Haemophilus parasuis endotoxin attenuated vaccine strain as well as preparation method and application thereof

Abstract

The invention belongs to the field of biology, and discloses a preparation method of a haemophilus parasuis endotoxin attenuated vaccine strain, which comprises the following steps: transforming plasmid containing optimized LpxE gene into haemophilus parasuis by electric shock to obtain the endotoxin attenuated vaccine strain; the sequence of the optimized LpxE gene is as shown in SEQ ID NO. 1. The LpxE gene is optimized by adopting different strategies to obtain a brand new plasmid, so that the haemophilus parasuis successfully attenuated endotoxin. Meanwhile, the invention also discloses application of the strain.

Description

Technical Field

[0001] The invention belongs to the biological field, and more specifically, relates to an attenuated Haemophilus parasuis endotoxin vaccine strain and a preparation method and application thereof. Background Art

[0002] Haemophilus parasuis disease (H. parasuis) is an infectious disease caused by Haemophilus parasuis of swine, characterized by fever, swollen joints, difficulty breathing, polyserositis, arthritis and high mortality. It is also called polyfibrinous serositis and arthritis, which seriously endangers the health of piglets and young pigs.

[0003] The applicant has previously applied for an invention patent CN115216478B, a method for constructing and applying an attenuated inactivated vaccine strain of avian Pasteurella multocida endotoxin. The method uses a plasmid containing a codon-optimized LpxE gene to transform into avian Pasteurella multocida to obtain an attenuated inactivated vaccine strain of avian Pasteurella multocida endotoxin.

[0004] In this application, the dephosphorization efficiency was 16.23%.

[0005] The applicant plans to continue using this strategy to implement the attenuation experiment of Haemophilus parasuis endotoxin, but found that directly copying this method cannot effectively attenuate the endotoxin of Haemophilus parasuis.

[0006] Therefore, the technical problem solved in this case is: how to achieve effective endotoxin attenuation of Haemophilus parasuis. Summary of the invention

[0007] The main purpose of the present invention is to provide an endotoxin attenuated vaccine strain of Haemophilus parasuis, which optimizes the LpxE gene using different strategies to obtain a new plasmid, thereby successfully achieving endotoxin attenuation of Haemophilus parasuis.

[0008] At the same time, the invention also discloses a preparation method and application of the strain.

[0009] According to a first aspect of the present invention, a method for preparing an endotoxin-attenuated vaccine strain of Haemophilus parasuis is provided, wherein a plasmid containing an optimized LpxE gene is electroporated into Haemophilus parasuis to obtain an endotoxin-attenuated vaccine strain; the sequence of the optimized LpxE gene is shown in SEQ ID NO.1.

[0010] In the above preparation method, the plasmid vector is a pET28 plasmid vector.

[0011] Meanwhile, the present invention also discloses an attenuated vaccine strain of Haemophilus parasuis endotoxin, which is prepared by the method as described above.

[0012] At the same time, the present invention also provides the use of the above-mentioned Haemophilus parasuis endotoxin attenuated vaccine strain for preparing vaccines.

[0013] Finally, the present invention discloses a vaccine comprising the endotoxin-attenuated vaccine strain of Haemophilus parasuis as described above.

[0014] One of the above technical solutions of the present invention has at least one of the following advantages or beneficial effects:

[0015] The invention constructs a recombinant plasmid expressing the LpxE gene and transforms it into Haemophilus parasuis by electroporation to successfully obtain an endotoxin attenuated strain. The invention uses the optimized LpxE gene to specifically remove the phosphate group on the A1 position of some lipids in the wild-type strain and successfully transforms Haemophilus parasuis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the plasmid map of plasmid pSF814;

[0017] Figure 2 is the plasmid map of plasmid pSF815-lpxE;

[0018] Figure 3 is the plasmid map of plasmid pSF816-lpxE;

[0019] Figure 4 This is the mass spectrometry analysis of lipid A extracted from the wild sc096 strain;

