Replication-deficient adenovirus vector and application thereof

Abstract

The invention discloses a single plasmid vector for packaging replication-deficient recombinant human type-4 adenovirus and application thereof, the single plasmid vector contains a human type-4 adenovirus genome with completely deleted E1 region and E3 region and modified E4 region, the unmodified E4 region comprises CDS1, CDS2, CDS3, CDS4, CDS5 and CDS6 regions, and the E4 region comprises a CDS1 region, a CDS2 region, a CDS3 region, a CDS4 region, a CDS5 region and a CDS6 region. The modification comprises that the CDS5 region of the E4 region of the human type 4 adenovirus genome is replaced by the ORF6 region of the E4 region of the human type 5 adenovirus. The vector can be used for rapidly and efficiently preparing the human type 4 adenovirus vector recombinant virus capable of stably expressing the exogenous gene, and has the advantages of safety, strong immunogenicity and high production efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid technology, and in particular, relates to a replication-deficient recombinant human adenovirus type 4 vector and an application thereof. Background Art

[0002] Adenovirus is non-enveloped, has a regular icosahedral symmetric structure, and is 70-90 nm in diameter. Its genome is a single-stranded double-stranded DNA with a length of about 36 kb. There is an inverted terminal repeat (ITR) at each end of the genome, and the inner side of the upstream terminal repeat contains a packaging signal to control the packaging of the recombinant virus. After the genome enters the nucleus, the adenovirus will initiate an orderly and complex step-by-step amplification transcription and splicing process. According to the transcription time, the genome coding region can be divided into early transcription regions (E1-E4) and late transcription regions (L1-L5). Among them, the E1 region is an important protein that regulates cell metabolism and activates early gene expression. The loss of E1 will cause the virus to lose its ability to replicate. The function of the E3 region is mainly related to the function of the virus escaping the immune surveillance of host cells. The loss of E3 will not block the replication and assembly of the virus. The adenovirus E4 region can cooperate with the E1 region to promote viral replication, which is related to the virus packaging titer and production efficiency.

[0003] Adenovirus (AdV) is a long-studied human pathogen and a basic agent for human gene therapy and vaccine vectors. Adenovirus has been shown to be very effective in mediating antigen-specific T and B cell responses. Adenovirus as an antigen presentation vector has the advantages of a wide range of host infections, high antigen expression levels, the ability to induce strong cellular and humoral immune responses, low pathogenicity, no integration, and easy production. Among them, adenovirus type 5 (Ad5) recombinant vectors have been widely used in laboratory vaccine research. Most people have anti-Ad5 immunity due to natural infection or will acquire Ad5 immunity after primary immunization with Ad5 vectors. Pre-existing immunity to adenovirus type 5 is maintained at a high level worldwide, with a neutralizing antibody seropositivity rate of more than 70% in China, while the existing immunity level of Ad4 is significantly lower than that of Ad5. In human adenovirus vector vaccine studies, high pre-existing immunity to adenovirus type 5 significantly affects the antigen-specific humoral and cellular immune responses induced by adenovirus type 5 vector vaccines. In order to overcome pre-existing immunity, a series of adenovirus vectors of rare serotypes have been developed.

[0004] Adenovirus type 4 (Ad4) is also an ideal vector for recombinant vaccine development. Ad4 is the only member of the human adenovirus species E and was first isolated in the 1950s from military personnel with febrile acute respiratory illness. Ad4 and Ad7 live-virus oral vaccines have been used in the U.S. military since 1971 due to outbreaks of adenovirus-infected acute respiratory illness among recruits. In 2010, the U.S. Food and Drug Administration approved newer Ad4 and Ad7 oral vaccines for use in all branches of the U.S. military. Subsequently, an Ad4-based oral replication-competent H5N1 HA vaccine (Ad4-H5-Vtn) was developed. The Ad4-H5-Vtn vaccine also has a similar safety profile to the U.S. military Ad4 vaccine, and lower rates of asymptomatic transmission to close household contacts and children have been noted in previous studies.

[0005] At present, there is still a need to further develop adenovirus type 4 vectors with higher safety, immunogenicity and larger packaging capacity. The purpose of the present invention is to provide a new replication-deficient Ad4 vector to solve the above technical problems. Summary of the invention

[0006] Based on the above objectives, the present invention first provides a single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4, wherein the single plasmid vector contains a human adenovirus type 4 genome in which the E1 region and the E3 region are completely deleted and the E4 region is modified, wherein the unmodified E4 region includes CDS1, CDS2, CDS3, CDS4, CDS5, and CDS6 regions, and the modified CDS5 region including the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5.

