Application of diphenyl iodized chloride in preparation of products for treating mitochondrial dysfunction related diseases

Abstract

The invention discloses application of diphenyl iodised chloride in preparation of products for treating diseases related to mitochondrial dysfunction. Experiments prove that the diphenyl iodized chloride can enhance PINK1-Parkin mediated mitochondrial autophagy and inhibit generation of active oxygen so as to be used for treating mitochondrial dysfunction related diseases, including neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis; and motor injury related diseases, such as spinal muscular atrophy.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to the application of a drug molecule, diphenyl iodonium chloride, in the preparation of a product for treating diseases related to mitochondrial dysfunction. Background Art

[0002] Mitochondria are energy factories in cells. They exist in every cell in the human body except red blood cells. The main function of mitochondria is to provide the energy needed by cells - nucleotide triphosphate (ATP). Mitochondrial diseases are caused by abnormal mitochondrial function, including neurodegenerative diseases (such as Alzheimer's disease, Parkinson's syndrome, amyotrophic lateral sclerosis); motor muscle damage diseases (such as Huntington's disease); as well as obesity, diabetes and tumors. Studies have shown that there are many factors that lead to mitochondrial dysfunction, including but not limited to oxidative metabolic damage, reduced adenosine triphosphate synthesis, calcium ion transport imbalance, mitochondrial genetic mutations, abnormal mtDNA release, mitochondrial respiratory chain deficiency, etc. Therefore, maintaining mitochondrial homeostasis, regulating mitochondrial function, and ensuring the integrity of the mitochondrial network are of great biological significance for the treatment of diseases caused by mitochondrial abnormalities, and can also provide valuable reference for clinical diagnosis and treatment.

[0003] Existing studies have shown that mitochondrial autophagy is the main mechanism for maintaining mitochondrial homeostasis and regulating mitochondrial quality. This process is relatively conservative in species such as yeast, plants, and animals. It mainly removes damaged mitochondria selectively through autophagy, and then decomposes them through lysosomes to reduce the accumulation of reactive oxygen species in cells, reduce the rate of cell carcinogenesis, and avoid cell apoptosis and necrosis. It can be seen that mitochondrial autophagy is a common and necessary mechanism to protect mitochondria and highly unsaturated mitochondrial membranes. Therefore, exploring the molecular mechanism of mitochondrial autophagy is of great significance for the targeted removal of damaged mitochondria.

[0004] Mitochondrial autophagy in yeast is mainly mediated by ATG32, which is a receptor protein unique to yeast. It initiates mitophagy through phosphorylation to remove damaged or redundant mitochondria. At present, there are few studies on mitophagy in plants, and the regulatory factors and molecular mechanisms involved in this process need to be further explored. There is a relatively clear regulatory network for the regulation of mitophagy in mammalian cells, among which the PINK1-Parkin-mediated pathway is the classic pathway of mitophagy. PINK1 is a protein kinase. In normal mitochondria, the protein maintains a low protein level and is localized in the cytoplasm. When cells are damaged by stress, the protein is stabilized on the outer membrane of mitochondria, and the kinase activity of the protein is activated by self-phosphorylation. At the same time, the cytoplasmic E3 ubiquitin ligase Parkin protein is recruited to the outer membrane of mitochondria. The latter ubiquitinates the outer membrane proteins of mitochondria, and then recruits autophagy receptors to mediate the removal of damaged mitochondria to lysosomes. So far, agonists of the PINK1-Parkin pathway have also been reported, such as carbonyl cyanide m-chlorophenylhydrazone (CCCP). However, the currently reported drug molecules still have certain disadvantages, such as the inability to cross the blood-brain barrier independently and high cytotoxicity, which limit the development and use of clinical drugs. Therefore, this field urgently needs to develop new clinical drugs for PINK1-Parkin-mediated mitochondrial autophagy. Summary of the invention

[0005] One object of the present invention is to provide a new pharmaceutical use of diphenyleneiodonium chloride (DPI).

[0006] The application of diphenyl iodonium chloride provided by the present invention is any one of the following (a1)-(a6):

[0007] (a1) Use in the preparation of products for preventing and / or treating diseases related to mitochondrial dysfunction;

[0008] (a2) Application in the preparation of a mitochondrial autophagy enhancer;

[0009] (a3) Use in the preparation of products that specifically enhance mitochondrial autophagy;

[0010] (a4) Use in the preparation of a product that specifically stabilizes PINK1 protein in the outer membrane of mitochondria;

[0011] (a5) Application in the preparation of a product for specifically regulating Parkin protein aggregation in the mitochondrial outer membrane;

[0012] (a6) Use in the preparation of products that specifically inhibit the production of reactive oxygen species.

[0013] The application of diphenyl iodonium chloride provided by the present invention is also any one of the following (b1)-(b6):

[0014] (b1) Use in the prevention and / or treatment of diseases related to mitochondrial dysfunction;

[0015] (b2) Application in promoting mitophagy;

[0016] (b3) Application in specific enhancement of mitophagy;

[0017] (b4) application in specific stabilization of PINK1 protein in the outer membrane of mitochondria;

[0018] (b5) Application in the specific regulation of Parkin protein aggregation in the mitochondrial outer membrane;

[0019] (b6) Application in specific inhibition of reactive oxygen species production.

