Helicobacter pylori levofloxacin drug resistance gene rapid visual detection system and method

Abstract

The invention provides a helicobacter pylori levofloxacin drug resistance gene rapid visual detection system and method, and the rapid visual detection system comprises a rapid PCR amplification system and a Cas14 detection system. Wherein the rapid PCR amplification system comprises primers for amplifying helicobacter pylori in a detection sample, and the sequences of a forward primer and a reverse primer are respectively shown as SEQ ID NO.1 and SEQ ID NO.2; the Cas14 detection system comprises gRNA (guide ribonucleic acid) sequences for guiding a Cas14 compound, and the gRNA sequences are shown as SEQ ID NO. 3 to SEQ ID NO. 9. The detection system disclosed by the invention can be used for accurately identifying a mutation site of a levofloxacin drug-resistant gene (GyrA) in H.pylori and directly displaying a result through fluorescence, and shows high sensitivity and specificity in a clinical sample. The rapid identification of the H.pylori drug-resistant gene can be promoted, so that personalized treatment is helped to be realized, and the eradication success rate of H.pylori is remarkably improved.

Description

Technical Field

[0001] The invention belongs to the technical field of medical biological detection, relates to the rapid detection of Helicobacter pylori, and specifically relates to a rapid visualization detection system and a detection method for Helicobacter pylori levofloxacin resistance genes. Background Art

[0002] Helicobacter pylori (H.pylori) is a Gram-negative bacterium that infects nearly half of the world's population and is the leading cause of gastrointestinal diseases such as gastritis, peptic ulcers, and mucosa-associated lymphoid tissue (MALT) lymphoma. [1-3] Currently, empirical treatment with two antibiotics is the mainstream strategy for the treatment of H. pylori. [6] However, due to the significant variability between H. pylori strains and humans and the increase in antibiotic resistance, the eradication success rate of empirical antibiotic treatment has decreased. [9] The success rate of traditional clarithromycin-based triple therapy has dropped from 90% in the 1990s to less than 60% today.

[10] A review and meta-analysis of primary antibiotic resistance of Helicobacter pylori between 1990 and 2022, published in The Lancet Gastroenterology & Hepatology in 2023, showed that the overall resistance rate to clarithromycin in the Asia-Pacific region was 52%, and that to levofloxacin was 26%, which created a bottleneck in H. pylori eradication treatment. Improving the success rate under current high resistance conditions is the main challenge in H. pylori research.

[0003] Ideally, as an infectious disease, treatment of H. pylori infection should follow the principles of antimicrobial stewardship.

[11] This will involve obtaining antimicrobial susceptibility data through culture or molecular testing to tailor treatment to individual patients, ensuring reliable and effective treatment.

[11] However, precision treatment of H. pylori based on susceptibility testing is difficult to implement across the board for a number of reasons. Major barriers include the high cost and cumbersome procedures associated with susceptibility testing, which often requires weeks after endoscopy to obtain results.

[10] This not only consumes a lot of medical resources, but also prolongs the healing time and increases the suffering of patients.

[0004] In recent years, point-of-care testing (POCT) based on clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) proteins has shown great potential in nucleic acid detection, with greater robustness, speed, low cost, specificity and sensitivity, meeting unmet needs.

[12] In previous studies, our team developed several CRISPR-based POCT platforms that can rapidly detect acute respiratory syndrome coronavirus 2 (SARS-CoV-2), Escherichia coli, Vibrio parahaemolyticus, and Mycoplasma [13-17] . Guided by CRISPR-derived RNA (crRNA), the CRISPR / Cas complex can specifically recognize and cut the target nucleic acid and locate it by recognizing the protospacer adjacent motif (PAM). Combined with fluorescent reporters, the CRISPR / Cas complex can cut the reporter molecule and produce a detectable signal, thereby realizing POCT detection. However, the CRISPR detection system is limited by the PAM sequence, which greatly limits its scope of application. Therefore, it is crucial to construct a CRISPR system that is not restricted by the PAM sequence and has single nucleotide polymorphism (SNP) detection specificity for detecting drug-resistant bacteria. [18,19] .

