Construction method and application of conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus

Abstract

The invention provides a construction method and application of conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus, and belongs to the technical field of genetic engineering. The construction method comprises the following steps: carrying out enzyme digestion on a PoAd5 plasmid by endonuclease AsiSI; the method comprises the following steps: carrying out in-vitro gene synthesis on a chimeric Ad5 / 35-Hexon (HVR1 + 5) gene segment, carrying out homologous recombination on the chimeric Ad5 / 35-Hexon (HVR1 + 5) gene segment and linear PoAd5 co-transfected BJ5183 to obtain PoAd5 / 35-H, carrying out ClaI enzyme digestion, carrying out in-vitro gene synthesis on Ad5 / 35-Fiber, and carrying out homologous recombination on the Ad5 / 35-Fiber and linear PoAd5 / 35-H co-transfected BJ5183 to obtain a final plasmid oAd5 / 35-HF; and carrying out PacI enzyme digestion, purifying, and transfecting an HEK293 cell to obtain the conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus. The invention provides an innovative adenovirus vector construction scheme for enhancing the infection ability and the treatment effect of viruses.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for constructing a conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus and its application. Background Art

[0002] Oncolytic viruses (OV) are a type of virus that can selectively infect and kill tumor cells. As a new type of anti-tumor immunotherapy following surgery, radiotherapy, chemotherapy and targeted therapy, several drugs have been approved for marketing in Europe, the United States and China. Among them, adenovirus (Ad) vectors are the most widely used oncolytic virus products so far, accounting for 41.9% of oncolytic virus products that have been clinically tested. In December 2022, the FDA approved the first non-oncolytic adenovirus gene therapy encoding IFNα-2b, nadofaragene firadenovec, for non-muscle invasive bladder cancer (NMIBC) that is unresponsive to BCG (BCG). And the large-scale use of adenovirus vector vaccines has further confirmed its safety and effectiveness as an oncolytic virus vector. Adenovirus is a non-enveloped, non-integrated double-stranded DNA virus with a genome length of 30 to 38 kilobase pairs (kb), and the diameter of the virus particles is approximately 80 to 110 nanometers (nm). The outer shell of the virus particle has an icosahedral structure composed of 240 hexons and 12 pentons, showing its morphological complexity and particularity. Adenovirus vector technology uses the unique physical and biological properties of the virus and has shown broad application potential in many fields such as gene therapy and vaccine development.

[0003] In particular, adenovirus type 5 (Ad5) vectors are particularly prominent in the field of gene therapy. Four Ad5-based drugs have been successfully developed and approved for marketing. These drugs have shown significant therapeutic effects in cancer treatment and vaccine development. Ad5 vectors use specific gene modification technology to accurately encode and deliver a variety of immune-related genes including cytokines, immune activation factors, and tumor-specific antigens, effectively activating the host immune response and achieving precise targeted killing of tumor cells.

[0004] Nevertheless, oncolytic adenovirus therapy has limitations in administration, pre-existing adenovirus neutralizing antibodies in the population, and unclear interaction mechanisms with host immunity, which limit the clinical application of oncolytic adenovirus products. Type 5 recombinant adenovirus vectors are widely used in gene therapy due to their advantages such as wide range of host cells, large insertable fragments, and high virus titers, including the current and future generations. and dl5120 (ONYX-015), but the application of adenovirus type 5 vectors also has limitations: 1. The infection efficiency is extremely low for ovarian cancer cells and lymphomas that lack coxsackievirus and adenovirus receptor (CAR). 2. The proportion of pre-existing type 5 neutralizing antibodies in the population is relatively high, especially after the widespread use of the new crown vaccine with adenovirus type 5 as the vector (recombinant new coronavirus vaccine (adenovirus type 5 vector) ) further limits the application scope of products using type 5 adenovirus as a vector.

