctttacca

[0242] gctcctttccgaccgcatccacgccctccaccccgagggctacctcatcaccccggcctggctttgggaaaagtacggcctgaggcccgaccagtgggc

[0243] cgactaccgggccctgaccggggacgagtccgacaaccttcccggggtcaagggcatcggggagaagacggcgaggaagcttctggaggagtggg

[0244] ggagcctggaagccctcctcaagaacctggaccggctgaagcccgccatccgggagaagatcctggcccacatggacgatctgaagctctcctgggac

[0245] ctggccaaggtgcgcaccgacctgcccctggaggtggacttcgccaaaaggcgggagcccgaccgggagaggcttagggcctttctggagaggcttg

[0246] agtttggcagcctcctccacgagttcggccttctggaaagccccaaggccctggaggaggccccctggcccccgccggaaggggccttcgtgggctttg

[0247] tgctttcccgcaaggagcccatgtgggccgatcttctggccctggccgccgccagggacggccgggtgcaccgggcagcagaccccttggcggggct

[0248] aaaggacctcaaggaggtccggggcctcctcgccaaggacctcgccgtcttggcctcgagggaggggctagacctcgtgcccggggacgaccccatg

[0249] ctcctcgcctacctcctggacccctccaacaccacccccgagggggtggcgcggcgctacgggggggagtggacggaggacgccgcccaccgggc

[0250] cctcctctcggagaggctccatcggaacctccttaagcgcctcgagggggaggagaagctcctttggctctaccacgaggtggaaaagcccctctcccg

[0251] ggtcctggcccacatggaggccaccggggtacggcgggacgtggcctaccttcaggccctttccctggagcttgcggaggagatccgccgcctcgagg

[0252] aggaggtcttccgcttggcgggccaccccttcaacctcaactcccgggaccagctggaaagggtgctctttgacgagcttaggcttcccgccttggggaa

[0253] gacgcaaaagacaggcaagcgctccaccagcgccgcggtgctggaggccctacgggaggcccaccccatcgtggagaagatcctccagcaccggg

[0254] agctcaccaagctcaagaacacctacgtggaccccctcccaagcctcgtccacccgaggacgggccgcctccacacccgcttcaaccagacggccacg

[0255] gccacggggaggcttagtagctccgaccccaacctgcagaacatccccgtccgcacccccttgggccagagaatccgccgggccttcatcgccgagga

[0256] ggggtggctattggtggccctggactatagccagatagagctcagggtgctggcccacctctccggcgacgagaacctgatccgggtcttccaggaggg

[0257] gcgggacatccacacggagaccgccagctggatgttcggcgtcccccgggaggccgtggaccccctgatgcgccgggcggccaagaccatcaacttc

[0258] ggggtcctctacggcatgtcggcccaccgcctctcccaggagctagccatcccttacgaggaggcccaggccttcattgagcgctactttcagagcttccc

[0259] caaggtgcgggcctggattgagaagaccctggaggagggcaggaggcgggggtacgtggagaccctcttcggccgccgccgctacgtgccagacct

[0260] agaggcccgggtgaagagcgtgcgggaggcggccgagcgcatggccttcaacatgcccgtccagggcaccgccgccgacctcatgaagctggctat

[0261] ggtgaagctcttccccaggctggaggaaatgggggccaggatgctccttcaggtccacgacgagctggtcctcgaggccccaaaagagagggcggag

[0262] gccgtggcccggctggccaaggaggtcatggagggggtgtatcccctggccgtgcccctggaggtggaggtggggataggggaggactggctctccg

[0263] ccaaggagtaagatatcaagcttatcgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggat

[0264] acgctgcagatctacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaa

[0265] ttaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtaggg

[0266] cctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctc

[0267] ccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactccta

[0268] atctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttgtaggtaaccacgtgcgg

[0269] acctcgaaattccccagtggaaagacgcgcaggcaaaacgcaccacgtgacggagcgtgaccgcgcgccgagcgcgcgccaaggtcgggcaggaagaggg cctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaa atacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtattt cgatttcttgggtttatatatcttgtggaaaggacgcgggatcgcaccgcatatttcatgagagcatctaaagtcggccgaaaggccgacttttttagct.