[0020] Figure 5 Mass spectrometry analysis of lipid A extracted from the plasmid constructed for the original LpxE gene;

[0021] Figure 6 This is the mass spectrometry analysis of lipid A extracted from the plasmid constructed by the optimized LpxE gene;

[0022] Figure 7 This is the electrophoresis diagram of the amplification of the Pasteurella replicon fragment;

[0023] Figure 8 is the electrophoresis diagram of the amplification of the vector fragment;

[0024] Fig. 9 is the electrophoresis diagram of the amplification of the native lpxE gene;

[0025] Fig.10 This is the electrophoresis diagram of the optimized gene lpxE-opt amplification. DETAILED DESCRIPTION

[0026] The embodiments of the present invention are described in detail below. The embodiments are exemplary and are only used to explain the present invention, but are not to be construed as limiting the present invention.

[0027] Experimental methods

[0028] 1. Construction of pSF814 plasmid

[0029] (1) First, we commissioned Bioengineering to synthesize the Pasteurella replicon (NCBI No.: DQ125466.1, SEQ ID NO. 2);

[0030] (2) Obtain the Pasteurella replicon fragment using the following primers P1 and P2;

[0031] P 1: GATCCTTTTTCTGTAATCTGTTTCG (SEQ ID NO.6)

[0032] P2:GATCATAGGCTCAATTCTCGCAATT(SEQ ID NO.7)

[0033] The amplification conditions used for PCR cloning were: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 90 s, 35 cycles; 72°C for 3 min; the amplification electrophoresis can be seen Figure 7 .

[0034] The nucleotide sequence of the cloned Pasteurella replicon fragment is shown in SEQ ID NO.2;

[0035] (3) Amplify the pET28 vector using the following primers p3 and p4 to obtain the vector fragment

[0036] P3: TGCGAGAATTGAGCCTATGATCAACGCCAGCAACGCGGCCTT (SEQ ID NO.8)

[0037] P4: GAAACAGATTACAGAAAAAGGGATTCTTTCCATAGGCTCCGCCCCCCTGAC(SEQID NO.9)

[0038] The amplification conditions used for cloning were: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 3 min, 40 cycles; 72°C for 6 min. The amplification electrophoresis can be seen Figure 8 .

[0039] The nucleotide sequence of the pET28 vector fragment is shown in SEQ ID NO.3;

[0040] (4) The obtained Pasteurella replicon fragment and pET28 vector fragment were sent for sequencing after confirming their correct size by PCR. After confirming that there was no mutation, a DNA gel recovery kit was used to recover and purify the target gene;

[0041] (5) Determine the concentration of the recovered product using an ultra-micro spectrophotometer;

[0042] (6) Prepare seamless homologous recombination solution in a microcentrifuge tube, the total volume is 10 μL, and the DNA solution system is shown in Table 1 below;

[0043] Table 1 System for preparing seamless homologous recombination solution

[0044]

[0045]

[0046] (7) Connection: Place in a metal bath at 50°C for 50 minutes;

[0047] (8) Transformation: Take out a tube of competent DH5αE.coli from -80°C and place it on ice. After 5 minutes, add 10 μL of the ligation product in step (7). After reacting on ice for 25 minutes, heat shock for 45 seconds, quickly put it back on ice, let it stand for 3 minutes, then add 700 μL of antibiotic-free LB liquid culture medium, and culture at 37°C, 200 r / min shaking for 1 hour;

[0048] (9) Sequencing identification: Spread 100 μL of bacterial solution on a kanamycin LB agar plate, wait for the bacteria to grow, pick a single colony and perform PCR on the bacterial solution. The PCR amplification reaction conditions and system are the same as those in step (3) above.

[0049] The bacterial solution corresponding to the positive band was sequenced;

[0050] (10) Extraction of plasmid and preservation of seed: The bacterial solution with the correct sequencing results was expanded and the plasmid pSF814 was extracted using a plasmid extraction kit and stored at -20°C. The bacterial solution was also preserved at -80°C in LB liquid culture medium containing 15-20% glycerol.