[0005] In clinical practice, antibiotic susceptibility testing of H. pylori is mainly performed by disk diffusion, E-test, and agar dilution methods. [9] However, these methods are time-consuming (7-10 days), require professional operation, have poor reproducibility, and are somewhat subjective, making widespread application of personalized H. pylori treatment challenging. [9,20,21] In addition, some well-equipped hospitals use molecular detection techniques such as PCR to detect H. pylori resistance genes. Although these methods are highly sensitive and reliable, they require professional technicians and specialized laboratory equipment, and the detection of resistance genes still takes several hours.

[22] Other molecular detection technologies, such as whole genome sequencing (WGS), can provide comprehensive genotyping of H. pylori and identify new, rare, and complex resistance mechanisms. However, the high cost and long cycle of WGS limit its clinical application.

[0006] Currently, CRISPR detection tools include Cas9, Cas12, Cas13, and Cas14.

[12] Unlike other researchers who usually choose CRISPR / Cas13a, CRISPR / Cas12a or CRISPR / Cas9 technology, this paper chose CRISPR / Cas14 for the following reasons: Cas13 detects RNA, a process that may require complex pretreatment of the target RNA, making it complicated and time-consuming; Cas9 lacks trans-cutting activity and therefore cannot amplify and output signals, which limits its advantages in detection; Cas12 is the most commonly used, but its requirement for PAM limits its scope of application

[12] In contrast, Cas14 can precisely target gene sequences without the need for a PAM structure, which is more advantageous in clinical translation.

[0007] Here, the present invention develops a visual instant detection system based on Cas14 for detecting levofloxacin resistance genes in H.pylori, called high-sensitivity Cas14 visual instant detection (Cas14VIDet). Our results show that the detection system can accurately identify the mutation site of the levofloxacin resistance gene (GyrA) in H.pylori, and directly display the results by fluorescence, showing high sensitivity and specificity in clinical samples. The detection system can promote the rapid identification of H.pylori resistance genes, thereby helping to achieve personalized treatment and significantly improving the eradication success rate of H.pylori. Summary of the invention

[0008] The present invention aims to establish a visual instant detection technology for the levofloxacin resistance gene of Helicobacter pylori using rapid PCR-Cas14 technology, so as to achieve rapid identification of H. pylori resistance genes, timely guide the prescription of antimicrobial drugs, and shorten the patient's diagnosis and treatment process.

[0009] In order to achieve the above object, the specific technical solution adopted by the present invention is as follows:

[0010] In a first aspect, the present invention provides a rapid visualization detection system for levofloxacin resistance gene of Helicobacter pylori, including a rapid PCR amplification system and a Cas14 detection system. The rapid PCR amplification system includes primers for amplifying Helicobacter pylori in a test sample, and the Cas14 detection system includes gRNA for guiding the Cas14 complex.

[0011] The specific sequence of the primer combination is as follows:

[0012]

[0013] gRNAs were designed based on different mutation sites, including 7 in total. The specific sequences are as follows:

[0014]

[0015] Preferably, the rapid PCR amplification system is a 50uL system, comprising 12.5U TaKaRa Taq HS, 5uL 1×PCR buffer (including 10mM Tris-HCl pH 8.3, 50mM KCl, 1.5mM MgCl2), 4uL dNTP (each), 2uL forward primer (1μM), 2μL reverse primer (10μM) and 33.5μL sterile water.

[0016] The amplification method was as follows: hot start at 98°C for 30 seconds, followed by 40 cycles of [98°C (1s or 2s or 5s or 10s) and 55°C (2s or 3s, 5s or 10s)]. The amplified products were analyzed by melting curve analysis and electrophoresis on a 2% agarose gel at 120V for 40 minutes.

[0017] Preferably, the Cas14 detection system includes 500nM gRNA, 1μM reporter, 2μL Holmes buffer, 0.25μM Cas14, 4 units of RNase inhibitor, 7mM magnesium acetate and 20μL RNase-free sterile water, which are combined together to prepare the cutting system.