[0007] In a preferred embodiment, on the basis that the CDS5 region is replaced by the ORF6 region of the E4 region of human adenovirus type 5, the modification also includes that any one or more regions of CDS1, CDS2, CDS3, CDS4, and CDS6 regions of the E4 region are replaced by ORF1, ORF2, ORF3, ORF4, and ORF7 regions of the E4 region of human adenovirus type 5, respectively. The one region refers to at least one region being replaced, for example, CDS6 region is replaced by ORF7 region; the multiple regions include 2, 3 or 4 regions being replaced, or until all 5 regions are replaced, for example, CDS6 region is replaced by ORF7 region, and at the same time, CDS4 region is also replaced by ORF4 region; or, The CDS6 region is replaced by the ORF7 region, the CDS4 region is also replaced by the ORF4 region, and at the same time, the CDS3 region is also replaced by the ORF3 region; or CDS6 region is replaced by ORF7 region, CDS4 region is also replaced by ORF4 region, CDS3 region is also replaced by ORF3 region, and CDS2 region is also replaced by ORF2 region; or The CDS6 region is replaced by the ORF7 region, the CDS4 region is replaced by the ORF4 region, the CDS3 region is replaced by the ORF3 region, the CDS2 region is replaced by the ORF2 region, and at the same time, the CDS1 region is replaced by the ORF1 region.

[0008] In a specific embodiment of the present invention, the sequence of the modified E4 region is as shown in SEQ ID NO.1. In the present invention, the modified E4 region with this technical solution means that the CDS5 region of the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5 genome, the CDS6 region is replaced by the ORF7 region, the CDS4 region is replaced by the ORF4 region, the CDS3 region is replaced by the ORF3 region, the CDS2 region is replaced by the ORF2 region, and the CDS1 region is replaced by the ORF1 region. The E region modification with this technical solution is named "A" type modification in the present invention; or The sequence of the modified E4 region is shown in SEQ ID NO.5. In the present invention, the modified E4 region with this technical solution means that the CDS5 region of the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5 genome, the CDS6 region is replaced by the ORF7 region, and the CDS4 region is replaced by the ORF4 region. The E region modification with this technical solution is named "E" type modification in the present invention; or The sequence of the modified E4 region is shown in SEQ ID NO.6. In the present invention, the modified E4 region with this technical solution means that the CDS5 region of the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5, and the CDS6 region is replaced by the ORF7 region. The E region modification with this technical solution is named "F" type modification in the present invention; or The sequence of the modified E4 region is shown in SEQ ID NO.7. In the present invention, the modified E4 region having this technical solution refers to the CDS5 region of the E4 region of the human adenovirus type 4 genome being replaced by the ORF6 region of the E4 region of the human adenovirus type 5 genome; the E region modification having this technical solution is named "G" type modification in the present invention.

[0009] In an alternative embodiment, on the basis that any one or more of the CDS1, CDS2, CDS3, CDS4, and CDS6 regions in the E4 region are replaced by ORF1, ORF2, ORF3, ORF4, and ORF7 regions of the E4 region of human adenovirus type 5, respectively, the modification further includes the deletion of one or more regions that are not replaced in the E4 region. The one region refers to at least one region being deleted, such as deleting the unsubstituted CDS1 region; the multiple regions include 2, 3, or 4 regions being deleted, or until all 5 regions are deleted; for example, deleting the unsubstituted CDS1 region and CDS2 region; or Deletion of the unsubstituted CDS1, CDS2 and CDS3 regions; or Deletion of the unsubstituted CDS1, CDS2, CDS3 and CDS4 regions; or The unsubstituted CDS1, CDS2, CDS3, CDS4 and CDS6 regions were deleted.

[0010] In a specific embodiment of the present invention, the sequence of the modified E4 region is as shown in SEQ ID NO.2. In the present invention, the modified E4 region having this technical solution means that the CDS5 region of the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5, and the CDS1 region, CDS2 region, CDS3 region, CDS4 region, and CDS6 region are all deleted. The E region modification having this technical solution is named "B" type modification in the present invention; or The sequence of the modified E4 region is shown in SEQ ID NO.3. In the present invention, the modified E4 region with this technical solution means that the CDS5 region of the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5, the CDS6 region is replaced by the ORF7 region, and the CDS1 region, CDS2 region, CDS3 region, and CDS4 region are all deleted. The E region modification with this technical solution is named "C" type modification in the present invention; or The sequence of the modified E4 region is shown in SEQ ID NO. 4. In the present invention, the modified E4 region with this technical solution means that the CDS5 region of the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5, the CDS6 region is replaced by the ORF7 region, the CDS4 region is replaced by the ORF4 region, and the CDS1 region, CDS2 region, and CDS3 region are all deleted. The E region modification with this technical solution is named "D" type modification in the present invention; In a more preferred embodiment, in the single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4, the foreign gene insertion site is located after the packaging signal of human adenovirus type 4 and before the original E1 region.

[0011] More preferably, the single plasmid vector system for packaging replication-deficient recombinant human adenovirus type 4 also includes a vector sequence for plasmid amplification in bacteria, a pBR322 replication origin, and an antibiotic resistance gene.

[0012] Particularly preferably, the human adenovirus type 4 is RI67 adenovirus.