[0051] The plasmid map of plasmid pSF814 is shown in Figure 1 ;

[0052] The nucleotide sequence of plasmid pSF814 is shown in SEQ ID NO.4;

[0053] 2. Construction of pS815 and pS816 plasmids

[0054] (1) Gene synthesis of the native lpxE gene and the codon-optimized lpxE gene, respectively, wherein the native sequence is from Francisella tularensis subsp. novicida FTG (ABXZ01000007.1, 38038-38757); the nucleotide sequence of the native lpxE gene is shown in SEQ ID NO.5; the nucleotide sequence of the codon-optimized lpxE gene is shown in SEQ ID NO.1;

[0055] (2) Primers p5 and p6 were used to amplify the native lpxE gene. The electrophoresis diagram showed Fig. 9 ;

[0056] The codon-optimized gene lpxE-opt was amplified using primers p5 and p7. The amplified electrophoresis showed Fig.10 ;

[0057] P5: GGTGGACAGCAAATGGGTCGC ACGTGGCAATGACAGTGCTTTTAG (SEQ ID NO.10)

[0058] P6: GTGGTGGTGCTCGAGTGCGGCCGC CTAAATAATCTCTCTATTTCTCATCCA (SEQ ID NO. 11)

[0059] P7: GTGGTGGTGCTCGAGTGCGGCCGC TTAAATGATTTCGCGGTTACGCATC (SEQ ID NO. 12)

[0060] The amplification conditions used for cloning were: 95°C for 3 min; 95°C for 15 s, 60°C for 30 s, 72°C for 60 s, 40 cycles; 72°C for 2 min

[0061] (3) Enzyme digestion: pSF814 was digested with BamHI and HindIII enzymes. The digestion system was: 1 μg of enzyme plus 10 μg of pSF814 plasmid. The digestion conditions were 37°C for 30 min in a water bath. After digestion, the target gene was recovered and purified using a DNA gel recovery kit. The concentration of the recovered product was measured using an ultra-micro spectrophotometer.

[0062] (4) lpxE and lpxE-opt were connected to pSF814 using seamless recombination to obtain pSF815 and pSF816.

[0063] Prepare a DNA solution in a microcentrifuge tube, the total volume is 10 μL, and the seamless homologous recombination solution system is shown in Table 2 below;

[0064] Table 2 System for preparing seamless homologous recombination solution

[0065] Reagents Usage amount (μL) pSF814 2 lpxE / lpxE-opt 3 Homologous recombination enzyme 5

[0066] (5) Connection: Place in a metal bath at 50°C for 50 minutes;

[0067] (6) Transformation: Take out two tubes of competent DH5αE.coli from -80°C and place them on ice. After 5 minutes, add 10 μL of the ligation product in (5). After reacting on ice for 25 minutes, heat shock for 45 seconds, quickly put them back on ice, let them stand for 3 minutes, then add 100 μL of antibiotic-free LB liquid culture medium to each tube, and culture at 37°C, 200 rpm on a shaking incubator for 1 hour.

[0068] (7) Sequencing identification: 100 μL of bacterial solution was spread on a kanamycin LB agar plate, and after the bacteria grew, single colonies of pS815-DH5α E. coli and pS816-DH5α E. coli were picked for detection. The target band size was about 900 bp, indicating that the target bands LpxE and lpxE-opt existed in the pSF815-lpxE plasmid and the pSF816-1pxE plasmid. The bacterial solution corresponding to the positive bands was sequenced;

[0069] (8) Extracting plasmids and preserving the culture: The bacterial solution with the correct sequencing results was expanded and cultured. Plasmid pSF815-lpxE and plasmid pSF816-1pxE were extracted using a plasmid extraction kit and stored at -20°C. The bacterial solution was then preserved at -80°C using LB liquid culture medium containing 15-20% glycerol.

[0070] The plasmid map of plasmid pSF815-lpxE is shown in Figure 2 ;

[0071] The plasmid map of plasmid pSF816-lpxE is shown in Figure 3 .