[0005] In order to overcome the impact of pre-existing antibodies of adenovirus type 5 on the efficacy of adenovirus oncolytic products or vaccine products, adenovirus vector vaccine products adopt strategy 1: use rare serotype adenovirus vectors such as Ad26 and Ad48, including Johnson & Johnson's viral vector vaccine Ad26.COV2.S and Russia's "Sputnik V" both use Ad26 vectors, which have resistance advantages in non-replicating adenovirus vectors, but in oncolytic adenovirus type 5 vectors, due to their strong immunogenicity and strong oncolytic properties, other types of oncolytic products cannot match them; strategy 2: use chimeric adenovirus type 5 vectors and use other serotypes Hexon to replace Ad5 Hexon, but due to gene compatibility, only a few replacements have been successful, including using Ad3 or Ad6 to replace Ad5Hexon, but HAdV-3 is the most common type of HAdVs in the world, and its outbreak or prevalence has been reported in almost every country; the serotype positive rates of Ad3, Ad5, and Ad7 in my country are all above 60%; Strategy 3: HVR region replacement (hypervariable region, HVR), especially the selection of rare sera to replace Ad5 Hexon HVR shows oncolytic ability, Hexon protein is the most distributed protein structure in the adenovirus capsid protein structure, which is highly conserved between human serotypes. The main difference between different serotypes of adenovirus is the 7 hypervariable regions (hypervariable region, HVR) of Hexon protein; including the HVR regions of ad6, ad26, ad43, and ad48 can be successfully replaced with the HVR region of ad5. In oncolytic products, the replacement of the HVR region is bound to cause changes in the packaging and oncolytic abilities of adenoviruses, including those that have been successfully replaced, and most of them are used in non-replicating adenovirus vector vaccine research. Summary of the invention

[0006] The purpose of the present invention is to provide a method for constructing and applying a conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus.

[0007] In order to solve the problem of reduced efficacy of type 5 conditionally replicative oncolytic adenovirus (Ad5) vectors in tumor immunotherapy, especially the problem of reduced efficacy caused by pre-existing immune responses in patients, the present invention proposes an innovative adenovirus vector construction scheme. This scheme combines the use of BJ5183 homologous recombination technology and in vitro seamless cloning technology, aiming to develop a new adenovirus vector oAd5 / 35-HF by replacing the Hexon and Fiber regions of Ad5 with the corresponding regions of Ad35. This transformation strategy can not only effectively avoid the reduction of the virus infection and killing ability of pre-existing neutralizing antibodies in the body, but also enhance the virus's infection ability and therapeutic effect by changing the way the virus enters the host cell (from CAR receptor to CD46).

[0008] The core modification steps of oAd5 / 35-HF of the present invention include: 1) deleting 27bp (sites 920-946) of the Ad5 E1A region to enhance conditional replication ability; 2) replacing specific sequences (regions 1 and 5) in the Hexon region of Ad5 with corresponding sequences of the Ad35 type; 3) completely replacing the Fiber region of Ad5 with the Fiber of the Ad35 type to further optimize the virus's recognition and binding ability to the novel receptor CD46. Through these precise genetic engineering modifications, the oAd5 / 35-HF vector can bypass the pre-recognition of the host immune system, providing a gene therapy solution that is still effective in the presence of a strong immune background.

[0009] The technical solution of the present invention specifically includes the following aspects:

[0010] In a first aspect, the present invention provides a method for constructing a conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus, comprising the following steps:

[0011] (1) using the nuclease AsiSI to digest the PoAd5 plasmid to obtain linearized PoAd5;

[0012] (2) in vitro gene synthesis of chimeric Ad5 / 35-Hexon (HVR1+5) gene fragments;

[0013] (3) co-transfecting the Ad5 / 35-Hexon (HVR1+5) gene fragment and the linearized PoAd5 into BJ5183 competent cells to achieve homologous recombination and obtain the PoAd5 / 35-H plasmid;

[0014] (4) digesting the PoAd5 / 35-H plasmid with ClaI to obtain linearized PoAd5 / 35-H;

[0015] (5) in vitro gene synthesis of Ad5 / 35-Fiber gene fragments;

[0016] (6) co-transfecting the Ad5 / 35-Fiber gene fragment and the linearized PoAd5 / 35-H into BJ5183 competent cells to achieve homologous recombination and obtain the oAd5 / 35-HF plasmid;

[0017] (7) The oAd5 / 35-HF plasmid was digested with PacI and purified, and then transfected into HEK293 cells to finally obtain the conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus.

[0018] Among them, the DNA sequence of the Ad5 / 35-Hexon (HVR1+5) gene fragment is shown in SEQ ID NO.9, and its corresponding protein sequence is shown in SEQ ID NO.11.

[0019] The DNA sequence of the Ad5 / 35-Fiber gene fragment is shown in SEQ ID NO.10, and its corresponding protein sequence is shown in SEQ ID NO.12.