[0020] For example, the above-mentioned product may be a medicine or a pharmaceutical preparation.

[0021] Furthermore, the prevention and / or treatment of diseases related to mitochondrial dysfunction in the present invention is to treat diseases related to mitochondrial dysfunction through the PINK1-Parkin pathway.

[0022] Furthermore, diphenyl iodonium chloride induced mitochondria to enter lysosomes and undergo mitophagy by enhancing the PINK1-Parkin pathway.

[0023] Furthermore, the diseases associated with mitochondrial dysfunction include neurodegenerative diseases and motor muscle damage diseases.

[0024] Optionally, the neurodegenerative disease is Parkinson's syndrome.

[0025] Furthermore, the Parkinson's syndrome of the present invention refers to a disease model of dopaminergic neuron damage induced by MPTP.

[0026] Furthermore, diphenyl iodonium chloride can effectively improve the damage of dopaminergic neurons induced by MPTP.

[0027] Furthermore, diphenyl iodonium chloride can effectively alleviate the motor function damage caused by MPTP.

[0028] Furthermore, the neuroprotective effect of diphenyliodonium chloride is achieved by regulating PINK1 protein.

[0029] Furthermore, the effective concentration of diphenyl iodonium chloride salt for enhancing mitophagy was 5-50 μM;

[0030] Furthermore, the effective concentration of diphenyl iodonium chloride salt used to stabilize PINK1 protein on the outer membrane of mitochondria is 5-50 μM;

[0031] Furthermore, the effective concentration of diphenyl iodonium chloride salt used to specifically regulate Parkin protein aggregation in the mitochondrial outer membrane is 5-50 μM;

[0032] Furthermore, the effective concentration of diphenyl iodonium chloride salt for inhibiting the generation of active oxygen is 5-50 μM.

[0033] The present invention also provides a method for preventing and / or treating diseases related to mitochondrial dysfunction, comprising the following steps: administering a therapeutically effective amount of diphenyl iodonium chloride to a subject to prevent and / or treat diseases related to mitochondrial dysfunction.

[0034] The present invention also provides a method for enhancing mitochondrial autophagy, comprising the following steps: administering an effective amount of diphenyl iodonium chloride salt to a subject.

[0035] Compared with the existing technology, the present invention has the following beneficial effects:

[0036] 1) The present invention establishes a high-throughput screening model in which PINK1 protein is accumulated on the outer membrane of mitochondria during mitochondrial autophagy, takes the up-regulated expression of PINK1 protein at the transcriptional level as an indicator, constructs a stable cell line by fusing PINK1 protein with Nano-Lucia, and obtains diphenyl iodonium chloride as an inducer of up-regulated PINK1 protein expression through high-throughput screening. Diphenyl iodonium chloride is a NADPH inhibitor.

[0037] 2) The present invention establishes a high-throughput screening model for Parkin protein aggregation and phosphorylation modification during mitochondrial autophagy, and uses the characteristics of Parkin protein at the cellular and molecular levels as screening indicators, and screens out diphenyl iodonium chloride salt to induce Parkin protein aggregation, and regulates the post-translational modification of Parkin protein in a PINK1-dependent manner, mainly phosphorylation and phosphopubiquitination modification.

[0038] 3) The product of the present invention does not affect the mitochondrial membrane potential at all, which is completely different from other reported inducers of mitochondrial autophagy and is a special feature of the product of the present invention.

[0039] 4) The product of the present invention significantly inhibits the generation of active oxygen, which is one of the advantages of the product of the present invention itself

[0040] 5) The product of the present invention can cross the blood-brain barrier autonomously, which is one of the advantages of the product of the present invention itself, and also lays the foundation for the subsequent clinical drug research and development of the product of the present invention.

[0041] 6) The product of the present invention has a significant therapeutic effect on Parkinson's syndrome. Judging from the effect on the MPTP mouse model, diphenyl iodonium chloride has a significant therapeutic effect on Parkinson's syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The drawings described herein are used to provide further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0043] Figure 1 :It is a high-throughput screening system, the purpose of which is to screen activators of the PINK1-Parkin pathway. Figure A is a high-throughput screening using the up-regulated expression of PINK1 protein transcription level as an indicator, and the dominant target molecule DPI is selected from it; Figure B is a high-throughput screening using the recruitment of Parkin protein to mitochondria and aggregation as an indicator, and the dominant target molecule DPI is selected from it.

[0044] Figure 2 : It proves that the screened drug target molecule DPI regulates the mitochondrial localization, protein accumulation and post-translational modification of Parkin protein; Figures AC represent DPI-regulated post-translational modification of Parkin protein, phosphorylation modification of ubiquitin protein Ubiquitin and accumulation of PINK1 protein in the mitochondrial outer membrane in different types of cells; Figure D represents the cytological morphological characterization and statistical results of DPI recruiting Parkin protein to aggregate in the mitochondrial outer membrane.

[0045] Figure 3 :It is proved that the screened drug target molecule DPI regulates the mitochondrial localization, protein accumulation and post-translational modification of Parkin protein in a PINK1 protein-dependent manner. Figure A shows the currently reported activators of the PINK1-Parkin pathway, including CCCP, Sorafenib, Urolithin A, and Rafoxanide as positive controls, highlighting that the target molecule DPI has the same regulatory effect as the reported PINK1-Parkin agonists; Figure BC represents the cytological morphological characterization and statistical result characterization of DPI recruiting Parkin protein to aggregate in the mitochondrial outer membrane, indicating that the knockout of PINK1 protein abolished the DPI-induced Parkin protein aggregation in the mitochondrial outer membrane.