[0013] Secondly, the present invention provides a method for packaging a recombinant human adenovirus type 4 using the above-mentioned single plasmid vector, the method comprising the following steps: (1) Inserting the target gene into the above-mentioned single plasmid vector to construct a recombinant human adenovirus type 4 vector recombinant plasmid; (2) linearizing the human adenovirus type 4 vector recombinant plasmid obtained in step (1) using restriction endonuclease; (3) transfecting the linearized human adenovirus type 4 vector recombinant plasmid obtained in step (2) into host cells and culturing until cytopathic effect occurs; (4) The cell culture medium after freezing and thawing is continuously passaged until the cells continue to have lesions; (5) Obtain a stably propagated recombinant human adenovirus type 4.

[0014] In a specific embodiment of the present invention, the target gene is the SARS-CoV-2 full-length S protein encoding gene. Those skilled in the art can use other protective antigen encoding genes as target genes for packaging to obtain recombinant human adenovirus type 4 that meets the intended application.

[0015] Finally, the present invention provides the use of the above-mentioned single plasmid vector in the preparation of vaccines, gene therapy drugs and / or tumor therapeutic drugs. Based on the different packaging of the target gene by the single plasmid vector system provided by the present invention, different preparation applications can be provided. For example, when the target gene is a protective antigen encoding gene, the single plasmid vector is prepared as a vaccine; when the target gene is a gene regulatory element, the single plasmid vector is prepared as a gene therapy drug, or when the target gene is an immune effector molecule encoding gene or a targeting molecule encoding gene, the single plasmid vector is prepared as a tumor therapeutic drug.

[0016] In a preferred embodiment, the single plasmid vector is prepared as an intramuscular injection or nasal drops. In the specific implementation of the present invention, the single plasmid vector can be prepared as an intramuscular injection or nasal drops according to the needs of the specific application. The embodiment of the present invention shows that the same modification scheme exhibits slightly different technical effects in intramuscular injection and nasal drop administration. Therefore, according to the specific disease type and the requirements of the administration route, a suitable E-zone modification scheme can be selected to prepare a targeted pharmaceutical dosage form. For example, "B" type modification and "G" type modification are suitable for preparation as intramuscular injection, "F" type modification and "C" type modification are suitable for preparation as nasal drops, and "E" type modification and "A" type are suitable for both dosage forms.

[0017] In a specific embodiment of the present invention, the target gene is a gene encoding the S protein of the novel coronavirus, and the vaccine is a novel coronavirus S protein vaccine. Those skilled in the art will appreciate that vaccines for infectious diseases caused by the corresponding microorganisms can also be prepared based on the single plasmid vector provided by the present invention by selecting protective antigens of other microorganisms.

[0018] The present invention uses a human adenovirus type 4 RI67 strain (GenBank No.AY594253) that has long been used as a live virus vaccine as a template to develop a replication-deficient Ad4 vector. The human adenovirus type 4 vector constructed by the present invention is a replication-deficient adenovirus vector. In conventional adenovirus type 5 vectors, the adenovirus E1 region and E3 region are deleted, wherein the deletion of the E1 region causes the virus to lose its replication ability. In production, 293 cells supplemented with the E1 region gene of the adenovirus type 5 are generally used for expansion culture. The present invention constructs a replication-deficient Ad4 vector on the replicative recombinant Ad4 vector constructed in the early stage. Since the upper limit of adenovirus packaging capacity is about 5%-10% of the whole genome, based on the previous knockout of adenovirus E3 region to expand the upper limit of viral vector packaging capacity to more than 6000bp, in order to further improve its safety, we deleted the E1 region of adenovirus replication essential region to make it lose its replication ability, and modified the E4 region, wherein the CDS5 region of the E4 region was replaced by the ORF6 region of the E4 region of human adenovirus type 5, and infected HEK293 cells. After 48 hours, the virus production efficiency was increased by 6.3 times compared with the wild-type type 4 adenovirus recombinant virus, and then supplemented with the replacement or deletion of other regions, for example, after the CDS4 region and CDS6 region were replaced by the ORF4 region and ORF7 region of the E4 region of human adenovirus type 5, not only the production efficiency was increased by 9.1 times compared with the wild-type type 4 adenovirus recombinant virus, but also the highest level of neutralizing antibodies could be induced, which was 1.89 times higher than that of Ad4-dE1,3-S. It shows that the replication-deficient Ad4 vector provided by the present invention has the potential to be prepared as a recombinant vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Flow chart for constructing adenovirus type 4 backbone plasmid with E1 and E3 region deletion. N Ⅰ Linearized adenovirus type 4 terminal recombinant plasmid (A) was homologously recombined with Ad4-RI67 genome (B) to obtain closed circular adenovirus backbone plasmid Ad4-V0 (C). Based on this plasmid, adenovirus type 4 recombinant plasmid with E3 region deletion was obtained through homologous recombination and resistance screening. At the same time, the A base at 2692bp was mutated to G base, and the original Pme I site, add base AAAC at the 2939bp of the free sequence between the packaging signal and the E1 region to introduce Pme Ⅰ restriction site, newly introduced Pme I restriction site is the cloning site for inserting the exogenous gene expression frame, thus obtaining the backbone plasmid Ad4-dE3-E1R (D). Pme Ⅰ and N The E1 region was deleted by enzyme digestion with I, and the backbone plasmid after double enzyme digestion was spliced ​​with the exogenous gene expression frame (E) using the Gibson in vitro recombination method to construct a type 4 adenovirus vector recombinant plasmid Ad4-dE1,3-S (F) with E1 / E3 region deleted and exogenous gene expression frame (S) embedded.