[0020] As a further improvement of the present invention, the PoAd5 plasmid is a plasmid having an E1 / del (Ad5920-946nt) gene. Specifically, the E1 / del (Ad5920-946nt) gene is a gene containing the 104-4001nt sequence of the E1 gene of adenovirus Ad5, but lacking the 920-946 region corresponding to the adenovirus.

[0021] As a further improvement of the first aspect of the present invention, the construction method of the PoAd5 / 35-H plasmid is as follows:

[0022] S1. Use AsiSI to digest the PoAd5 plasmid to obtain linearized PoAd5;

[0023] S2. Purify the linearized PoAd5 in step S1 and detect its DNA concentration;

[0024] S3. Take the pUC57-AD5-17821-22740 (HVR1+5) plasmid and use primers to perform PCR to obtain the target fragment;

[0025] S4. Purifying the target fragment in step S3 and detecting its DNA concentration;

[0026] S5. co-transform the purified product of the linearized PoAd5 in step S2 and the purified product of the target fragment in step S4 into BJ5183 competent cells;

[0027] S6. Colony PCR followed by sequencing identification;

[0028] S7. The plasmid with the correct sequencing result was transformed into the infectious T1 competent cell for identification and preservation to obtain the PoAd5 / 35-H plasmid.

[0029] As a further improvement of the first aspect of the present invention, the enzyme cutting system in step S1 is AsiSI 5 μL, PoAd 540 μL, rcutSmart Buffer 25 μL, ddH2O is added to 500 μL, the condition is 37°C, 15 min.

[0030] As a further improvement of the first aspect of the present invention, the primers in step S3 include PUC57-F and PUC57-R, the sequence of PUC57-F is such as SEQ ID NO.1; the sequence of PUC57-R is such as SEQ ID NO.2.

[0031] As a further improvement of the first aspect of the present invention, the specific method of step S5 is as follows:

[0032] ①Take BJ5183 competent cells from -80℃ and quickly put them in ice. After the bacterial block melts, add the linearized PoAd5 purification product and PCR product, mix gently, and let it stand in ice for 20-30 minutes;

[0033] ② Heat shock in a 40-45℃ water bath for 40-50s, return to ice and let stand for 2min;

[0034] ③ Add LB medium to the centrifuge tube, mix well and resuscitate for 50-70 minutes;

[0035] ④ Take the culture solution and spread it on LB medium containing kanamycin;

[0036] ⑤ Place the plate upside down in an incubator for overnight culture;

[0037] ⑥ The next day, pick the plaques and culture them in 5 ml LB + 5 μl kana (10 mg / ml) at 200 rpm and 37°C;

[0038] ⑦Extract the plasmid after 8-12 hours of culture.

[0039] As a further improvement of the first aspect of the present invention, the sequencing primers used for sequencing in step S6 include HVR2-F, HVR2-R, HVR5-F, and HVR5-R, the sequence of HVR2-F is shown in SEQ ID NO.3; the sequence of HVR2-R is shown in SEQID NO.4; the sequence of HVR5-F is shown in SEQ ID NO.5; and the sequence of HVR5-R is shown in SEQ ID NO.6.

[0040] The present invention further protects a conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus obtained by the above method.

[0041] In a second aspect, the present invention provides the use of the above-mentioned conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus in the preparation of anti-tumor drugs.

[0042] As a further improvement of the second aspect of the present invention, the present invention provides the use of the above-mentioned conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus in the preparation of oncolytic virus drugs.

[0043] The present invention has the following beneficial effects:

[0044] The present invention proposes a novel chimeric oncolytic adenovirus vector modification scheme, which realizes specific adenovirus capsid gene modification through novel genetic engineering technology, and constructs a novel chimeric oncolytic adenovirus vector to improve its efficacy in patients with pre-existing adenovirus type 5 neutralizing antibodies. In the present invention, an innovative strategy is proposed for the main challenge encountered by Ad5 vectors in gene therapy applications-the weakening of the oncolytic adenovirus type 5 treatment effect due to the patient's pre-existing immune response to adenovirus type 5. Previous studies have shown that Ad5-specific neutralizing antibodies are mainly directed against the major capsid protein of its hexon, suggesting that the recognition of these neutralizing antibodies can be circumvented by modifying the hexon structure of Ad5, thereby improving the immune escape ability of Ad5 vectors. However, there are significant biological limitations to the exchange of hexons between adenoviruses, and direct exchange of hexons from different viral subgroups may affect the structural stability and replication ability of the virus. Based on this challenge, the present invention proposes a method to avoid the binding of neutralizing antibodies by specific Hexon gene mutations rather than complete replacement. This approach can both block the neutralization effect of pre-existing antibodies on Ad5 and keep the virus's replication efficiency unaffected.