[0046] Figure 4 :Demonstrated that DPI enhances PINK1-Parkin-mediated mitophagy. AB represents DPI-enhanced Parkin-mediated mitophagy; CE represents that knockout of PINK1 protein in different cell types abolished the enhancement of DPI-induced mitophagy.

[0047] Figure 5 :Flow cytometry showed that DPI did not change mitochondrial membrane potential.

[0048] Figure 6 : Characterization of DPI significantly inhibiting the production of reactive oxygen species through H2DCFDA probe.

[0049] Figure 7 : In vivo mouse model confirmed that DPI can effectively improve the phenotype of MPTP-mediated dopaminergic neuron injury defects. DETAILED DESCRIPTION

[0050] The present invention will be further described below in conjunction with the accompanying drawings and embodiments in order to deepen the understanding and recognition of the present invention, but the embodiments of the present invention are not limited thereto.

[0051] Unless otherwise specified, the equipment and reagents used in the present invention are conventional equipment and reagents in the field of the present technology, and are all purchased from conventional biological reagent suppliers. The experimental methods involved in the present invention, unless otherwise specified, are all conventional experimental methods, and can be completed according to the conventional experimental method steps given in the literature or the instructions given by the manufacturer. The quantitative statistical experiments in the following examples are all set up for three biological replicates, and the results are the average values.

[0052] The HeLa, L929, BV2 and SHSY5Y cells involved in the embodiments of the present invention are all commonly used cell types in the technical field and can be purchased from ATCC.

[0053] The mice involved in the embodiments of the present invention are all WT C57BL / 6, a mouse type commonly used in the technical field.

[0054] The products CCCP, Sorafenib, Urolithin A (hereinafter referred to as UA), and Rafoxanide (hereinafter referred to as Raf) involved in the embodiments of the present invention can all be purchased from commercial channels.

[0055] The product DPI involved in the present invention has a chemical structure as shown in Formula I, and its synthesis was independently completed by this laboratory.

[0056]

[0057] The synthesis method of compound DPI is as follows:

[0058]

[0059] (1) Synthesis of Compound 1

[0060] Take a 25mL round-bottom flask, dissolve 2-iodobiphenyl (300mg, 1.07mmol, 1eq) in anhydrous dichloromethane (10mL), then add m-chloroperbenzoic acid (277.1mg, 1.61mmol, 1.5eq) and trifluoromethanesulfonic acid (0.28mL, 3.21mmol, 3eq) in turn, add a magnetic bar, stir at room temperature for 1 hour, remove dichloromethane under reduced pressure, add 15mL of anhydrous ether to resuspend the residual mixture, stir for 20 minutes, filter, rinse the filter cake three times with a small amount of anhydrous ether, and dry to obtain 343mg of compound 1 with a yield of 75%.

[0061] 1H NMR (400MHz, DMSO-d6) δ8.90(dt,J=25.1,7.4Hz,2H),8.72–8.57(m,2H),8.46–8.30(m,2H),8.23(dt,J=24.1,8.3Hz,2H).

[0062] 19F NMR(376MHz,DMSO-d6)δ-79.51–-79.74(m).

[0063] (2) Synthesis of compound 2 (DPI)

[0064] Take a 50 mL round-bottom flask, dissolve diphenylene iodonium trifluoromethanesulfonate (343 mg, 0.8 mmol, 1 eq) in 20 mL of methanol, add 10 mL of an aqueous solution containing sodium chloride (100 mg, 1.6 mmol, 2 eq), stir at room temperature for 20 min, filter, rinse the filter cake several times with pre-cooled water, and dry to obtain 230 mg of compound 2 (DPI) with a yield of 91%.

[0065] 1H NMR (400MHz, DMSO-d6) δ8.56(dd,J=8.2,1.2Hz,2H),8.44(dd,J=7.9,1.4Hz,2H),7.86–7.77(m,2H),7.67(ddd,J=8.5,7.2,1.4Hz,2H).

[0066] The above structural confirmation data showed that the prepared compound was indeed the target compound DPI.

[0067] Example 1: High-throughput screening process to obtain activators that regulate the PINK1-Parkin pathway

[0068] Screening workflow Figure 1 The specific steps are as follows:

[0069] Screening strategy 1: Construction of HeLa-PINK1-Nano cells. The specific steps are as follows: First, obtain PINK1 and Nano amplification products through polymerase chain reaction, and then obtain PINK1 and Nano gel recovery products through gel recovery kit (Tiangen), and then use homologous recombination kit (Biyuntian) to connect it to the pCDH-puro vector backbone (Addgene), and successfully construct pCDH-PINK1-Nano-puro plasmid through sequencing (BGI). The successfully constructed plasmid and retroviral packaging plasmids psPAX2 and pMD2.G were co-transfected into 293T cells. After 48 hours of transfection, the viral supernatant was collected and infected with HeLa (ATCC CCL-2) cells. After 48 hours of infection, the antibiotic puromycin (Biyuntian) was added for screening, and finally HeLa-PINK1-Nano cells were successfully obtained. HeLa-PINK1-Nano cells were cultured at 8x10 3 The cells were resuspended in DMEM medium containing 10% serum FBS and 1% penicillin-streptomycin mixture at a density of 10 cells / mL, and evenly plated into 384-well plates with a volume of 100 μL per well using a dispenser, and placed in an incubator at 37°C and 5% CO2 for overnight culture. The drug transfer device of the pharmaceutical technology platform was used to spray about 20,000 small molecules in the target library at a final concentration of 10 μM into the corresponding 384-well plate with cells. The 384-well plate was then centrifuged and placed in an incubator at 37°C and 5% CO2 for overnight culture. After about 18 hours, the plate was taken out, the liquid in the plate was gently shaken off, and then 1xPBS was added to wash twice. 50 μL of cell lysis solution (25 mM Tris-HCL, 4 mM EDTA pH7.8, 1% Triton, 10% glycerol, 2 mM DTT) was added to each well. After lysis for 2-3 minutes, 20 μL of cell lysate was aspirated and transferred to a new 384-well plate. At the same time, 50 μL of luciferase detection solution (50 mM HEPES pH 7.0, 50 mM NaCl, 0.05% CHAPS, 10 mM EDTA, 1 μM Coelenterazine), using Cytation TM The luminescence value was read by Cell Imaging Reader (BioTek's). Finally, the luminescence signals of different treatment groups were normalized with those of DMSO treatment group and the relative fold change was plotted. Figure 1 As shown in A. As can be seen from the figure, the screened drug molecule DPI can significantly increase the expression of PINK1 protein at the mRNA level.

[0070] Screening strategy 2: Construction of HeLa-Parkin cells. The specific steps are as follows: First, obtain Venus and Parkin amplification products through polymerase chain reaction, and then obtain Venus and Parkin gel recovery products through gel recovery kit (Tiangen), and then use homologous recombination kit (Biyuntian) to connect them to the pCDH-Bsd vector backbone (Addgene), and successfully construct pCDH-Venus-parkin-Bsd plasmid through sequencing (BGI). The successfully constructed plasmid was successfully introduced into HeLa (ATCC CCL-2) cells using the retroviral packaging system, and HeLa-Venus-Parkin-Bsd (hereinafter referred to as HeLa-Parkin) cells were successfully obtained through antibiotic blasticidin (Biyuntian). The constructed HeLa-Parkin cells were cultured at 8x10 3 The cells / mL density was resuspended in DMEM medium containing 10% serum FBS and 1% penicillin-streptomycin mixture, and the cells were evenly spread into 384-well plates with a volume of 100 μL per well using a spray gun, and placed in an incubator at 37°C and 5% CO2 for overnight culture. The drug transfer device of the pharmaceutical technology platform was used to spray about 20,000 small molecules in the target library into the corresponding 384-well plates with cells at a final concentration of 10 μM, and then the 384-well plates were centrifuged and placed in an incubator at 37°C and 5% CO2 for 2 hours. The GFP fluorescence channel was photographed using a high-content confocal microscope, and 6 shooting points were set for each well. The fluorescent images taken were then summarized and sorted, and the reported PINK1-Parkin pathway activators CCCP (Chloro carbonyl cyanide phenyl hydrazone) and Sorafenib, as well as the product DPI of the present invention, were screened out. The results are as follows: Figure 1 As shown in Figure B. As can be seen from the figure, the screened drug molecule DPI can regulate the aggregation of Parkin protein in mitochondria, which is consistent with the functions of CCCP and Sorafenib, the activators of the PINK1-Parkin pathway that have been reported so far.

[0071] Example 2: DPI recruits Parkin protein to aggregate in the outer membrane of mitochondria and regulates phosphorylation modification of ubiquitin protein Ubiqutin

[0072] The regulation of DPI on the PINK1-Parkin pathway was explored mainly from the following aspects: post-translational modification of Parkin protein, mainly phosphorylation and phosphopubicin modification; phosphorylation modification of ubiquitin protein; accumulation of PINK1 protein; aggregation of Parkin protein in the outer membrane of mitochondria.

[0073] The specific steps are as follows:

[0074] (1) Western blotting

[0075] by Figure 2 A is used as an example for detailed description. Venus and Parkin amplification products were obtained by polymerase chain reaction, and then Venus and Parkin gel recovery products were obtained by gel recovery kit (Tiangen), and then connected to the pCDH-Bsd vector backbone (Addgene) using homologous recombination kit (Biyuntian), and the pCDH-Venus-parkin-Bsd plasmid was successfully constructed by sequencing (BGI). The successfully constructed plasmid was successfully introduced into HeLa (ATCCCCL-2) cells using the retroviral packaging system, and HeLa-Venus-Parkin-Bsd (hereinafter referred to as HeLa-Parkin) cells were successfully obtained by screening with the antibiotic blasticidin (Biyuntian). HeLa and HeLa-Parkin cells were cultured at 1x10 5 The cells were resuspended in DMEM medium containing 10% serum FBS and 1% penicillin-streptomycin mixture at a density of 10 cells / mL, and then evenly planted in 12-well plates and placed in an incubator at 37°C and 5% CO2 for overnight culture. HeLa and HeLa-Parkin cells were then treated with different concentrations of DPI (0, 10, 20 μM), and the cells were collected 2 hours later. The cells were lysed on ice for 30 minutes using whole cell lysis buffer (20 mM Tris-HCL pH 7.4, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 0.1% SDS, 1 mM EDTA, 1 mM Na3VO4, 25 mM sodium glycerophosphate, protease inhibitors), and the cell lysate was centrifuged at 13,000 g, 4°C for 10 minutes, and boiled at 95°C for 5 minutes with SDS loading buffer to obtain total protein samples. Then, SDS-PAGE gel electrophoresis was performed according to conventional molecular biology operation steps, and commercially available antibodies, including p-Ubiqutin (CST D7C3S), Parkin (Santa cruz sc-32282), PINK1 (CST D8G3), and GAPDH (CST 14C10), were used for color imaging using chemiluminescent color development solution. Figure 2 BC, different types of cells (L929 or BV2) were treated with 10 μM CCCP and DPI respectively, and the proteins were collected after 2 hours for SDS-PAGE gel staining, and the operation steps were the same as above. Figure 2 AC. As shown in the figure, DPI can significantly increase the accumulation of PINK1 protein and enhance the phosphorylation of ubiquitin protein and Parkin protein.

[0076] (2) Immunofluorescence microscopy

[0077] HeLa-Parkin cells were cultured at 1x10 5 The cells were resuspended at a density of 10 cells / mL in DMEM medium containing a mixture of 10% serum FBS and 1% penicillin-streptomycin, and then evenly planted in a four-grid confocal dish and placed in an incubator at 37°C and 5% CO2 for overnight culture. The cells were treated with 0.1% DMSO (marked as CTR in the figure) and 10μM DPI (DPI group) for 2 hours, respectively, and then the culture medium was removed, washed twice with 1xPBS, and 10μM Mitotracker-Red and 10μM Hochast were added. After incubation at 37°C in the dark for 20 minutes, the cell culture medium was removed and 1xPBS was added for fluorescence confocal imaging. Confocal images were captured on a Zeiss LSM780 confocal microscope using a 63× (NA 1.45) objective lens. The collected confocal microscopy images were post-processed in Zen Blue 3.1 software. The experimental results are shown in the following figure. Figure 2 As shown in D. As can be seen from the figure, DPI can significantly increase the aggregation of Parkin protein on the mitochondrial outer membrane.

[0078] (3) Colocalization analysis

[0079] The confocal images captured on the Zeiss LSM780 confocal microscope were analyzed for colocalization using Image J. The specific steps are as follows: separate the channels and keep the two channels with the target protein (Image-Color-SplitChannels)---add pseudocolor to the two channels (Image-Color-Channels Tool)---open the Colorc 2 plug-in (Analyze-Colocalization-Coloc 2)---select all parameters---analysis. A total of 12 images were counted in each group, and then the colocalization values ​​were normalized and plotted using Graphpad. One-way anova was used for significance analysis. The experimental results are shown in the figure. Figure 2 As shown in D. As can be seen from the figure, DPI can significantly increase the co-localization ratio of Parkin protein and mitochondria.

[0080] Example 3: DPI recruits Parkin protein to aggregate on the mitochondrial outer membrane in a PINK1-dependent manner and regulates the phosphorylation modification of ubiqutin

[0081] By constructing PINK1 knockout HeLa-Parkin cells, we explored whether DPI's regulation of Parkin protein depends on the presence of PINK1 protein. The specific steps for constructing the knockout cell line are as follows: co-transfect 293T cells with the successfully constructed plasmid CRISPR-humanPINK1-sgRNA-puro (sgRNA-F: CGTGGACCATCTGGTTCAAC; sgRNA-R: GTTGAACCAGATGGTCCACG) and retroviral packaging plasmids psPAX2 and pMD2.G, collect the viral supernatant after 48 hours of culture, and infect HeLa-Parkin cells with it. After 48 hours of infection, puromycin was added for selection, and PINK1 knockout HeLa-Parkin cells were successfully obtained.

[0082] The subsequent specific operation steps are the same as those in Example 2. Including Western blotting experiment ( Figure 3 A) Immunofluorescence microscopy ( Figure 3 B) Co-localization analysis ( Figure 3 C).

[0083] The results of Examples 2 and 3 demonstrate that DPI positively regulates the PINK1-Parkin pathway, as shown by regulating the accumulation of PINK1 protein ( Figure 2 A, 3A), post-translational modification of Parkin protein ( Figure 2 AC, 3A), Parkin protein aggregation in the mitochondrial outer membrane ( Figure 2 D, 3B-C).

[0084] Example 4: DPI enhances PINK1-Parkin-mediated mitochondrial autophagy

[0085] By constructing HeLa-Parkin cells overexpressing mcherry-LC3B, the regulation of DPI on mitochondrial autophagy was explored. The method for constructing the cell line is the same as in Example 3. In short, the successfully constructed plasmid pCDH-CMV-mcherry-LC3B-puro and the retroviral packaging plasmids psPAX2 and pMD2.G were co-transfected into 293T cells, and the viral supernatant was collected after 48 hours of culture and infected with HeLa-Parkin cells. Puromycin was added for selection 48 hours after infection to obtain HeLa-Parkin cells overexpressing mcherry-LC3B. The subsequent experimental operations are the same as those shown in Example 2. Our experimental results confirm that DPI positively regulates mitochondrial autophagy, which is manifested by an increase in the LC3B shear band (such as Figure 4 A), increased aggregation of LC3B (as shown in Figure 4At the same time, by constructing a PINK1 knockout cell line, it was confirmed that the positive regulation of DPI on mitochondrial autophagy was achieved in a PINK1-dependent manner (as shown in Figure 4 CE).