[0072] 3. Preparation of electroporation competent cells of Haemophilus parasuis

[0073] TSB medium: Add 15 g of Tryptone, 5 g of Peptones soybean, and 5 g of NaCl to 1 L of deionized water, adjust the pH to neutral, set the autoclave to 121°C, steam sterilize, and store in a refrigerator at 4°C.

[0074] TSA medium: Add 40g Tryptone SOYAAGAR and 3g YEAST EXTRACT to 1L deionized water, set the autoclave to 121℃, steam sterilize, and store at room temperature.

[0075] The sc096 strain of Haemophilus parasuis was from the National and Local Joint Engineering Laboratory for Zoonotic Disease Prevention and Control Agents of South China Agricultural University.

[0076] The two plasmids pSF815-lpxE plasmid and pSF816-lpxE plasmid constructed above were respectively electroporated into Haemophilus parasuis. The specific method for preparing Haemophilus parasuis electroporation competent cells is as follows:

[0077] (1) Pick a single colony of Haemophilus parasuis sc096 strain, inoculate it into 3-4 mL TSB liquid culture medium, and culture it in a shaking incubator at 37° C. and 200 rpm for 12-14 h;

[0078] (2) Inoculate the sc096 strain into 100 mL of fresh TSB liquid medium at a ratio of 1:100 and culture at 37°C, 200 rpm for about 2.5 to 3 h until the OD 600 When the value reached 0.4 to 0.6, hyaluronidase was added at a ratio of 100 U / mL and the shaking culture was continued for 30 min;

[0079] (3) Precool the bacterial solution on ice for 15 to 30 minutes (shake occasionally to accelerate the cooling of the bacterial solution), divide the bacterial solution into precooled 50 mL centrifuge tubes, precool the centrifuge to 4°C in advance, centrifuge at 4000 r / min for 10 minutes, and discard the supernatant;

[0080] (4) Wash the cells four times with sterilized precooled sucrose 272, centrifuge at 4°C, 4000 rpm for 10 min, and discard the supernatant;

[0081] (5) Add 1.5 mL to 2 mL of sterile pre-cooled sucrose 272 to resuspend the cells, then divide the mixture into 90 μL / tube sterile pre-cooled 1.5 mL centrifuge tubes and store in a -80°C refrigerator.

[0082] 4. Electroporation and identification of phosphatase overexpressing plasmid

[0083] The two plasmids pSF815-1pxE plasmid and pSF816-lpxE plasmid were transformed into the competent cells of Haemophilus parasuis. The specific operation steps are as follows:

[0084] (1) taking the competent cells of Haemophilus parasuis sc096 prepared above out of a -80°C refrigerator and placing them on an ice-water mixture to melt;

[0085] (2) Take out a 0.1 cm electric shock cup and cup cover, take it out of the storage solution and invert it on clean absorbent paper for 5 minutes to drain the water, then put it upright for 5 minutes to allow the ethanol to evaporate completely. After the ethanol evaporates completely, immediately insert it into ice and compact the ice surface. Keep the top of the electrode cup 0.5 cm away from the ice surface to facilitate the cup cover. Let it stand in the ice for 5 minutes to fully cool down;

[0086] (3) Add 5 μL of recombinant plasmids pSF815-lpxE plasmid and pSF816-lpxE plasmid to the competent cell sc096 strain in the 1.5 mL centrifuge tube prepared in advance, stir the bottom of the tube by hand to mix, immediately insert into ice, and place on the ice-water mixture for 10 minutes; use the tip of the pipette to quickly transfer the competent cell and plasmid mixture to a 0.1 cm ice-bathed electroporation cup, cover the cup, and keep the empty tube for later use. Avoid bubbles when adding electroporated competent cells to the electroporation cup, as bubbles will increase the risk of arc discharge;