[0045] As a member of the C group adenovirus, Ad5 is mainly combined with the target cell through the interaction of Ad fiber protein with the Coxsackie virus and adenovirus receptor (CAR) on the cell surface. In addition, the pentamer substrate of Ad5 and the integrin on the target cell also participate in the interaction. However, the gene transduction efficiency mediated by Ad5 is affected by the expression level of CAR, and the expression of CAR in various tumors is often downregulated due to the activation of the RAF-MEK-ERK pathway, which limits the application of Ad5 as a tool for cancer gene therapy. In order to overcome this limitation, the present invention proposes a strategy to replace the fiber protein of Ad5 with the fiber protein of Ad35. Unlike Ad5, Ad35 (belonging to group B adenovirus) can attach to cells in a CAR-independent manner, and its main cell receptor is CD46, which is a complement regulatory protein widely expressed on various cells in the human body. Therefore, through this replacement, the infection range of the vector can be expanded, and the infection efficiency of tumor cells with downregulated CAR expression can be improved, thereby enhancing the practicality of Ad5 vectors in cancer gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0047] Figure 1 Schematic diagram of oAd5 / 35-HF genome modification

[0048] Figure 2 PoAd5 / 35-HF plasmid map

[0049] Figure 3 This is the oAd5 / 35-HF viral genome map;

[0050] Figure 4 The killing ability of oAd5 / 35-HF in different tumor cell lines;

[0051] Figure 5 The infectivity of oAd5 / 35-HF in different tumor cell lines in the presence of neutralizing antibodies

[0052] Figure 6 The killing ability of oAd5 / 35-HF in different tumor cell lines in the presence of neutralizing antibodies

[0053] Figure 7 The killing capacity of oAd5 / 35-HF in animals in the presence of neutralizing antibodies. DETAILED DESCRIPTION

[0054] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0055] The names and sources of the plasmids used in the present invention are as follows:

[0056]

[0057]

[0058] The competent states and sources used in the present invention are as follows:

[0059] Name of competent state source Part Number Bj5183 Shanghai Weidi Biotechnology Co., Ltd. CAT:DL1076S Bj5183-AD-1 Shanghai Weidi Biotechnology Co., Ltd. CAT:DL1075S T1 competent state Beijing Quanshijin Biotechnology Co., Ltd. CAT:CD501

[0060] Example 1 Construction of conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus

[0061] This embodiment provides a method for constructing a conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus. Figure 1 As shown:

[0062] The present invention designs an innovative scheme for constructing oAd5 / 35-HF (oncolyticAd5 / 35-HF) conditionally replicative adenovirus vector based on the combined application of gene synthesis technology, in vitro ligation technology and BJ5183 homologous recombination technology, which is specifically based on two plasmids, Padeasy-1 and Pshuttle-CMV, in the AdEasy system.

[0063] (1) oAd5 used the Pad-E1A / Δ27bp-delE3 / GFP / LUC plasmid (named PoAd5) stored in the laboratory;

[0064] (2) digesting the PoAd5 plasmid with the nuclease AsiSI to obtain linearized PoAd5;

[0065] (3) in vitro gene synthesis of chimeric Ad5 / 35-Hexon (HVR1+5) gene fragments;

[0066] (4) The Ad5 / 35-Hexon (HVR1+5) gene fragment and linearized PoAd5 were co-transfected into BJ5183 cells to achieve homologous recombination and obtain the PoAd5 / 35-H plasmid;

[0067] (5) ClaI digestion of PoAd5 / 35-H plasmid to obtain linearized PoAd5 / 35-H;

[0068] (6) in vitro gene synthesis of Ad5 / 35-Fiber gene fragments;

[0069] (7) Co-transfecting the Ad5 / 35-Fiber gene fragment with the linearized PoAd5 / 35-H into BJ5183 to achieve homologous recombination and obtain the final oAd5 / 35-HF plasmid;

[0070] (8) The oAd5 / 35-HF plasmid was digested with PacI and purified, and then transfected into HEK293 cells to obtain the oAd5 / F35-HF adenovirus oncolytic product.