[0020] Figure 2 This is a schematic diagram of seven different modifications of the E4 region of adenovirus type 4 and the original Ad4-S plasmid. All or part of ORF4, ORF6, and ORF7 in the Ad5 E4 region replaced CDS1-6 in the Ad4 E4 region. CDS1-6 was inferred to be the coding region ORF1-7 based on the protein size.

[0021] Figure 3 Flow chart for constructing a human adenovirus type 4 vector with E1 and E3 regions deleted and E4 region modified. Using the type 4 adenovirus genome as a template, the upstream and downstream sequences of the E4 region were amplified as the upstream homology arm (up) and downstream homology arm (down), and the E4 homologous recombination plasmid was obtained by splicing different modified fragments of the E4 region in the middle. Spe Ⅰ and Pme Ⅰ Double enzyme digestion of Ad4-dE1,3-S backbone plasmid (A), and Gibson in vitro recombination between it and linearized E4 homologous recombination plasmid (B) can obtain type 4 adenovirus recombinant plasmid with E1 / E3 deleted and E4 region modified (Ad4-dE1,3-E4 modification) (C).

[0022] Figure 4This is a replication defect verification of the E1 / E3-deficient adenovirus type 4 recombinant virus. The Ad4-dE3-E1R recombinant virus with only E3 deficiency and the Ad4-dE1,3-S recombinant virus with both E1 and E3 deficiency were infected with A549 cells at the same multiplicity of infection. After 48 hours, the titer test results showed that the titer of the Ad4-dE3-E1R recombinant virus could reach 2×10 8 IFU / ml, the virus cannot be effectively amplified in A549 cells after the deletion of the E1 region (A). The Ad4-dE1,3-S recombinant virus was used to infect HEK293 cells and A549 cells at the same multiplicity of infection. The virus fluid was collected and the adenovirus titer was detected at 15h, 24h, 48h, 72h, and 96h after infection. A one-step growth curve was drawn and it was found that the recombinant virus could be amplified in HEK293 cells (a complementary cell line containing the gene of the E1 region, which is essential for adenovirus replication) and basically reached a peak at 48 hours, while it lost its replication ability in A549 cells, indicating that the recombinant virus was replication-defective (B).

[0023] Figure 5 The results show the expression of exogenous genes in HEK293 and A549 cells after infection with human adenovirus type 4 recombinant viruses with different E4 modifications. Seven E4-modified recombinant viruses (Ad4-A to -G), adenovirus type 5 control (Ad5-S), adenovirus type 4 vector (Ad4-NULL, no exogenous gene), and adenovirus type 4 without E4 modification (Ad4-dE1,3-S) were used to infect HEK293 and A549 cells at an infection multiplicity of 1. After 24 hours of infection, the supernatant was removed, the cells were lysed, and the expression level of Spike protein in the cells was identified by Western blot. The results showed that in HEK293 cells (A), Ad4-A to -G could express proteins at high levels, which was basically consistent with the expression levels of Ad5-S and Ad4-S, while in A549 cells (B), the expression level of Ad4-A,-Dto -G was higher than that of the other two modified methods, and even higher than that of Ad5-S and Ad4-dE1,3-S.

[0024] Figure 6 The neutralizing antibody levels induced by immunizing Balb / c mice with human adenovirus type 4 recombinant viruses with different E4 modifications were shown in Table 1. 7 IFU was used to immunize mice by intramuscular injection or intranasal administration, and the neutralizing antibody level in the mouse serum was detected 28 days after immunization. Whether by intramuscular injection (A) or intranasal administration (C), the E4 region modification of Ad4-E, i.e., replacing the Ad5 E4 ORF4-7 with the Ad4 E4 CDS4-5 region, can induce the highest level of neutralizing antibodies, and there is no significant difference in the neutralizing antibodies induced by Ad5-S (B, D).

[0025] Figure 7 The results of the titer test of human adenovirus type 4 with different E4 modification methods. Each group of adenovirus type 4 recombinant viruses was infected with HEK293 cells using the same infection multiplicity of 1, and the virus liquid was collected 48 hours later to detect the peak titer of adenovirus. The results showed that the 7 E4 region modification methods can significantly improve the production efficiency of adenovirus type 4 in HEK293 cells, and the peak titer increased by about 4-9 times compared with the original (A). Among them, the virus production efficiency of the Ad4-E type E4 region modification method can reach the same level as that of adenovirus type 5 (B). DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0027] Unless otherwise specified, the starting plasmids, enzymes, and related reagents used in the following examples can all be purchased from commercial companies, and the primers used are synthesized by a synthesis company.