[0087] (4) Set the parameters of the electroporator: voltage 1850V / cm, pulse resistance 200Ω, capacitance 50μF, wipe off the water on the outside of the electroporation cup and then perform electroporation. After the electroporation is completed, add 1mL of TSB liquid culture medium to mix the bacteria (TSB culture medium should be added quickly after electroporation), and transfer to a 1.5mL EP tube. Note: When adding plasmid, the volume should not be greater than 1 / 10 of the competent volume; if the plasmid is impure or contaminated by organic matter such as ethanol, the transformation efficiency will drop sharply; if the plasmid doubles in size, the transformation efficiency will drop by an order of magnitude. Be gentle when mixing in plasmids. Transforming high-concentration plasmids can reduce the amount of bacteria used for plating accordingly. When the density of positive clones on the plate is too high, the positive clones grow slower and the colonies become smaller due to lack of nutrition. In order to obtain large colonies, the amount of plasmid should be reduced;

[0088] (5) After preheating at 37°C, transfer to a shaking incubator at 200 rpm for 2–3 h (preheating after transformation can increase homologous recombination and bacterial survival rate) to fully activate the bacteria.

[0089] (6) Spread the bacterial suspension on a TSA agar plate containing Km resistance, with 200 μL applied to one plate;

[0090] (7) Place the plate in a 37°C constant temperature incubator until the liquid is completely absorbed, invert the plate, and observe the results after incubation for 36 to 48 hours;

[0091] (8) After the bacteria grow, pick a single colony for bacterial liquid PCR, and sequence the bacterial liquid corresponding to the positive band;

[0092] (9) After the sequencing results were verified to be correct, the endotoxin-attenuated strain of Haemophilus parasuis was obtained, and the strain was expanded and freeze-dried and stored in a -80°C refrigerator.

[0093] The final endotoxin-attenuated strain of Haemophilus parasuis was preserved in the National and Local Joint Engineering Laboratory for Zoonotic Disease Prevention and Control Agents of South China Agricultural University, and this endotoxin-attenuated strain was used for subsequent experiments.

[0094] 5. Extraction of lipid A from Haemophilus parasuis

[0095] (1) The two endotoxin-attenuated strains of Haemophilus parasuis obtained in 2 were used to extract lipid A, and single bacteria were picked out and inoculated into 10 mL TSB medium, and cultured at 37°C in a shaking incubator for 16 h;

[0096] (2) 1% of the seed solution was added to 300 mL of TSB medium for expansion culture, and cultured overnight at 37°C and 200 rpm for 24 h;

[0097] (3) The cultured bacterial suspension was centrifuged at 3500 × g for 20 min to collect the cells;

[0098] (4) The bacterial precipitates were then washed twice with phosphate buffered saline (PBS), centrifuged at 5000 rpm for 15 min, and the bacterial cells were collected again (to wash away the excess culture medium to prevent any impact on subsequent experiments);

[0099] (5) Add 10 mL of double-distilled water to the precipitated bacteria and mix them evenly with a pipette to fully resuspend them in the double-distilled water. Observe the bacterial solution until there are no obvious bacterial clusters.

[0100] (6) Add 8 mL of bacterial solution to a 100 mL beaker and place a magnetic stirring bar in the beaker;

[0101] (7) Chloroform and methanol were added into a beaker at a final ratio of 1:2:0.8 (chloroform:methanol:water v / v) to form a single-phase Bligh / Dyer mixture;

[0102] (8) The bacterial solution and the mixture were magnetically stirred at room temperature for 1 h;

[0103] (9) Transfer the liquid to a Nalgene centrifuge tube and centrifuge at 2500 × g for 20 min;

[0104] (10) After centrifugation, a white precipitate was obtained. The supernatant was discarded and the precipitate was resuspended in 19 mL of a single-phase Bligh / Dyer mixture and washed once.