[0071] The plasmid map of PoAd5 / 35-HF is as follows Figure 2 , oAd5 / 35-HF viral genome map Figure 3 .

[0072] Among them, PoAd5 / 35-H plasmid (such as Figure 2 The construction method of (shown) is as follows:

[0073] 1) Take the Pad-E1A / Δ27bp-delE3A / GFP / LUC (PoAd5) plasmid, which has the E1 / del (Ad5920-946nt) gene (E1 contains the adenovirus 104-4001nt sequence, and lacks the 920-946 region corresponding to the adenovirus) (Zhou, J., et al., Novel oncolytic adenovirus selectively targets tumor-associated polo-like kinase 1 and tumor cell viability. Clin Cancer Res, 2005. 11(23): p.8431-40.);

[0074] 2) AsiSI digested the PoAd5 plasmid. The digestion system is as shown in Table 1:

[0075] Table 1

[0076]

[0077] 3) Purifying the linearized PoAd5 in step 2) and detecting its DNA concentration;

[0078] 4) Take the pUC57-AD5-17821-22740 (HVR1+5) plasmid and use the primers in Table 2 to perform PCR to obtain the target fragment (PCR kit 2×Phanta Max MasterMix (Dye Plus), Cat: P525-01);

[0079] Table 2

[0080] Primer name sequence Remark PUC57-F GTAAAACGACGGCCAGTG SEQ ID NO.1 PUC57-R GGAAACAGCTATGACCATG SEQ ID NO.2

[0081] 5) purifying the target product of 4) and detecting its DNA concentration;

[0082] 6) Co-transform the linearized PoAd5 purified product from 3) and the PCR product from 5) into the Bj5183 competent cells. The specific steps are as follows:

[0083] ①Take BJ5183 competent cells, take them out from -80℃, and quickly put them in ice. After 8 minutes, wait for the bacterial block to melt, add 50ng of linearized PoAd5 purification product and 500ng of PCR product, mix gently, and let it stand in ice for 25 minutes;

[0084] ② Heat shock in a 42℃ water bath for 45s, then quickly return to ice and let stand for 2min;

[0085] ③ Add 500ul LB medium to the centrifuge tube, mix well, and incubate at 37℃, 200rpm for 60min;

[0086] ④ Take 50ul and 150ul of culture solution and spread it on LB medium containing kanamycin;

[0087] ⑤ Place the plate upside down in a 37°C incubator for overnight culture;

[0088] ⑥ The next morning, pick the plaques and culture them in 5 ml LB + 5 ul kana (10 mg / ml) at 200 rpm and 37°C.

[0089] ⑦ After 10 hours of culture, a small amount of plasmid was extracted;

[0090] 7) Colony PCR and sequencing identification, sequencing primers are as shown in Table 3:

[0091] Table 3

[0092] Primer name sequence Remark HVR2-F CCGTTGTTGTAACCCGTCCT SEQ ID NO.3 HVR2-R CTTGCCCTCCATTTTCATTT SEQ ID NO.4 HVR5-F CCAGAGTAGGTGTAATAAGG SEQ ID NO.5 HVR5-R TAGAAAGTCAAGTGGAAATG SEQ ID NO.6

[0093] 8) The correctly sequenced plasmid was transformed into the infectious T1 competent cell for identification and preservation to obtain the PoAd5 / 35-H plasmid.

[0094] Construction method of PoAd5 / 35-HF plasmid:

[0095] 1) Take PoAd5 / 35-H plasmid;

[0096] 2) ECORI digestion of PoAd5 plasmid, the digestion system is as shown in Table 4:

[0097] Table 4

[0098]

[0099] 3) Purifying the linearized PoAd5 / 35-H in step 2) and detecting its DNA concentration;

[0100] 4) Take pUC57-Ad5 / 35-F plasmid (characterized by containing adenovirus vector delE3A / GFP / LUC and Ad5 / 35-Fiber gene), and use the primers in Table 5 to perform PCR to obtain the target fragment (PCR kit 2×Phanta MaxMasterMix (Dye Plus), Cat: P525-01);

[0101] Table 5

[0102] Primer name sequence Remark PUC57-F GTAAAACGACGGCCAGTG SEQ ID NO.7 PUC57-R GGAAACAGCTATGACCATG SEQ ID NO.8

[0103] 5) purifying the target product of 4) and detecting its DNA concentration;

[0104] 6) Co-transform the linearized PoAd5-H purified product from 3) and the PCR product from 5) into the competent cells of Bj5183, following the same steps as above;

[0105] 7) Select clones for sequencing and identification. The correct plasmid is transfected into T1 competent cells;

[0106] 8) Obtain PoAd5 / 35-HF plasmid.