[0028] Example 1: Construction of human adenovirus type 4 with deletion of E1 and E3 regions and modification of E4 region 1. Preparation of adenovirus type 4 recombinant plasmid with E3 region deleted like Figure 1 As shown, use N Ⅰ Linearized adenovirus type 4 terminal recombinant plasmid ( Figure 1 A), and the Ad4-RI67 genome ( Figure 1 The closed circular adenovirus backbone plasmid Ad4-V0 ( Figure 1 C). Based on this plasmid, adenovirus type 4 recombinant plasmid with E3 region deleted was obtained through homologous recombination and resistance screening ( Figure 1 D), mutate the A base at 2692bp to a G base, delete the original Pme I site, add base AAAC at the 2939bp of the free sequence between the packaging signal and the E1 region to introduce Pme Ⅰ restriction site, newly introduced Pme The I restriction site is the cloning site for embedding the exogenous gene expression cassette, and the backbone plasmid Ad4-dE3-E1R is obtained. The construction of the terminal recombinant plasmid (Ad4-re), the Ad4 backbone plasmid (PAd4-V0), and the specific steps for preparing the E3-deficient recombinant plasmid Ad4-dE3-E1R are shown in CN111057716A, which is incorporated by reference in the present invention as part of the specification of the present invention.

[0029] 2. Introduction of E3-deficient human adenovirus type 4 backbone plasmid upstream of the E1 region Pme I monoclonal site The construction method is as follows: adenovirus backbone plasmid PAd4-dE3 is used Pme I and N After digestion with I, overlapping PCR was used to amplify the complementing fragment. During the preparation of the complementing fragment, the A base at 2692 bp of the PAd4-dE3 plasmid (corresponding to 204 bp of the Ad4-RI67 genome) was mutated to a G base to delete the original Pme I site, adding base AAAC between the packaging signal and the E1 region at 2939 bp to introduce Pme I restriction site. Overlap PCR requires the following two primer pairs: The primer pairs used to amplify the upstream fragment were: Ad4-E1-dPme1-1F: AACGAGGTGTGGTTTG (SEQ ID NO. 10), and Ad4-E1-dPme1-1R: CAGCTGACACCTACGTAAGTTTTAAACACCGGACTTTGACACCG (SEQ ID NO. 11), The primer pairs for the downstream fragment are: Ad4-E1-dPme1-2F: CGGTGTCAAAGTCCGGTGTTTAAACTTACGTAGGTGTCAGCTG (SEQ ID NO. 12), and Ad4-GP-E1-dPme1-2R: ACGGCGGCCAGCATATGACTG (SEQ ID NO. 13).

[0030] The PCR-amplified complemented fragment was spliced ​​with the double-enzyme-digested backbone plasmid PAd4-dE3 using the Gibson in vitro one-step recombination method, transformed into TOP10 competent cells, and the positive clone PAd4-dE3-E1 was screened using kanamycin.

[0031] 3. Preparation of replication-defective human adenovirus type 4 recombinant plasmid pAd4-dE1,3-S Use the following primer pairs to PCR amplify the target gene (Spike) expression frame fragment: Ad4-MCMV-F: GGTGTCAAAGTCCCGGTGTTTAAACGAGTCATTAGGGACTTTCC (SEQ IDNO.14), and Ad4-WTS-R: CATGCACGGCGGCCAGCATATGGGATCTTCGATGCTAGACG (SEQ ID NO. 15).

[0032] Add about 20 bp of homologous regions to the ends of the forward and reverse primers to obtain the exogenous gene expression frame ( Figure 1 E), using Gibson in vitro recombination, and Pme I and N I double-digested plasmid ( Figure 1 D) Direct splicing to prepare the replication-defective human adenovirus type 4 recombinant plasmid pAd4-dE1,3-S for packaging recombinant virus ( Figure 1 F).

[0033] 4. Construction of human adenovirus type 4 with deletion of E1 and E3 regions and modification of E4 region (1) Various E4 region modification strategies and construction like Figure 2 As shown, Ad4 CDS1 is E4 13.5KDa protein (GenBank No.AAT97374.1, corresponding to 35232-35606 bp of Ad4-RI67 genome); Ad4 CDS2 is E4 14.6KDa protein (GenBank No.AAT97472.1, corresponding to 34795-35184 bp of Ad4-RI67 genome); Ad4 CDS3 is E4 13.7KDa protein (GenBank No.AAT97471.1, corresponding to 34445-34798 bp of Ad4-RI67 genome); Ad4 CDS4 is E4 14.1KDa protein (GenBank No.AAT97470.1, corresponding to 34068-34436 bp of Ad4-RI67 genome); Ad4 CDS5 is E4 34.6KDa protein (GenBank No.AAT97469.1, corresponding to 33266-34165bp of Ad4-RI67 genome); Ad4 CDS6, i.e. E4 7.4KDa protein (GenBank No.AAT97467.1, corresponding to 33018-33212bp of Ad4-RI67 genome).