[0086] Example 5: Flow cytometry detection of mitochondrial membrane potential

[0087] JC-1 is an ideal fluorescent probe that is more widely used to detect mitochondrial membrane potential ΔΨm. It can detect the mitochondrial membrane potential of cells, tissues or purified mitochondria. JC-1 exists in two states: monomer and polymer, and the emission spectra of the two are different. In normal cells, the mitochondrial membrane potential is high, and JC-1 aggregates in the mitochondrial matrix to form polymers, which can produce red fluorescence; in the early stage of apoptosis, the mitochondrial membrane potential decreases, and JC-1 cannot aggregate in the mitochondrial matrix. At this time, JC-1 is a monomer and can produce green fluorescence. Therefore, this experiment mainly uses the difference in the emission wavelength of JC-1 to characterize the mitochondrial membrane potential. The specific experimental operation steps are as follows:

[0088] (1) HeLa cells in good growth state were cultured at 2x10 6 The cells were plated at a density of cells / mL in a 6 cm culture dish and cultured overnight in a 37°C, 5% CO2 incubator;

[0089] (2) A control group (0.1% DMSO), experimental group 1 (10 μM DPI), and experimental group 2 (10 μM CCCP) were set up and treated in an incubator at 37°C and 5% CO2 for 2 hours;

[0090] (3) Digest the cells with trypsin, then terminate the digestion with serum-containing DMEM medium, centrifuge at 1000×g for 2 min, resuspend the cells in 1×PBS, and centrifuge at 1000×g for 2 min;

[0091] (4) Prepare JC-1 with 1xPBS, resuspend the cell pellet after centrifugation, and incubate in a 37°C, 5% CO2 incubator for 30 min;

[0092] (5) Centrifuge at 1000 × g for 2 min, resuspend the cells in 1 × PBS, and count the cells using a hemocytometer to control the number of cells to >10,000;

[0093] (6) Detection by flow cytometry.

[0094] The results are as follows Figure 5 As shown, the results show that the PINK1-Parkin activator CCCP can significantly reduce mitochondrial membrane potential, which is consistent with the reported data, while the product DPI of the present invention has no effect on mitochondrial membrane potential. The experiment was repeated three times and the results were consistent.

[0095] Example 6: Detection of Reactive Oxygen Species ROS

[0096] The probe DCFH-DA is used to detect reactive oxygen species. DCFH-DA itself has no fluorescence and can freely pass through the cell membrane. After entering the cell, it can be hydrolyzed by the esterase in the cell to produce DCFH. The latter cannot penetrate the cell membrane, making it easy for the probe to be loaded into the cell. The reactive oxygen species in the cell can oxidize the non-fluorescent DCFH to produce a strong green fluorescent substance DCF, whose fluorescence has a maximum peak near the excitation wavelength of 502nm and the emission wavelength of 530nm, and the intensity is proportional to the level of reactive oxygen species in the cell. Therefore, this experiment uses the DCFH-DA probe for reactive oxygen species detection, and the specific operation steps are as follows:

[0097] (1) HeLa cells in good growth state were cultured at 5x10 4 Cells at a density of 10 cells / mL were evenly plated in a 96-well plate and cultured overnight in a 37°C, 5% CO2 incubator;

[0098] (2) A blank control group (0.1% DMSO), a positive control group (1% H2O2), experimental group 1 (10 μM CCCP), experimental group 2 (10 μM DPI), experimental group 3 (10 μM UA), and experimental group 4 (10 μM Raf) were set up and treated in an incubator at 37°C and 5% CO2 for 2 hours;

[0099] (3) Remove the original culture medium of the cells, wash the cells with 1xPBS, and then add 1 μM DCFH-DA probe dissolved in 1xPBS, and incubate in a light-proof incubator at 37°C and 5% CO2 for 30 min;

[0100] (4) Digest the cells with trypsin, then terminate the digestion with serum-containing DMEM medium, centrifuge at 1000×g for 2 min, resuspend the cells in 1×PBS, and centrifuge at 1000×g for 2 min;

[0101] (5) Wash with 1xPBS twice to remove excess unbound DCFH-DA probe;

[0102] (6) collecting cell pellets for fluorescence detection;

[0103] (7) The collected cell pellet was resuspended in 20 μL 1xPBS, placed on a glass slide, and covered with a cover glass. The GFP channel of the microscope was used to observe and photograph. Images were captured on a Nikon ordinary inverted microscope using a 10× objective lens;

[0104] (8) The images were analyzed for mean fluorescence intensity using Image J and graphed using Graphpad.

[0105] The experimental results are as follows Figure 6 The results showed that the treatment of H2O2 in the positive control group led to a significant increase in the production of reactive oxygen species, while experimental group 1 (10μM CCCP) and experimental group 4 (10μM Raf) led to a significant increase in the production of reactive oxygen species, while experimental group 2 (10μM DPI) and experimental group 3 (10μM UA) significantly inhibited the production of reactive oxygen species.