[0270] Next, we tested the effects of TaqTth-T and TaqTth-NT single plasmids on overexpression of APP in HEK 293T cells. swe and APP wt The cells were cultured at 2×10 5 The cells were inoculated at a density of 100 μg / well in a 12-well plate. After 24 hours, the plasmid expressing TaqTth-T or TaqTth-NT was transferred into the cells. Transfection sample: 4 μg of the plasmid expressing TaqTth-T or TaqTth-NT was added to 100 μL serum-free medium. Then 10 μL TransIntro TMEL Tranfection Reagent, gently mix. Let stand at room temperature for 15 minutes. Add the incubated transfection mixture to the 12-well plate and replace with fresh culture medium after 12 hours. After 96 hours, the transfection efficiency was detected by observing the EGFP positive cell rate ( Fig.14 B) Then, qPCR detection App wt / App swe mRNA abundance and WB detection APP swe and APP wt Protein levels. Fig.14 As shown in C, for HEK293T-App swe Compared with the control TaqTth-NT group, the APP swe mRNA was down-regulated by about 40.17%; for HEK293T-App wt cells, APP between control TaqTth-NT group and TaqTth-T group wt There was no difference in mRNA levels. Protein levels were also tested, such as Fig.14 As shown in D, in HEK293T-App swe In cells, compared with the control TaqTth-NT group, APP in the TaqTth-T group swe The protein level decreased by about 41.48%; in HEK293T-App wt In cells, APP wt There was no difference in protein levels. This proves that the TaqTth-3'hpRNA system also has good silencing efficiency and specificity in the AAV single plasmid system.

[0271] Example 8 AAV-TaqTth-T downregulates APP in the brain of 5×FAD transgenic mice swe

[0272] To verify the efficacy of TaqTth in AD mice, we first replaced the CAG promoter in the above-mentioned TaqTth-T and TaqTth-NT shuttle plasmids with the neuron-specific promoter Syn, and packaged them into AAV using serotype 9 AAV auxiliary plasmids (pAdDeltaF6, addgene, #112867; pAAV2 / 9n, addgene, #112865), and named them AAV-TaqTth-T and AAV-TaqTth-NT, respectively. Fig.15 A).

[0273] Next, we injected AAV-TaqTth-T and AAV-TaqTth-NT ( Fig.15 B). 2 μL is titrated to 10 12 ~10 13 vg / ml of AAV-TaqTth-T or AAV-TaqTth-NT was injected into the CA1 region of the hippocampus (2.2 mm from the anterior bregma, ±1.7 mm from the midline, and 2.4 mm in depth). One month after the injection, the hippocampal tissue was extracted for WB detection.

[0274] Extraction of hippocampal tissue lysate: The extracted hippocampal tissue was weighed and placed in a homogenizer, and the premixed Intact Protein was added. TM lysis reagent (GenuIN Biotech, #415, Reagent A: Reagent B = 1: 500), the amount added was 3 mL / g, the homogenizer was placed on ice and ground until there were no obvious tissue blocks, the ground tissue fluid was transferred to a 1.5 mL centrifuge tube, left on ice for 15 min, then centrifuged at 4°C for 10 min, the supernatant was transferred to a clean centrifuge tube, heated in a 95°C metal bath for 5 min, left on ice for 3 min, then centrifuged at 4°C, 13000g for 5 min, and the protein concentration was determined using a NanoDrop spectrophotometer. Subsequently, we detected the protein level of APP in the hippocampal lysate. Compared with the control group AAV-TaqTth-NT, the mutant APP in the hippocampus of the AAV-TaqTth-T group of mice decreased by about 68.36%. It was demonstrated that the TaqTth-3'hpRNA system can effectively knock out the mutant APP in the 5×FAD mouse model ( Fig.15 C).

[0275] Example 9 AAV-TaqTth-T does not change the body weight and brain weight of 5×FAD transgenic mice

[0276] To further investigate the AD pathology and cognitive function of 5×FAD mice, we injected AAV-TaqTth-T( Fig.16 A), After injection of AAV-TaqTth-T, the body weight of mice was measured once a week, and there was no significant change compared with the uninjected mice ( Fig.16 B) At the same time, there was no significant change in brain weight after virus injection compared with mice not injected with the virus ( Fig.16 C).