[0034] In the HAd5 genome (GenBank No. AC_000008), Ad5 E4 ORF 1 (GenBank No. AP000232.1, corresponding to 35140-35526 bp in the HAd5 genome); Ad5 E4 ORF 2 (GenBank No. AP000231.1, corresponding to 34700-35092 bp in the HAd5 genome); Ad5 E4 ORF 3 (GenBank No. AP000230.1, corresponding to 34353-34703 bp in the HAd5 genome); Ad5 E4 ORF 4 (GenBank No. AP000229.1, corresponding to 33998-34342 bp in the HAd5 genome); Ad5 E4 ORF 6, i.e. E4 34K (GenBank No. AP 000228.1, corresponding to 33193-34077 bp in the HAd5 genome); bp); Ad5 E4 ORF 7, i.e., part of E4 ORF6 / 7 (GenBank No. AP 000227.1, corresponding to 32914-33192 bp of HAd5 genome).

[0035] Ad4-A (SEQ ID NO.1), CDS1-6 of Ad4 E4 region are completely replaced with Ad5 E4 ORF1-7; Ad4-B (SEQ ID NO.2), Ad4 E4 region is deleted, and only Ad5 E4 ORF6 is inserted; Ad4-C (SEQ ID NO.3), Ad4 E4 region is deleted, and only Ad5 E4 ORF6-7 is inserted; Ad4-D (SEQ ID NO.4), Ad4 E4 region is deleted, and only Ad5 E4 ORF4, 6, and 7 are inserted; Ad4-E (SEQ ID NO.5), Ad4 E4 CDS4-6 are replaced with Ad5 E4 ORF4, 6, and 7; Ad4-F (SEQ ID NO.6), Ad4 E4 CDS5-6 are replaced with Ad5 E4 ORF6-7; Ad4-G (SEQ ID NO.7), Ad4 E4 CDS5 is replaced with Ad5 E4 ORF6. The replacement can increase the adaptability of the E4 region to the Ad5 E1 gene in the Ad5 complementing cell line HEK293, thereby improving the amplification efficiency of Ad4 in HEK293 cells.

[0036] (2) Construction of human adenovirus type 4 vector with E1 and E3 regions deleted and E4 region modified Ad4-dE1,3-S backbone plasmid ( Figure 3 A) Use Spe I and Pme I double digestion, it and the linearized E4 homologous recombination plasmid ( Figure 3 B) The upstream homology arm and the downstream homology arm (SEQ ID NO.8-9) are subjected to Gibson in vitro recombination to obtain a human adenovirus type 4 vector with E1 and E3 regions deleted and E4 region modified.

[0037] Example 2: Verification of replication defect of human adenovirus type 4 vector recombinant virus pAd4-dE1,3-S The human adenovirus type 4 vector recombinant plasmid pAd4-dE1,3-S is a closed circular structure. Pac I restriction endonuclease linearized human adenovirus type 4 recombinant plasmid, selected HEK293 cells as packaging cell lines, used Turbofect transfection reagent to transfect the linearized fragment into HEK293 cells, and maintained culture until the cells became cytopathic. The cell culture fluid after freeze-thaw lesions was continuously passaged until the cells continued to become cytopathic, and the recombinant virus of stable passage was obtained. The titer of the packaged recombinant virus was detected by capsid protein immunoassay, and the specific process was as follows: 2.5×10 5 HEK293 cells were seeded in each well of a 24-well plate. Viruses were serially diluted in DMEM supplemented with 10% fetal bovine serum, and 50 μl of virus dilution was added to each well. After incubation at 37°C for 48 hours, the cell supernatant was removed, and the cells were fixed with pre-cooled methanol at −20°C for 20 minutes. 250 ul of Mouse Anti-Adenovirus Hexon primary antibody was added to each well and incubated at 37°C for 1 hour, washed three times with 1% BSA PBS, and then 250 μl of Goat pAb to Ms IgG2a (HRP) secondary antibody was added and incubated at 37°C for 1 hour, washed three times with 1% BSA PBS, and stained with DAB substrate. Positive cells appeared dark brown.

[0038] After obtaining the virus titer, the Ad4-dE3-E1R recombinant virus lacking only E3 and the Ad4-dE1,3-S recombinant virus lacking both E1 and E3 were infected with A549 cells at the same multiplicity of infection. After 48 hours, the titer of the Ad4-dE3-E1R recombinant virus reached 2×10 8 IFU / ml, but the virus could not be effectively amplified in A549 cells after the E1 region was deleted, and the virus titer was only 10 4 IFU / ml( Figure 4 A). HEK293 cells (a complementing cell line containing the E1 region gene of the adenovirus replication essential region) and A549 cells were infected with Ad4-dE1,3-S recombinant virus at the same multiplicity of infection. Virus fluid was collected at 15h, 24h, 48h, 72h, and 96h after infection, and a one-step growth curve was drawn. It was found that the recombinant virus could be amplified in HEK293 cells and basically reached a peak at 48 hours, while it lost its replication ability in A549 cells ( Figure 4B), indicating that the recombinant virus is replication-defective.