[0105] (11) Centrifuge again, discard the supernatant, and let stand for a while until the organic liquid evaporates and the precipitate becomes slightly dry;

[0106] (12) Add 13.5 mL of 12.5 mM sodium acetate (pH 4.5) to the dried pellet and vortex to fully resuspend the pellet;

[0107] (13) The resuspended pellet was placed in boiling water for 30 min to release lipid A from LPS;

[0108] (14) After cooling, add 15 mL of a 1:1 mixture of methanol and 15 mL of chloroform (final ratio 2:2:1.8);

[0109] (15) vortexing the mixture to fully lyse it and fully extract lipid A;

[0110] (16) After lysis, centrifuge at 2500 × g for 20 min to separate the two phases;

[0111] (17) Using a pipette, carefully transfer the lower part of the bottle, i.e., the chloroform phase, to a round-bottom flask and dry on a rotary evaporator for 30 min to obtain dry lipid A;

[0112] (18) The dried lipid A was dissolved in chloroform:methanol (2:1, v / v) by vortexing and sonication, transferred to a glass tube, dried, sealed with a Teflon-lined cap, and stored at −80 °C;

[0113] 6. MALDI-TOF / TOF-MS mass spectrometry analysis of lipid A

[0114] Mass spectrometry analysis of lipid A was performed in the negative ion mode of MALDI-TOF / TOF MS (matrix-assisted laser desorption ionization time-of-flight tandem mass spectrometry). The three extracted groups (A is lipid A extracted by wild sc096 strain, B is lipid A extracted by plasmid constructed by original LpxE gene, C is lipid A extracted by plasmid constructed by optimized LpxE gene) were spotted with 1 μL of lipid A onto the MALDI sample plate; then 1 μL of matrix solution dissolved in chloroform / methanol / water (3:1.5:0.25, v / v / v) was added; the laser intensity was adjusted to 500 shots and 50% laser power for analysis.

[0115] Note: For MS / MS analysis, the analysis was performed in LIFT mode. Based on the MS mass spectrum, the precursor ions were selected and the MS / MS analysis was performed in LIFT TOF / TOF mode. The instrument was calibrated using the ES Tuning Mix (Agilent, Palo Alto, CA, USA).

[0116] The results of mass spectrometry analysis of lipid A are as follows: Figures 4 to 6 As shown, Figure 4For wild-type sc096, the phosphorus ratio is 2.40%; Figure 5 It is native LpxE, with a dephosphorization ratio of 29.64%; Figure 6 The optimized LpxE gene was used, and the dephosphorylation effect of group C reached 83.96%, indicating that the optimization effect was good. At the same time, it was determined through mass spectrometry that LpxE specifically removed the phosphate group on the A1 position of some lipids in the sc096 strain in the attenuated strain of Haemophilus parasuis endotoxin, and the results showed that the lipopolysaccharide structure of Haemophilus parasuis was successfully transformed.

[0117] One of the advantages of the present invention is that LpxE is optimized by a selected codon optimization strategy to obtain an optimized LpxE gene, and the dephosphorylation effect of the optimized LpxE gene reaches 83.96%. Compared with the applicant's prior patent application CN115216478B, the construction method of a avian Pasteurella multocida endotoxin attenuated inactivated vaccine strain and the dephosphorylation effect of avian Pasteurella multocida obtained by application is increased by 65%, and the dephosphorylation effect is equivalent to 5 times that of the prior scheme.

Claims

1. A method for preparing an attenuated vaccine strain of Haemophilus parasuis endotoxin, characterized in that: The plasmid containing the optimized LpxE gene is transformed into Haemophilus parasuis by electroporation to obtain an endotoxin attenuated vaccine strain; the sequence of the optimized LpxE gene is shown in SEQ ID NO.

1.

2. The preparation method according to claim 1, characterized in that: The plasmid vector is a pET28 plasmid vector.

3. An attenuated endotoxin vaccine strain of Haemophilus parasuis, characterized in that: The method is prepared according to claim 1 or 2.

4. Use of the attenuated endotoxin vaccine strain of Haemophilus parasuis as claimed in claim 3 for preparing a vaccine.

5. A vaccine, characterized in that Contains the attenuated vaccine strain of Haemophilus parasuis endotoxin as claimed in claim 3.

Images