[0277] Example 10 AAV-TaqTth-T improves spatial learning and memory function in 5×FAD transgenic mice

[0278] On the basis of Example 9, at week 12 after AAV-TaqTth-T injection, the mice were subjected to Morris water maze (MWM) and novel object recognition (NOR) tests to evaluate their spatial learning and memory functions.

[0279] Water maze test: Mice were placed in the behavioral test site 24 h before each behavioral test to adapt to the environment. First, a five-day training experiment was conducted. That is, in a circular pool (130 cm in diameter, 60 cm deep), water was injected to a depth of about 30 cm and maintained at a temperature of about 22°C. In the center of the southwest (SW) quadrant, an escape platform with a diameter of about 10 cm was placed, hidden 1 cm underwater. During the five-day training, mice were placed in the water facing the pool wall at four different entry points (north, east, southeast, and northwest) every day. At the same time, the instrument was used to automatically track the swimming trajectory of the mice for 60 seconds. If the test mouse reached the hidden escape platform and stayed there for at least 2 seconds, the recording was stopped. Mice that took more than 60 seconds to find the escape platform continued to stay on the platform for at least 10 seconds. On the sixth day after 5 days of training, the test experiment was conducted. Before the experiment, the platform hidden under the water was removed, and the mice were released in the northeast direction facing the pool wall, and the swimming trajectory of the mice was automatically tracked for 60 seconds.

[0280] New object recognition test: First, place the mouse in an open box of 45cm×45cm×40cm for 2 minutes of environmental adaptation. After resting for 30 minutes after adaptation, place two objects of the same color in a fixed position in the area, and let the mice explore freely for 8 minutes as training. After resting for 1 hour after the training, change one of the objects to a different color, and let the mice continue to explore in the box for another 8 minutes. During the environmental adaptation, training and testing process, use alcohol to remove the odor on the floor and objects. The time (T) that the mouse spends around each object is recorded by video. Calculate its cognitive index, cognitive index (Discrimination index) = T 新物体 / (T 新物体 +T 旧物体 ).

[0281] In the water maze test, 5×FAD mice took longer to find the hidden platform during the 5-day training compared with wild-type (WT) mice, while 5×FAD mice injected with AAV-TaqTth-T showed a decrease in latency on the fourth and fifth days of training ( Fig.17 A, Fig.17B). At the same time, during the test, compared with WT mice, the number of times 5×FAD mice crossed the platform and the time they spent in the quadrant where the platform was located decreased, while the injection of AAV-TaqTth-T increased the number of times 5×FAD mice crossed the platform and the time they spent in the quadrant where the platform was located ( Fig.17 C, Fig.17 D).

[0282] In the novel object recognition test, WT mice spent more time exploring a novel object than the object they recognized during training, while 5×FAD mice spent almost the same amount of time exploring both objects. In contrast, injection of AAV-TaqTth-T significantly improved the cognitive function of 5×FAD mice in recognizing novel objects ( Fig.17 E, Fig.17 F).

[0283] This shows that TaqTth-T knocks down mutant APP swe The cognitive function of AD mice can be fully improved, indicating that TaqTth-T has potential clinical application in AD treatment.

[0284] Example 11 AAV-TaqTth-T alleviates pathological features of 5×FAD transgenic mice

[0285] On the basis of Example 9, mice were killed for pathological study at 13 weeks after AAV-TaqTth-T injection. First, mice were killed by cardiac perfusion, the brains were removed, and the hippocampi of 3 mice were randomly selected to make protein lysate, and the brains of the remaining 5 mice were fixed in 4% PFA for 24 h, then dehydrated with 30% sucrose solution, embedded and cut into 30 μm slices, which can be used for subsequent immunohistochemistry.

[0286] Specific method of immunohistochemistry: brain slices were washed 3 times with PBS, permeabilized in 0.3% Triton solution for 15 minutes, then blocked in 2.5% BSA solution for 1 hour, incubated with antibodies at 4°C overnight, washed 3 times with PBS, incubated with secondary antibodies at room temperature for 1 hour, and sealed with anti-fluorescence quencher containing DAPI. EGFP fluorescence showed that AAV had a high infection efficiency ( Fig.18 A). Meanwhile, WB test results showed that the Aβ expression level in the hippocampus decreased by about 59.46% ( Fig.18 B).