[0039] Example 3: Expression of exogenous genes in cells of recombinant viruses containing modified plasmids containing human adenovirus type 4 E4 region Western blotting was used to investigate the expression of the exogenous gene SARS-CoV-2 full-length S protein encoding gene (GenBank No. NC_045512.2, 14-1273 aa)) after HEK293 and A549 cells were infected with human adenovirus type 4 recombinant viruses with different E4 modifications. The virus packaging steps are as follows: (1) Insert the SARS-CoV-2 full-length S protein encoding gene into the Ad4 vector to construct a recombinant plasmid; (2) Linearize the human adenovirus type 4 vector recombinant plasmid using PacI restriction endonuclease; (3) Transfect the target gene fragment into host cells and culture them until they become cytopathic; (4) The cell culture medium after freezing and thawing is continuously passaged until the cells continue to have lesions; (5) Obtain a stably propagated recombinant human adenovirus type 4.

[0040] One day in advance, HEK293 cells and A549 cells were plated in six-well plates, and seven E4-modified recombinant viruses (Ad4-A to -G) and adenovirus type 5 control (Ad5-S), adenovirus type 4 vector (Ad4-NULL, no exogenous gene), and adenovirus type 4 without E4 region modification (Ad4-dE1,3-S) were used to infect the two types of cells at an infection multiplicity of 1. After 24 hours of infection, the culture supernatant was discarded, the cells were washed with RIPA lysis buffer and mixed, the cells were lysed on ice, and the supernatant was obtained by centrifugation. Then, the lysate was centrifuged and mixed with protein loading buffer and boiled. The sample was transferred to a PVDF membrane using a 4-12% PAGE gel using a membrane transfer instrument. Afterwards, 5% skim milk was prepared using TBST, and the protein membrane was transferred to skim milk, incubated at room temperature for 1 hour with shaking, and the primary antibody SARS-CoV-2 (2019-nCoV) Spike Antibody was diluted with 5% skim milk at a dilution factor of 1:2000, and the protein membrane was transferred to the primary antibody diluent, incubated at room temperature for 1 hour with shaking, and the protein membrane was transferred to TBST washing solution for washing. 5% skim milk was used to dilute the secondary antibody Goat pAb to MsIgG (HRP) at a dilution factor of 1:10000, and the protein membrane was transferred to the secondary antibody diluent, incubated at room temperature for 1 hour, and the membrane was washed again. The HRP detection substrates A and B were mixed, and the protein membrane was washed with the mixed solution. The protein membrane was quickly placed in a chemiluminescence imager, and the appropriate light source and exposure time were selected to detect the protein bands. Finally, the specific β-actin protein antibody was used to incubate the membrane and wash it to detect the β-actin protein band. The results showed that in HEK293 cells ( Figure 5 A, C) Ad4-A to -G can express proteins at high levels, which is basically consistent with the expression levels of Ad5-S and Ad4-dE1,3-S. In A549 cells ( Figure 5 B, D) The expression levels of Ad4-A to -G were higher than those of Ad4-dE1,3-S, and Ad4-D to -G increased by more than 1.5 times. Figure 5 The fold difference of protein expression level between the modified group and the unmodified group is shown in FIG.

[0041] Example 4: Detection of neutralizing antibody levels induced by immunization of mice with human adenovirus type 4 E4 region modified plasmid recombinant virus 1. Construction of a replication-defective, luciferase-expressing HIV backbone pseudovirus containing the full-length SARS-CoV-2 S protein The synthetic SARS-CoV-2 S sequence (NC_045512.2) was cloned into the pCAGGS plasmid (purchased from Ubao Bio) to construct the pCAGGS-S plasmid. One day in advance, HEK293T cells were inoculated to 10 cm2 In the plate, when the cells are about 90% confluent, TurboFect transfection reagent is used to co-transfect the cells with HIV backbone plasmid and pCAGGS-S plasmid. After 48 hours, the supernatant is collected and filtered to obtain the replication-defective HIV backbone pseudovirus containing the full-length S protein of SARS-CoV-2 and expressing luciferase and stored at -70°C.

[0042] 2. Mouse Inoculation Each group of adenovirus type 4 recombinant vaccine was given the same dose of 10 7 IFU was administered intramuscularly or intranasally to immunize mice, and the neutralizing antibody levels in the mouse serum were detected 28 days after immunization.

[0043] 3. Serum neutralizing antibody detection Neutralizing antibody levels were detected using a replication-defective, luciferase-expressing HIV backbone pseudovirus containing the full-length S protein of SARS-CoV-2.

[0044] In the serum neutralizing antibody test, serum samples were heat inactivated at 56°C for 30 minutes, pseudovirus was diluted and mixed with serially diluted samples in a 96-well plate. After incubation at 37°C for 1 hour, ACE2-293T cells were added, and luciferase levels were detected using a luciferase assay kit after incubation at 37°C and 5% CO2 for 48 hours. The results showed that whether intramuscular injection ( Figure 6 A) or nasal administration ( Figure 6 In the C) method, the Ad4-E type E4 region modification method, that is, replacing the Ad4E4 CDS4-5 region with the Ad5 E4 ORF4,6,7 can induce the highest level of neutralizing antibodies, which is 1.89 times higher than that of Ad4-dE1,3-S (2287 / 1213), and there is no significant difference in the neutralizing antibodies induced by Ad5-S ( Figure 6 B, D).