[0107] oAd5 / 35-HF oncolytic virus (eg Figure 2 How to obtain it:

[0108] 1) 10ug PoAd5 / 35-HF plasmid was digested with PacI and the product was purified by conventional phenol-chloroform method.

[0109] 2) 5ug linearized PoAd5 / 35-HF was transfected into HEK293A cells using Lipo3000, and viral plaques were observed after 5 days;

[0110] 3) Amplify and purify oAd5 / 35-HF virus.

[0111] In the present invention, the DNA sequences of Ad5 / 35-H and Ad5 / 35-F in Example 1 and their corresponding protein sequences are shown below:

[0112]

[0113]

[0114]

[0115] Example 2 Identification of the therapeutic effect and anti-neutralizing antibody capacity of oncolytic adenovirus recombinant oAd5 / 35-HF

[0116] 1. In vitro killing ability detection of oAd5 / 35-HF

[0117] (1) Cell inoculation and culture

[0118] The cell lines used in this experiment are human tumor cells. At the beginning of the experiment, 5×10^3 cells were inoculated in each well of a 96-well culture plate. After the cells were inoculated and adhered to the wall, they were replaced with complete culture medium containing 10% fetal bovine serum and cultured in a constant temperature cell culture incubator at 37°C and 5% CO2 until the cell fusion rate was close to 70%.

[0119] (2) oAd5 / 35-HF treatment

[0120] When the cell fusion rate reaches 70%, the old culture medium is replaced with a new culture medium, to which oAd5 / 35-HF with different polyvalent infection indexes (MOI) and control Ad5 wild-type virus are added. After replacing the culture medium, the 96-well culture plate is gently shaken three times to ensure that the virus solution is in uniform contact with the cells. After adding oAd5 / 35-HF, the 96-well culture plate is returned to the constant temperature cell culture incubator and cultured for 72 hours at 37°C and 5% CO2.

[0121] (3) Cell viability determination

[0122] After 72 hours of cell culture, the CCK-8 kit (Takara, Japan) was used to determine the cell survival rate. This kit relies on the dehydrogenase activity in the cells and can convert WST-8 into a water-soluble yellow chelate, the color intensity of which is proportional to the number of viable cells. The experimental operation was carried out according to the manufacturer's instructions, including adding 10 μL of CCK-8 solution to each well and continuing to culture in a constant temperature cell culture incubator for 1 to 4 hours. The absorbance value (450 nm wavelength) of the 96-well culture plate was read by a microplate reader to analyze the cell survival.

[0123] (4) Results analysis

[0124] like Figure 4 As shown, the oAd5 / 35-HF treatment group significantly reduced cell survival in different tumor cell lines. In contrast, the control group had a higher cell survival rate. This result highlights that oAd5 / 35-HF has a significant inhibitory effect on tumor cells in in vitro models.

[0125] 2. Detection of the neutralizing antibody ability of oAd5 / 35-HF against adenovirus type 5 in vitro (replication)

[0126] (1) Dilution of adenovirus type 5 neutralizing antibodies

[0127] A commercial adenovirus type 5 neutralizing antibody (Ab6982, USA) was used to evaluate the effect of neutralizing antibodies on the infection ability of oAd5 / 35-HF oncolytic virus. 2 μL of adenovirus type 5 neutralizing antibody was taken and diluted 5000 times with complete medium containing 10% fetal bovine serum. The diluted adenovirus type 5 neutralizing antibody solution was filtered through a small filter with a 0.22 μm filter membrane and collected in a 15 mL sterile centrifuge tube for use.

[0128] (2) Co-incubation of adenovirus type 5 neutralizing antibodies with viruses

[0129] Different volumes of the above-prepared antibody dilution solution were taken out for further dilution, and mixed with oAd5 / 35-HF at a volume ratio of 1:1 to prepare oAd5 / 35-HF-5-type adenovirus neutralizing antibody mixtures containing different type 5 adenovirus neutralizing antibody concentrations (10,000 times, 50,000 times, 100,000 times and 1 million times dilution). In addition, a virus solution without antibodies was set as an experimental control group.