[0106] Example 7: DPI effectively treats MPTP-induced Parkinson's disease mouse model by regulating PINK1-Parkin-mediated mitochondrial autophagy

[0107] Neurotoxins can be used to establish animal models that are similar to human PD and partially reflect the pathological characteristics of human PD, which can provide a good way to screen PD therapeutic drugs and study their mechanisms. In the PD-induced model, commonly used neurotoxins include MPTP, 6-OHDA, paraquat, rotenone and other drugs. The MPTP-induced mouse model has a short modeling cycle, simple operation, and significant neuronal loss and behavioral abnormalities. It is one of the most commonly used PD animal models. Therefore, this experiment mainly uses MPTP for modeling, and on the basis of MPTP, the product DPI of the present invention is administered to characterize the therapeutic effect of DPI through behavioral indicators and staining of dopaminergic neurons. The time and concentration of MPTP and drug DPI injection in mice are as follows. Figure 7 As shown in A, the specific steps are as follows:

[0108] (1) Mouse preparation. WT and PINK1 mice aged 6-8 weeks were selected. - / - C57BL / 6 mice weighing about 20g were selected from each group, 8-10 mice were transferred to the behavioral mouse room, separated into cages, and marked. Subsequent experiments were carried out after the mice had adapted for one day.

[0109] (2) MPTP administration. The purchased MPTP powder (Biyuntian ST1020) was dissolved in sterile water to 5 mg / mL, and 100 μL was administered to each mouse. The MPTP dosage for each mouse was 25 mg / kg, and the weight of the mouse was weighed before administration and recorded as Day 1;

[0110] (3) Repeat step (2), recorded as Day 2;

[0111] (4) Repeat step (2), recorded as Day 3;

[0112] (5) Repeat step (2), recorded as Day 4;

[0113] (6) Repeat step (2), recorded as Day 5;

[0114] (7) DPI administration. The synthesized DPI powder was dissolved in DMSO to 10 mg / mL, and then diluted with water to 0.1 mg / mL. Each mouse was administered 100 μL. The DPI dose for each mouse was 0.5 mg / kg, and the weight of the mouse was weighed before administration and recorded as Day 6.

[0115] (8) Repeat step (7), recorded as Day 7;

[0116] (9) Repeat step (7), recorded as Day 8;

[0117] (10) Repeat step (7), recorded as Day 9;

[0118] (11) Repeat step (7), recorded as Day 10;

[0119] (12) Repeat step (7), recorded as Day 11;

[0120] (13) Repeat step (7), recorded as Day 12;

[0121] (14) After 2 days of adaptation, the mice were subjected to behavioral testing and dopaminergic staining, recorded as Day 14.

[0122] (15) Behavioral testing, including pole climbing and roller tests

[0123] a Climbing pole: The climbing pole experiment is a classic method for evaluating the motor coordination ability of mice. This experiment mainly evaluates the changes in their motor ability by recording the time required for the mouse to turn head down from the top of the pole and the time required to climb from the top to the bottom. The specific steps are: Place the mouse head up on a rough wooden ball, the ball is connected to a rough wooden stick, and the lower end of the stick is placed next to the mouse cage. The time it takes for the mouse to turn head up to head down on the wooden ball is recorded as A, and the time it takes to climb from the top to the bottom of the pole is recorded as B. Each mouse is tested 3 times, and the average of the 3 climbing times is taken as the statistical value. The statistical index values ​​are plotted using Graphpad, and two-way anova is used for significance analysis. The experimental results are as follows Figure 7 As shown in D. As can be seen from the figure, the administration of MPTP severely damaged the motor function of mice, as shown by the significant increase in the time the mice spent climbing the pole and the number of turns, but the administration of DPI alleviated the motor function damage of mice caused by MPTP to a certain extent. However, in PINK1 knockout mice, DPI could not restore the motor function damage of mice caused by MPTP, proving that the neuroprotective effect of DPI is achieved by regulating the PINK1 protein.

[0124] b Roller wheel experiment: The roller wheel experiment is a convenient method to evaluate the motor function of mice. This experiment mainly records the time when the mouse falls for the first time and the total number of times the mouse falls within the specified time. The specific operation steps are: set the speed of the roller to a uniform speed of 20r / min, first place the mouse in different barrel positions of the roller, conduct 1-2 minutes of simulation training, and then start the formal experiment. The time is set to 3 minutes, place the mouse on the roller and start timing, the time when the mouse falls from the roller for the first time is recorded as A, and the total number of times the mouse falls within the specified 3 minutes is recorded as B. Each mouse is tested 3 times, and the average of the 3 times is taken as the statistical value. The statistical index values ​​are plotted using Graphpad, and two-way anova is used for significance analysis. The experimental results are as follows Figure 7 As shown in D. As can be seen from the figure, the administration of MPTP severely damaged the motor function of mice, as shown by a significant increase in the number of times the mice fell off the roller, but the administration of DPI alleviated the motor function damage of mice caused by MPTP to a certain extent. However, in PINK1 knockout mice, DPI could not restore the motor function damage of mice caused by MPTP, proving that the neuroprotective effect of DPI is achieved by regulating the PINK1 protein.

[0125] (16) Dopaminergic section staining.