[0018] When performing mutation site cutting, the amplified H. pylori DNA product was mixed with the Cas14 detection system, and then the entire system was incubated at 37°C for 5 minutes. All reaction tubes were observed under blue fluorescence to determine the levofloxacin resistance gene in H. pylori.

[0019] In a second aspect, the present invention provides a method for rapidly detecting the levofloxacin resistance gene of Helicobacter pylori using the above-mentioned rapid visual detection system, characterized in that it comprises the following steps:

[0020] (1) Helicobacter pylori proliferation

[0021] DNA was extracted from Helicobacter pylori as template DNA, and 12.5 U TaKaRa Taq HS, 5 uL 1× PCR buffer, 4 uL dNTP, 2 μL forward primer, 2 μL reverse primer, and 33.5 μL sterile water were added into a reaction tube to form a 50 μL reaction system;

[0022] After hot start at 98°C for 30 seconds, 40 cycles of 98°C (1s or 2s or 5s or 10s) and annealing at 55°C (2s or 3s, 5s or 10s) were performed; and then the amplified products were analyzed;

[0023] Preferably, during the amplification reaction, 1× PCR buffer consists of 10 mM Tris-HCl pH 8.3, 50 mM KCl, and 1.5 mM MgCl2;

[0024] The concentration of the forward primer was 1 μM, and the concentration of the reverse primer was 10 μM.

[0025] (2) Cas14 system detection

[0026] Calculate the sample copy number, and when it is within a predetermined range (at least 10 0CFU / mL), mixed it with the Cas14 detection system, incubated at 37°C for 5 min, and observed all reaction tubes under fluorescence to determine the levofloxacin resistance gene in H. pylori.

[0027] In a third aspect, the present invention provides a Helicobacter pylori rapid amplification kit, comprising the above-mentioned primers, TaKaRa Taq HS, 1×PCR buffer (including 10mM Tris-HCl pH 8.3, 50mM KCl, 1.5mM MgCl2), dNTPs and sterile water.

[0028] Among them, the upstream primer and the downstream primer are both in powder form, and are dissolved in sterile water when used. The concentration of the forward primer is 1 μM, and the concentration of the reverse primer is 10 μM. The remaining reagents are all selected from the products in the existing rapid amplification kit.

[0029] The Helicobacter pylori rapid amplification kit can not only be combined with the Cas14 detection system of the present invention for visual detection of levofloxacin resistance genes, but can also be combined with other CRISPR detection systems to detect resistance genes of other antibiotics of Helicobacter pylori.

[0030] The beneficial protection and effects of the present invention are as follows:

[0031] In terms of detection efficiency, the present invention first performs a rapid PCR amplification system and then performs Cas14 system detection. The detection time of the rapid PCR amplification system does not exceed 25 minutes, amplification 5 minutes plus product detection 20 minutes, and the detection time of the Cas14 system is about 5 minutes, plus the early Helicobacter pylori isolation and culture 0.5 to 2 hours, tissue DNA extraction and operation preparation time, and the whole process can be completed within 3 hours. Compared with the traditional detection methods currently used in clinical practice, which take several hours or even days to complete the detection, the present invention greatly shortens the detection time, can timely guide the prescription of antibacterial drugs, help guide the clinic to take appropriate treatment plans in time, reduce the patient's diagnosis and treatment process, and solve the current problem that patients need to spend a lot of time waiting for test results.

[0032] In terms of specificity, the detection system of the present invention can only detect Helicobacter pylori, and does not detect common digestive system pathogens, such as Vibrio parahaemolyticus, Salmonella, Klebsiella pneumoniae, Escherichia coli, etc.

[0033] In terms of sensitivity, the 0All samples within the CFU / mL range can be detected, with excellent sensitivity.