[0045] Example 5: Detection of adenovirus titer of recombinant virus containing modified plasmid of human adenovirus type 4 E4 region The adenovirus titer was detected by protein immunoassay. The specific method is as follows: 1. Inoculate HEK293 cells in a 24-well plate and add 0.5 ml of cell suspension to each well, i.e. 2.5×10 5 cells. Dilute the virus solution 10-fold, take 50 μl of the virus dilution solution and add it dropwise to the HEK293 cell culture wells, and culture at 37℃ for 48 hours. Remove the culture medium, slowly add 0.5 ml of -20°C pre-cooled 100% methanol along the well wall, and let it stand at -20℃ for 10 min. Remove the methanol and wash 3 times with 0.5 ml of PBS solution containing 1% BSA.

[0046] 2. Dilute the Mouse Anti-Adenovirus Hexon primary antibody at 1:1000, remove the last rinse, add 0.25 ml of antibody diluent to each well, and incubate at 37°C for 1 hour. Remove the primary antibody, wash three times with 0.5 ml PBS+1% BSA solution. Dilute the Goat pAb to Ms IgG2a (HRP) secondary antibody at 1:2000, remove the last rinse, add 0.25 ml of antibody diluent to each well, and incubate at 37°C for 1 hour.

[0047] 3. Prepare working solution by diluting DAB substrate at 1:30 and place at room temperature. Remove secondary antibody and wash three times with 0.5 ml PBS solution containing 1% BSA. Remove the last rinse solution and add 0.25 ml DAB working solution to each well and incubate at room temperature for about 10 minutes until the color is clear. Remove DAB working solution and add 0.5 ml PBS and store at 4°C.

[0048] 4. Observe the plaques under a microscope.

[0049] The calculation method is titer (IFU / mL) = (number of spots in a single field of view) × 79 (number of fields of view) / 0.05 (amount of virus added) / dilution multiple.

[0050] Each group of adenovirus type 4 recombinant viruses was infected with HEK293 cells at the same infection multiplicity of 1. After 48 hours, the virus solution was collected to detect the peak adenovirus titer. The results showed that the seven E4 region modification methods could significantly improve the production efficiency of adenovirus type 4 in HEK293 cells, and the peak titer increased by about 4-9 times compared with the original ( Figure 7 A), in which the virus production efficiency of Ad4-E type E4 region modification can reach the same level as type 5 adenovirus 10 9 IFU / mL, 9 times higher than before ( Figure 7 B).

Claims

1. A single plasmid vector for packaging a replication-defective recombinant human adenovirus type 4, characterized in that: The single plasmid vector contains a human adenovirus type 4 genome in which the E1 and E3 regions are completely deleted and the E4 region is modified, wherein the unmodified E4 region includes CDS1, CDS2, CDS3, CDS4, CDS5, and CDS6 regions, and the modified CDS5 region including the E4 region of the human adenovirus type 4 genome is replaced by the ORF6 region of the E4 region of the human adenovirus type 5.

2. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 1, characterized in that: The modification includes any one or more of CDS1, CDS2, CDS3, CDS4 and CDS6 in the E4 region being replaced by ORF1, ORF2, ORF3, ORF4 and ORF7 of the E4 region of human adenovirus type 5, respectively.

3. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 2, characterized in that: The sequence of the modified E4 region is shown in any one of SEQ ID NO.1, SEQ ID NO.5 to SEQ ID NO.

7.

4. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 2, characterized in that: The modification also includes deletion of one or more regions in the E4 region that are not substituted.

5. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 4, characterized in that: The sequence of the modified E4 region is shown in any one of SEQ ID NO.2 to SEQ ID NO.

4.

6. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 1, characterized in that: In the single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4, the foreign gene insertion site is located after the packaging signal of human adenovirus type 4 and before the original E1 region.

7. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 6, characterized in that: The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 also includes a vector sequence for plasmid amplification in bacteria, a pBR322 replication origin and an antibiotic resistance gene.

8. The single plasmid vector for packaging replication-deficient recombinant human adenovirus type 4 according to claim 7, characterized in that: The human adenovirus type 4 is RI67 adenovirus.

9. A method for packaging recombinant human adenovirus type 4 using the single plasmid vector according to any one of claims 1 to 8, characterized in that: The method comprises the following steps: (1) Inserting the target gene into the single plasmid vector described in any one of claims 1 to 8 to construct a recombinant human adenovirus type 4 vector recombinant plasmid; (2) linearizing the human adenovirus type 4 vector recombinant plasmid obtained in step (1) using restriction endonuclease; (3) transfecting the linearized human adenovirus type 4 vector recombinant plasmid obtained in step (2) into host cells and culturing until cytopathic; (4) The cell culture medium after freezing and thawing is continuously passaged until the cells continue to have lesions; (5) Obtain a stably propagated recombinant human adenovirus type 4.

10. Use of the single plasmid vector according to any one of claims 1 to 8 in the preparation of vaccines, gene therapy drugs and / or tumor therapy drugs.

11. The use according to claim 10, characterized in that: The single plasmid vector is prepared as an intramuscular injection or nasal drops.

12. The use according to claim 11, characterized in that: The single plasmid vector is prepared as a new coronavirus S protein vaccine.

Images