[0126] a Mouse perfusion. Prepare 1xPBS and 4% PFA and the necessary equipment for perfusion, use the perfusion instrument to perfuse the mouse, and place the perfused mouse head in PFA for 72 hours until the head completely sinks to the bottom;

[0127] b Slice. The mouse brain was sliced ​​at a thickness of 40 μm using a freezing microtome, and the sliced ​​brain slices were stored in antifreeze at -20°C;

[0128] c Staining. The cut brain slices were randomly selected for washing with 1xPBS, blocking with 3% BSA + 0.05% Triton x-100, staining with TH antibody overnight, staining with secondary antibody in dark, staining of cell nuclei, and sealing.

[0129] d Confocal fluorescence photography. Confocal images were captured on a Zeiss LSM780 confocal microscope using a 20x objective. The acquired confocal microscopic images were processed in Zen Blue 3.1 software. Figure 7 As shown in C.

[0130] e TH-positive neuron number statistics. Confocal images captured on a Zeiss LSM780 confocal microscope were processed using Image J to calculate the number of TH-positive neurons. 15 images were collected for each experimental treatment group, and the obtained values ​​were plotted using Graphpad, and two-way anova was used for significance analysis. The experimental results are shown in Figure 2. Figure 7 As shown in C. As can be seen from the figure, the administration of MPTP led to a significant decrease in the number of dopaminergic neurons in the substantia nigra and striatum of mice, but when DPI and MPTP were co-treated, the number of dopaminergic neurons in the substantia nigra and striatum of mice was significantly restored, confirming that DPI has a good therapeutic and restorative effect on neuronal damage caused by MPTP. However, in PINK1 knockout mice, the co-treatment of DPI and MPTP did not change the number of dopaminergic neurons in the substantia nigra and striatum of mice, indicating that the protective effect of DPI on dopaminergic neurons depends on PINK1 protein.

Claims

1. The application of diphenyl iodonium chloride is any one of the following (a1)-(a6): (a1) Use in the preparation of products for preventing and / or treating diseases related to mitochondrial dysfunction; (a2) Application in the preparation of a mitochondrial autophagy enhancer; (a3) Use in the preparation of products that specifically enhance mitochondrial autophagy; (a4) Use in the preparation of a product that specifically stabilizes PINK1 protein in the outer membrane of mitochondria; (a5) Application in the preparation of a product for specifically regulating Parkin protein aggregation in the mitochondrial outer membrane; (a6) Use in the preparation of products that specifically inhibit the production of reactive oxygen species; The structural formula of the diphenyl iodonium chloride salt is as follows:

2. The application of diphenyl iodonium chloride is any one of the following (b1)-(b6): (b1) Use in the prevention and / or treatment of diseases related to mitochondrial dysfunction; (b2) application in increasing mitophagy; (b3) Application in specific enhancement of mitophagy; (b4) application in specific stabilization of PINK1 protein in the outer membrane of mitochondria; (b5) Application in the specific regulation of Parkin protein aggregation in the mitochondrial outer membrane; (b6) Application in specific inhibition of reactive oxygen species production; The structural formula of the diphenyl iodonium chloride salt is as follows:

3. The use according to claim 1 or 2, characterized in that: The prevention and / or treatment of diseases related to mitochondrial dysfunction is to treat diseases related to mitochondrial dysfunction through the PINK1-Parkin pathway.

4. The use according to claim 1 or 2, characterized in that: The diphenyl iodonium chloride salt induces mitochondria to enter lysosomes and cause mitochondrial autophagy by enhancing the PINK1-Parkin pathway.

5. The use according to claim 1 or 2, characterized in that: The diseases related to mitochondrial dysfunction include neurodegenerative diseases and motor muscle damage diseases; Furthermore, the neurodegenerative disease is Parkinson's syndrome.

6. The use according to claim 5, characterized in that: The Parkinson's syndrome refers to a disease model of dopaminergic neuron damage caused by MPTP; The diphenyl iodonium chloride salt can effectively improve the damage of dopaminergic neurons caused by MPTP; Or, the diphenyl iodonium chloride salt can effectively alleviate the motor function damage caused by MPTP.

7. The use according to claim 1 or 2, characterized in that: The effective concentration of diphenyliodonium chloride salt for enhancing mitophagy is 5-50 μM; Alternatively, the effective concentration of diphenyl iodonium chloride salt used to stabilize PINK1 protein on the outer membrane of mitochondria is 5-50 μM; Alternatively, the effective concentration of diphenyl iodonium chloride salt used to specifically regulate Parkin protein aggregation in the mitochondrial outer membrane is 5-50 μM; Alternatively, the effective concentration of diphenyl iodonium chloride salt for inhibiting the generation of active oxygen is 5-50 μM.

8. A method for preventing and / or treating diseases related to mitochondrial dysfunction, comprising the following steps: administering a therapeutically effective amount of diphenyl iodonium chloride to a subject to prevent and / or treat diseases related to mitochondrial dysfunction.

9. The method according to claim 8, characterized in that: The diseases related to mitochondrial dysfunction include neurodegenerative diseases and motor muscle damage diseases; Furthermore, the neurodegenerative disease is Parkinson's syndrome.

10. A method for promoting mitochondrial autophagy, comprising the following steps: administering an effective amount of diphenyl iodonium chloride salt to a subject.

Images