[0130] (3) Treatment with Ad5 / 35-HF-5 adenovirus neutralizing antibody mixture

[0131] The oAd5 / 35-HF-5 adenovirus neutralizing antibody mixture prepared above was incubated at 37°C and 5% CO2 for 1 hour. After incubation, the mixture was treated in a 12-well plate (2×10^5 tumor cells per well). After adding the mixture, the 12-well culture plate was returned to the constant temperature cell culture incubator and continued to be cultured for 4 hours in an environment of 37°C and 5% CO2. After the culture was completed, the 12-well culture plate was digested with trypsin, and the cell pellet in each well was collected by centrifugation for the next step of viral DNA analysis.

[0132] (4) DNA extraction

[0133] DNA was extracted from the above cell samples using a DNA extraction kit (OMEGA, USA), and the experimental operation was carried out according to the manufacturer's instructions. The quality and concentration of the extracted DNA were evaluated by Nanodrop spectrophotometer.

[0134] (5) qPCR analysis of oAd5 / 35-HF DNA replication ability in cells

[0135] Taq Pro Universal SYBR qPCR MasterMix (Novozymes, China) was used to perform qPCR analysis of oAd5 / 35-HF DNA levels in samples. Experimental operations, reaction systems, and thermal cycling parameters were set according to the manufacturer's guidelines.

[0136] (6) Results Analysis

[0137] like Figure 5 When neutralizing antibodies were added, the ability of oAd5 / 35-HF to infect tumor cells was significantly enhanced compared with the control group. This result highlights that oAd5 / 35-HF has a significant effect in resisting neutralizing antibodies in the in vitro model.

[0138] 3. Detection of the ability of oAd5 / 35-HF to resist neutralizing antibodies in vitro (killing)

[0139] (1) Dilution of adenovirus type 5 neutralizing antibodies

[0140] A commercial adenovirus type 5 neutralizing antibody (Ab6982, USA) was used to evaluate the effect of neutralizing antibodies on the infection ability of oAd5 / 35-HF oncolytic virus. 2 μL of adenovirus type 5 neutralizing antibody was taken and diluted 5000 times with complete medium containing 10% fetal bovine serum. The diluted adenovirus type 5 neutralizing antibody solution was filtered through a small filter with a 0.22 μm filter membrane and collected in a 15 mL sterile centrifuge tube for use.

[0141] (2) Co-incubation of adenovirus type 5 neutralizing antibodies with viruses

[0142] Different volumes of the above-prepared antibody dilution solution were taken out for further dilution, and mixed with oAd5 / 35-HF at a volume ratio of 1:1 to prepare oAd5 / 35-HF-5-type adenovirus neutralizing antibody mixtures containing different type 5 adenovirus neutralizing antibody concentrations (10,000 times, 50,000 times, 100,000 times and 1 million times dilution). In addition, a virus solution without antibodies was set as an experimental control group.

[0143] (3) Treatment with Ad5 / 35-HF-5 adenovirus neutralizing antibody mixture

[0144] The oAd5 / 35-HF-5 adenovirus neutralizing antibody mixture prepared above was incubated at 37°C and 5% CO2 for 1 h. After the incubation, the mixture was treated in a 96-well plate (5×10 3 After adding the mixed solution, the 96-well culture plate was returned to the constant temperature cell culture incubator and cultured for 72 hours in an environment of 37°C and 5% CO2.

[0145] (4) Cell viability determination

[0146] After 72 hours of cell culture, the CCK-8 kit (Takara, Japan) was used to determine the cell survival rate. The experimental operation was carried out according to the manufacturer's instructions, including adding 10 μL of CCK-8 solution to each well and continuing to culture in a constant temperature cell culture incubator for 1 to 4 hours. The absorbance value (450 nm wavelength) of the 96-well culture plate was read by an ELISA reader to analyze the cell survival.

[0147] (5) Results analysis

[0148] like Figure 6 The results showed that treatment with adenovirus type 5 neutralizing antibodies significantly reduced the ability of wild-type Ad5 to inhibit tumors, while the oAd5 / 35-HF treatment group was still able to effectively kill tumor cells. This result highlights that even in the neutralizing antibody environment, oAd5 / 35-HF still has a significant anti-tumor effect.