[0287] Specific information on the use of immunohistochemistry antibodies is as follows:

[0288] Primary antibody: Aβ (cell signaling technology, #2454, 1:500), Iba1 (GeneTex, #019-19741, 1:500), GFAP (abcam, #ab7260, 1:500); fluorescent secondary antibody is Anti-goat Alexa546-labelled (Invitrogen, #A10040, 1:500).

[0289] The specific information for WB antibody use is as follows:

[0290] HA(cell signaling technology,#3724,1:2000), APP(proteintech,#25524-1-AP,1:1000), Aβ(cell signaling technology,#2454,1:2000), PSD-95(cell signaling technology,#3450,1:2000), Synaptophysin(cell signaling technology, #36406,1:2000), GAPDH (abclonal, #AC033,1:5000), GFP (Santa Cruze, #sc-9996,1:2000).

[0291] Next, we further analyzed Aβ plaques of different sizes (diameter: <20 μm, 20-40 μm, >40 μm) and found that their numbers were significantly reduced compared with those in uninjected 5×FAD mice ( Fig.18 C, Fig.18 D).

[0292] Subsequently, to evaluate the effect of AAV-TaqTth-T on glial proliferation, we detected the levels of microglial and astrocyte proliferation. Immunohistochemical analysis showed that in 5×FAD mice injected with AAV-TaqTth-T, different sizes of Iba1 (Iba1 + : markers of microglia) were reduced in number ( Fig.18 E, Fig.18 F). GFAP + The number of clusters positive for astroglial markers ( Fig.18 G, Fig.18 H).

[0293] At the same time, the loss of synapses is also an Aβ-related pathology that can lead to a decline in cognitive function. Therefore, we detected the protein levels of synaptic markers, including PSD-95 (postsynaptic marker) and synaptophysin (presynaptic marker). WB results showed that injection of AAV-TaqTth-T significantly increased the level of PSD-95 in the hippocampus and slightly increased the expression of synaptophysin ( Fig.18 B).

[0294] Therefore, targeting APP swe AAV-TaqTth-3'hRNA of mRNA is beneficial to alleviate the pathological characteristics of AD mice.

[0295] Example 12: Concatenation of TaqTth-T and APOE2 to construct AAV vector

[0296] Considering that the size of TaqTth is much smaller than that of Cas9, we calculated its packaging capacity (the AAV vector genome is about 4kb after removing EGFP), so we constructed another AAV vector to better inhibit AD pathology. Some preclinical and clinical studies have found that AAV-mediated expression of APOE2 can delay the pathogenesis of AD. To this end, we cloned the APOE2 gene downstream of HA-tagged TaqTth, and the two proteins were connected by T2A ( Fig.19 A). We then packaged the vector into AAV9 using an AAV helper plasmid of serotype 9 and named it AAV-TaqTth-T-APOE2 (nucleotide sequence as shown in SEQ ID NO.7), and then injected it into one side of the hippocampus of 3-month-old 5×FAD mice, and injected AAV-TaqTth-T on the other side as a control ( Fig.19 B).

[0297] SEQ ID NO.7:

[0298]

[0299] Example 13 AAV-TaqTth-T-APOE2 enhances the effect of AAV-TaqTth-T in alleviating AD pathology

[0300] In order to compare the long-term efficacy of AAV-TaqTth-T-APOE2 and AAV-TaqTth-T, we injected two AAVs into the hippocampus of 5×FAD mice on both sides, killed the mice 3 months later, and removed the brains. WB experiments showed that the expression of APOE2 in the hippocampus injected with AAV-TaqTth-T-APOE2 was increased ( Fig. 20 A) (WB antibody: APOE (Academy Bio-Medical, #50H-G1a, 1:1000)). Therefore, our TaqTth tool does provide enough free packaging space in AAV for APOE2 overexpression.