[0034] Therefore, the detection system of the present invention can accurately identify the mutation site of the levofloxacin resistance gene (GyrA) in H.pylori, and directly display the results by fluorescence, showing high sensitivity and specificity in clinical samples. It can promote the rapid identification of H.pylori resistance genes, thereby helping to achieve personalized treatment and significantly improve the success rate of H.pylori eradication. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A schematic diagram of the CRISPR / Cas14 detection system is shown;

[0036] Figure 2 A schematic diagram of actual clinical operation is shown;

[0037] Figure 3 The gRNA length screening process is shown, where A, single base specificity experimental process; B~G, 19-nt gRNA~24-nt gRNA detection results;

[0038] Figure 4 To show that Cas14VIDet can generate fluorescence within 5 minutes, it can be identified by naked eyes, where A, comparison of fluorescence brightness values ​​without incubation time; B, comparison of fluorescence intensity at different incubation times;

[0039] Figure 5 The results show that the constructed Cas14VIDet detection system has good specificity; in the left figure, the system of the present invention can only amplify Helicobacter pylori and only produce fluorescence reaction to the levofloxacin resistance gene of Helicobacter pylori, and the system cannot amplify other rod-shaped bacteria; in the right figure, the system can amplify non-levofloxacin-resistant strains of Helicobacter pylori but cannot produce fluorescence;

[0040] Figure 6 It shows that the constructed Cas14VIDet detection system has good sensitivity; A, comparison of fluorescence brightness values ​​of different plasmid standard concentrations; B, comparison of fluorescence intensity values ​​of different plasmid standard concentrations;

[0041] Figure 7 Results of testing of clinical samples are shown. DETAILED DESCRIPTION

[0042] The implementation of the present invention is described in detail below in conjunction with the embodiments of the present invention. The following embodiments are implemented on the premise of the technical solution of the present invention, and provide detailed implementation methods and specific operating processes, but the protection scope of the present invention is not limited to the following embodiments.

[0043] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0044] 1. Construction of the testing system

[0045] Figure 1 The process diagram of the CRISPR / Cas14 detection system is shown. After DNA is extracted, rapid PCR amplification is performed, and then the amplified product is mixed with the Cas14 detection system. Under the guidance of the guide RNA, the CRISPR / Cas14 complex can specifically recognize and cut the target nucleic acid. Combined with the fluorescent reporter, the CRISPR / Cas complex can cut the reporter molecule and generate a detectable signal, thereby realizing POCT detection.

[0046] Figure 2 The schematic diagram shows the process of actual clinical detection operation. After culturing Helicobacter pylori, it is separated and suspended in buffer, and then the bacterial DNA is extracted by thermal lysis method, mixed with Cas14 detection system after rapid PCR amplification, and the drug resistance gene sequence is detected by fluorescence method to obtain a test report.

[0047] It can be seen that the key to realizing the detection of the present invention lies in the establishment of a rapid PCR amplification system, the construction of guide RNA (gRNA) at different mutation sites, and the construction of a Cas14 detection system. The following is a detailed description:

[0048] 1. Design and synthesis of gRNA

[0049] gRNA was designed using SnapGene software version 7.2 (https: / / www.snapgene.com / ). TM T7 High Yield RNA Synthesis Kit transcribed gRNA in vitro. Briefly, the reaction mixture (30 μL) contained 5 μL DNA template, 10 μL NTP mixture, 2 μL T7 RNA polymerase, and 13 μL nuclease-free water. The reaction was incubated at 37 ° C for 24 hours. Subsequently, 20 units of RNase inhibitor, 5 μL DNase I, 5 μL DNase I buffer, and 5 μL nuclease-free water were added to a final reaction volume of 50 μL, and the mixture was incubated at 37 ° C for 1 hour. The gRNA was then purified using the HiPure RNA Pure Micro kit according to the manufacturer's instructions.

[0050] 2. gRNA length optimization

[0051] See also Figure 3, replace the bases agcgcatcataaaccgcgttatcg (SEQ ID NO.10) in the following sequence one by one (for example, W1, replace the first a with t, W2, replace g with c, and the rest remain unchanged), and obtain 24 variant sequences, which were added as templates into the constructed Cas14 system (500nM gRNA, 1μM reporter, 2μL Holmes buffer, 0.25μM Cas14, 4unit RNase inhibitor, 7mM Magnesium Acetate, and RNase-freesterile water up to 20μL.), react at 37°C for 30min, record the fluorescence value, and take pictures under blue light.