[0301] We then assessed Aβ-related pathology. The injection of AAV-TaqTth-T-APOE2 almost completely eliminated all Aβ of different sizes ( Fig. 20 B, Fig. 20 C). Compared with AAV-TaqTth-T, AAV-TaqTth-T-APOE2 reduced Aβ levels by approximately 53.39% ( Fig. 20 A). At the same time, AAV-TaqTth-T-APOE2 injection also largely eliminated glial proliferation, Iba1 + ( Fig. 20 D, Fig. 20 E) and GFAP + cell( Fig. 20 G,, Fig. 20 H) was further reduced, and Iba1 + cell( Fig. 20 D, Fig. 20 F) and GFAP + cell( Fig. 20 G, Fig. 20 This was demonstrated by a further decrease in the area of ​​​​I). In addition, AAV-TaqTth-T-APOE2 also further increased the protein levels of PSD-95 and synaptophysin compared to AAV-TaqTth-T itself ( Fig. 20 A).

[0302] These results suggest that the combination of TaqTth and APOE2 overexpression packaged in a single AAV vector exhibits better efficacy in suppressing AD pathology than TaqTth alone.

[0303] As described above, although the present invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the present invention itself. Various changes in form and details may be made without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A novel RNA editing composition, characterized in that: The composition comprises: Component (i): TaqTth protein or a polynucleotide encoding the protein; Component (ii): at least one oligonucleotide probe, the oligonucleotide probe consisting of two parts, one part being a guide sequence capable of complementing the target gene; and the other part having a nucleic acid secondary structure; The oligonucleotide probe is a DNA probe or an RNA probe.

2. The composition according to claim 1, characterized in that In component (i), the TaqTth protein is selected from any one of the following: (1) Partial functional domains or complete enzyme fragments of Thermus aquaticus DNA polymerase or its mutants; (2) partial functional domains or complete enzyme fragments of Thermus thermophilus DNA polymerase or its mutants; (3) Thermus aquaticus DNA polymerase and / or Thermus thermophilus DNA Fusion of the whole enzyme or fragment of polymerase.

3. The composition according to claim 2, characterized in that The TaqTth protein is a chimeric functional protein formed by fusing parts of Thermus aquaticus DNA polymerase and Thermus thermophilus DNA polymerase, and its nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.

2.

4. The composition according to claim 2 or 3, characterized in that The TaqTth protein molecule contains one or more nuclear export signals at the C-terminus or N-terminus; the polynucleotide encoding the TaqTth protein molecule is DNA or RNA.

5. The composition according to claim 1, characterized in that In component (ii), the oligonucleotide probe is a chemically synthesized oligonucleotide probe, or a plasmid constructed by inserting into a plasmid backbone.

6. The composition according to claim 1 or 5, characterized in that The nucleic acid secondary structure of the oligonucleotide probe contains a 3' end hairpin structure.

7. Application of a novel RNA editing composition in gene editing and preparation of gene editing reagents.

8. Use of a novel RNA editing composition in the preparation of a therapeutic drug for a disease caused by gene mutation, characterized in that: The disease comprises Alzheimer's disease.

9. The use according to claim 7 or 8, characterized in that: The RNA editing composition is selected from any of the following forms: a TaqTth-3'hpRNA composition, a TaqTth-3'hpDNA composition, a TaqTth-3'hpRNA single plasmid system or an AAV-TaqTth-3'hRNA vector; The TaqTth-3'hpRNA single plasmid system is based on the transformation of the recombinant adeno-associated virus rAAV shuttle plasmid, which is driven by the CAG promoter to express EGFP and TaqTth protein respectively and cascaded with the U6 promoter to drive the expression of targeted APP. swe 3'hpRNA single plasmid; The AAV-TaqTth-3'hRNA vector replaces the CAG promoter in the TaqTth-3'hpRNA single plasmid with the neuron-specific promoter Syn, and packages it into AAV through the AAV auxiliary plasmid of serotype 9.

10. An AAV vector constructed by tandemly combining an RNA editing composition and APOE2, characterized in that: The APOE2 gene was cloned downstream of the HA-tagged TaqTth, and the two proteins were connected with T2A. The vector was packaged into AAV9 using the AAV helper plasmid of serotype 9 and named AAV-TaqTth-T-APOE2, and its nucleotide sequence is shown in SEQ ID NO.7.

Images