[0052] Based on the last 24 bases of the following wild-type gRNA (Wildtype gRNA, SEQ ID NO.11), the following 19-nt to 24-nt gRNAs were designed respectively, and the above-mentioned Cas14 system was used to detect the above-mentioned 24 variant sequences in sequence and at the same time. The results showed that the gRNA with a base length of 24 has the characteristics of fast responsiveness, high brightness, and good single-base specificity. Therefore, a gRNA with a base length of 24 was designed for the drug-resistant sites infected with Helicobacter pylori for subsequent experiments.

[0053] Wild-type gRNA (SEQ ID NO.11):

[0054] CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAU

[0055] UAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUG

[0056] CUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCCUCCAAUUCU

[0057] GCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAACG

[0058] CGGUUUAUGAUGCGCUAGUG

[0059] 19-nt gRNA (SEQ ID NO.12): AACGCGGUUUAUGAUGCGC

[0060] 20-nt gRNA (SEQ ID NO.13):AACGCGGUUUAUGAUGCGCU

[0061] 21-nt gRNA (SEQ ID NO.14): AACGCGGUUUAUGAUGCGCUA

[0062] 22-nt gRNA (SEQ ID NO.15): AACGCGGUUUAUGAUGCGCUAG

[0063] 23-nt gRNA (SEQ ID NO.16): AACGCGGUUUAUGAUGCGCUAGU

[0064] 24-nt gRNA (SEQ ID NO.17): AACGCGGUUUAUGAUGCGCUAGUG

[0065] The gRNA for detection of the present invention is designed based on the mutation site of the drug-resistant gene, and contains 7 in total. The specific sequences are shown in Table 1 below:

[0066] Table 1 Summary of gRNA sequences

[0067]

[0068] 3. Establishment of rapid PCR amplification system

[0069] Primers for PCR amplification were designed using SnapGene software. The rapid PCR amplification system (50uL) contained 12.5UTaKaRa Taq HS, 5uL 1×PCR buffer (including 10mM Tris-HCl pH 8.3, 50mM KCl, 1.5mMMgCl2), 4uL dNTPs (each), 2uL forward primer (1μM), 2μL reverse primer (10μM) and 33.5μL sterile water. The rapid polymerase chain reaction was hot-started at 98°C for 30 seconds, followed by 40 cycles [98°C (1s or 2s or 5s or 10s) and 55°C (2s or 3s, 5s or 10s)]. The amplified products were analyzed using a melting curve and electrophoresed on a 2% agarose gel at 120V for 40 minutes.

[0070] Wherein, the primer sequences are shown in Table 2:

[0071] Table 2 Summary of primer sequences

[0072]

[0073] 4. Construction of Cas14 detection system

[0074] Prepare the cleavage system by combining 500nM gRNA, 1μM reporter, 2μL Holmes buffer, 0.25μM Cas14, 4 units RNase inhibitor, 7mM magnesium acetate, and up to 20μL RNase-free sterile water. Incubate the entire system at 37°C for 5 minutes. Finally, observe all reaction tubes under blue light.

[0075] 2. Performance Verification

[0076] 1. Fluorescence time detection

[0077] The above reaction system was used to detect the drug-resistant gene of Helicobacter pylori resistant to levofloxacin. The rapid PCR product was mixed with the Cas14 detection system and incubated for 1 min, 2 min, 3 min, 4 min, 5 min, and 10 min, respectively, and then fluorescence detection was performed. The results are as follows Figure 4 As shown, the constructed Cas14VIDet can produce fluorescence within 5 minutes and can be identified by the naked eye.

[0078] 2. Specificity detection

[0079] For common digestive system pathogens, Vibrio parahaemolyticus, Salmonella, Klebsiella pneumoniae, Escherichia coli and Helicobacter pylori were tested simultaneously using the above detection system, and non-levofloxacin-resistant strains of Helicobacter pylori were also included in the test. Figure 5 As shown, the detection system of the present invention only amplifies Helicobacter pylori and produces a fluorescent response only to the levofloxacin resistance gene of Helicobacter pylori. The system cannot amplify other rod-shaped bacteria ( Figure 5 A); For non-levofloxacin-resistant strains of Helicobacter pylori, the system can amplify but cannot produce fluorescence ( Figure 5 B).

[0080] 3. Sensitivity detection

[0081] 3.1 Construction of plasmid standards

[0082] Use primers and Taq enzyme to perform PCR (50 μL system) to amplify the target gene of Helicobacter pylori; then perform agarose gel electrophoresis, and preliminarily estimate the target band according to the size indicated by the DNA marker; finally, cut the gel strip and recover the gel according to the instructions, and determine the concentration and purity by ultra-micro UV spectrophotometry for standby use. The amplified product is connected to the pEASY-T1 cloning vector, transformed into Escherichia coli competent cells DH5α, and evenly spread on solid LB medium containing 100 mg / L kanamycin, and cultured at 37°C for 16-18h. Screen out the positive single clone and add 5mL liquid culture medium containing kanamycin, culture at 37°C, take 2mL of bacterial solution to extract plasmid, and sequence to confirm the positive transformant (the nucleic acid sequence is shown in SEQ ID NO.18 below). The remaining bacterial solution is glycerol-preserved and stored at -80°C for standby use.

[0083] Plasmid insert sequence (SEQ ID NO.18):

[0084] TAATACGACTCACTATAGGGCTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAATTCATTTTTCCTCTCCAATTCTGCACAAGAAAGTTGCAGAACCCGAATAGACGAATG

[0085] 3.2 Sensitivity test

[0086] Construct a standard plasmid containing the target gene and calculate the copy number. Perform multiple dilutions on the plasmid standard and set the dilution ratio to 10. 6 -10 0 Several gradients were used and the above system was used for detection. The test results are shown in Figure 6 As shown: The detectable concentration is at least 10 0 CFU / mL of bacteria.

[0087] 4. Clinical sample testing

[0088] The detection system of the present invention was used to detect 10 clinical Helicobacter pylori samples with known mutation sequences. The results showed that the detection results of the 10 clinical samples were consistent with the sequencing results, and the detection sensitivity and specificity reached 100% ( Figure 7 ).

[0089] The references cited in the background technology of the present invention are as follows:

[0090] 1.Zhou XZ,Lyu NH,Zhu HY,Cai QC,Kong XY,Xie P,Zhou LY,Ding SZ,Li ZS,DuYQ:Large-scale,national,family-based epidemiological study on Helicobacterpylori infection in China:the time to change practice for related diseaseprevention.Gut 2023,72(5):855-869.

[0091] 2.Ding SZ,Du YQ,Lu H,Wang WH,Cheng H,Chen SY,Chen MH,Chen WC,Chen Y,Fang JY et al:Chinese Consensus Report on Family-Based Helicobacter pyloriInfection Control and Management(2021 Edition).Gut 2022,71(2):238-253.

[0092] 3.Lai Y,Wei W,Du Y,Gao J,Li Z:Biomaterials for Helicobacter pyloritherapy:therapeutic potential and future perspectives.Gut Microbes 2022,14(1):2120747.

[0093] 4.Du Y,Zhu H,Liu J,Li J,Chang X,Zhou L,Chen M,Lu N,Li Z:Consensus oneradication of Helicobacter pylori and prevention and control of gastriccancer in China(2019,Shanghai).J Gastroenterol Hepatol 2020,35(4):624-629.

[0094] 5.Sugano K,Tack J,Kuipers EJ,Graham DY,El-Omar EM,Miura S,Haruma K,Asaka M,Uemura N,Malfertheiner P:Kyoto global consensus report onHelicobacter pylori gastritis.Gut 2015,64(9):1353-1367.

[0095] 6.Malfertheiner P,Megraud F,Rokkas T,Gisbert JP,Liou JM,Schulz C,Gasbarrini A,Hunt RH,Leja M,O'Morain C et al:Management ofHelicobacter pylori infection:the Maastricht VI / Florence consensus report.Gut 2022.

[0096] 7.Liou JM,Malfertheiner P,Lee YC,Sheu BS,Sugano K,Cheng HC,Yeoh KG,Hsu PI,Goh KL,Mahachai V et al:Screening and eradication ofHelicobacterpylori for gastric cancer prevention:the Taipei global consensus.Gut Rev. 2020.69(12):2093–2

[0097] 8.Graham DY,Hernaez R,Rokkas T:Crossroads for meta-analysis and network meta-analysis of H.pylori therapy.Gut 2022,71(3):643-650.

[0098] 9.Tshibangu-Kabamba E,Yamaoka Y:Helicobacter pylori infection andantibiotic resistance-from biology to clinical implications.Nat RevGastroenterol Hepatol 2021,18(9):613-629.

[0099] 10.Graham DY:Best Practices for Helicobacter pyloriManagement.Gastroenterol Hepatol(N Y)2024,20(3):159-168.

[0100] 11.Graham DY,Liou JM:Primer for Development of Guidelines forHelicobacter pylori Therapy Using Antimicrobial Stewardship.ClinGastroenterol Hepatol 2022,20(5):973-983.e971.

[0101] 12.Wang T,Wang Z,Bai L,Zhang X,Feng J,Qian C,Wang Y,Wang R:Next-generation CRISPR-based diagnostic tools for human diseases.TrAC Trends inAnalytical Chemistry 2023,168:117328.

[0102] 13.Wang R,Qian C,Pang Y,Li M,Yang Y,Ma H,Zhao M,Qian F,Yu H,Liu Z etal:opvCRISPR:One-pot visual RT-LAMP-CRISPR platform for SARS-cov-2detection.Biosens Bioelectron 2021,172:112766.

[0103] 14.Wang R,Chen R,Qian C,Pang Y,Wu J,Li F:Ultrafast visual nucleicacid detection with CRISPR / Cas12a and rapid PCR in single capillary.Sensorsand Actuators B:Chemical 2021,326:128618.

[0104] 15.Wang R,Li Y,Pang Y,Zhang F,Li F,Luo S,Qian C:VIR-CRISPR:Visual in-one-tube ultrafast RT-PCR and CRISPR method for instant SARS-CoV-2detection.Anal Chim Acta 2022,1212:339937.

[0105] 16.Wang R,Xiao X,Chen Y,Wu J,Qian W,Wang L,Liu Y,Ji F,Wu J:Aloop-mediated,isothermal amplification-based method for visual detection of Vibrioparahaemolyticus within only 1h,from shrimp sampling to results.AnalyticalMethods 2017,9(11):1695-1701.

[0106] 17.Wang B,Wang R,Wang D,Wu J,Li J,Wang J,Liu H,Wang Y:Cas12aVDet:ACRISPR / Cas12a-Based Platform for Rapid and Visual Nucleic Acid Detection.AnalChem 2019,91(19):12156-12161.

[0107] 18.Harrington LB,Burstein D,Chen JS,Paez-Espino D,Ma E,Witte IP,Cofsky JC,Kyrpides NC,Banfield JF,Doudna JA:Programmed DNA destruction byminiature CRISPR-Cas14 enzymes.Science 2018,362(6416):839-842.

[0108] 19.Karvelis T,Bigelyte G,Young JK,Hou Z,Zedaveinyte R,Budre K,PaulrajS,Djukanovic V,Gasior S,Silanskas A et al:PAM recognition by miniatureCRISPR-Cas12f nucleases triggers programmable double-stranded DNA targetcleavage.Nucleic Acids Res 2020,48(9):5016-5023.

[0109] 20.Pohl D,Keller PM,Bordier V,Wagner K:Review of current diagnosticmethods and advances in Helicobacter pylori diagnostics in the era of nextgeneration sequencing.World J Gastroenterol 2019,25(32):4629-4660.

[0110] 21.Ng HY,Leung WK,Cheung KS:Antibiotic Resistance,SusceptibilityTesting and Stewardship in Helicobacter pylori Infection.Int J Mol Sci 2023,24(14).

[0111] 22. Jearth V, Rath MM, Chatterjee A, Kale A, Panigrahi MK: Drug-ResistantHelicobacter pylori: Diagnosis and Evidence-Based Approach. Diagnostics (Basel) 2023, 13(18).

[0112] The embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. A rapid visual detection system for Helicobacter pylori levofloxacin resistance gene, characterized in that: Including rapid PCR amplification system and Cas14 detection system, Among them, the rapid PCR amplification system includes primers for amplifying Helicobacter pylori in the test sample, and the sequences of the forward primer and the reverse primer are shown in SEQ ID NO.1 and 2, respectively; the Cas14 detection system includes a gRNA sequence for guiding the Cas14 complex as shown in SEQ ID NO.3 to SEQ ID NO.

9.

2. The Helicobacter pylori levofloxacin resistance gene rapid visualization detection system according to claim 1, characterized in that: In the rapid PCR amplification system, the concentration of the forward primer is 1 μM, and the concentration of the reverse primer is 10 μM.

3. The Helicobacter pylori levofloxacin resistance gene rapid visualization detection system according to claim 2, characterized in that: The rapid PCR amplification system also includes 12.5U TaKaRa Taq HS, 1×PCR buffer, dNTP and sterile water. The 1×PCR buffer consists of 10 mM Tris-HCl, pH 8.3, 50 mM KCl, and 1.5 mM MgCl 2 .

4. The Helicobacter pylori levofloxacin resistance gene rapid visualization detection system according to claim 1, characterized in that: The amplification method of the rapid PCR amplification system is as follows: Hot start: hot start at 98℃ for 30 seconds; Extension: 98°C, 1s, 2s, 5s or 10s, 40 cycles; Annealing: 55°C, 2s, 3s, 5s or 10s, and analyze the amplified products using melting curve.

5. The Helicobacter pylori levofloxacin resistance gene rapid visualization detection system according to claim 1, characterized in that: The Cas14 detection system includes 500nM gRNA, 1μM reporter, 2μL Holmes buffer, 0.25μM Cas14, 4 units of RNase inhibitor, 7mM magnesium acetate and 20μL RNase-free sterile water.

6. A method for rapid detection of levofloxacin resistance gene in Helicobacter pylori, characterized in that: The method is carried out using the rapid visual detection system according to any one of claims 1 to 5, characterized in that it comprises the following steps: (1) Helicobacter pylori proliferation DNA was extracted from Helicobacter pylori as template DNA, 12.5U TaKaRa Taq HS, 5uL 1×PCR buffer, 4uL dNTP, 2μL forward primer, 2μL reverse primer and 33.5μL sterile water were added into a reaction tube to form a 50μL reaction system; after hot starting at 98°C for 30 seconds, 40 cycles were performed at 98°C for extension, with the time of each cycle selected from 1s, 2s, 5s or 10s, and then annealed at 55°C and the amplified products were analyzed; (2) Detection of Cas14 system Calculate the sample copy number, and when it is within a predetermined range (at least 10 0 CFU / mL), mixed it with the Cas14 detection system, incubated at 37°C for 5 min, and observed all reaction tubes under fluorescence to determine the levofloxacin resistance gene in H. pylori.

7. A Helicobacter pylori rapid amplification kit, characterized in that: Contains primers for amplifying Helicobacter pylori in a test sample, and the sequences of the forward primer and the reverse primer are shown in SEQ ID NO. 1 and 2, respectively.

8. The Helicobacter pylori rapid amplification kit according to claim 7, characterized in that: Also included is 12.5 U TaKaRa Taq HS, 1× PCR buffer, dNTPs, and sterile water.

Images