[0149] 4. Detection of the ability of oAd5 / 35-HF to resist neutralizing antibodies in vivo (passive immunity)

[0150] (1) Construction of subcutaneous xenograft tumor model

[0151] 42 6-week-old female nude mice were ordered and housed in the SRF cell house. Subsequently, A549 cells were digested with trypsin-EDTA, washed with PBS and resuspended to reach a cell concentration of 2×10^7 / mL. Each nude mouse was inoculated with 2×10^6 A549 cells by subcutaneous injection, and tumor growth was observed and measured regularly after inoculation.

[0152] (2) Pre-immunization with adenovirus type 5 neutralizing antibody and oAd5 / 35-HF treatment in subcutaneous xenograft tumor model

[0153] On the 7th day after subcutaneous inoculation of A549 cells, qualified model animals were selected for the experiment according to the tumor volume. The animals were first injected intravenously with immune serum of type V adenovirus neutralizing antibodies (100uL / animal), followed by oncolytic virus therapy (5*10 8 / 50uL / mouse). During the treatment, the drug was administered at multiple points via intratumoral injection, and whole blood samples were collected at specific time points to measure the neutralizing antibody (NAB) level in nude mice.

[0154] (3) Effect evaluation

[0155] After the treatment, the tumor growth was continuously monitored until the experimental endpoint was reached (tumor volume was greater than 2000, tumor volume = length × width × width / 2).

[0156] (4) Results analysis

[0157] like Figure 7The results showed that in the animal model injected with adenovirus type 5 neutralizing antibodies, the therapeutic effect of oAd5 / 35-HF was significantly better than that of the control group. This result highlights that even in the presence of neutralizing antibodies in the body, oAd5 / 35-HF still has a significant anti-tumor effect.

[0158] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing a conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus, characterized in that: The following steps are involved: (1) using the nuclease AsiSI to digest the PoAd5 plasmid to obtain linearized PoAd5; (2) in vitro gene synthesis of chimeric Ad5 / 35-Hexon (HVR1+5) gene fragments; (3) co-transfecting the Ad5 / 35-Hexon (HVR1+5) gene fragment and the linearized PoAd5 into BJ5183 competent cells to achieve homologous recombination and obtain the PoAd5 / 35-H plasmid; (4) digesting the PoAd5 / 35-H plasmid with ClaI to obtain linearized PoAd5 / 35-H; (5) in vitro gene synthesis of Ad5 / 35-Fiber gene fragments; (6) co-transfecting the Ad5 / 35-Fiber gene fragment and the linearized PoAd5 / 35-H into BJ5183 competent cells to achieve homologous recombination and obtain the oAd5 / 35-HF plasmid; (7) The oAd5 / 35-HF plasmid was digested with PacI and purified, and then transfected into HEK293 cells to finally obtain the conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus.

2. The method according to claim 1, characterized in that The PoAd5 plasmid is a plasmid having the E1 / del (Ad5920-946nt) gene, which is a gene containing the 104-4001nt sequence of the E1 gene of adenovirus Ad5 but lacking the 920-946 region corresponding to the adenovirus.

3. The method according to claim 1, characterized in that The construction method of the PoAd5 / 35-H plasmid is as follows: S1. Use AsiSI to digest the PoAd5 plasmid to obtain linearized PoAd5; S2. Purify the linearized PoAd5 in step S1 and detect its DNA concentration; S3. Take the pUC57-AD5-17821-22740 (HVR1+5) plasmid and use primers to perform PCR to obtain the target fragment; S4. Purifying the target fragment in step S3 and detecting its DNA concentration; S5. co-transform the purified product of the linearized PoAd5 in step S2 and the purified product of the target fragment in step S4 into BJ5183 competent cells; S6. Colony PCR followed by sequencing identification; S7. The plasmid with the correct sequencing result was transformed into the infectious T1 competent cell for identification and preservation to obtain the PoAd5 / 35-H plasmid.

4. The method according to claim 1, characterized in that: In step S1, the enzyme digestion system is AsiSI 5 μL, PoAd 540 μL, rcutSmart Buffer 25 μL, ddH2O is added to 500 μL, the condition is 37°C, 15 min.

5. The method according to claim 1, characterized in that The primers in step S3 include PUC57-F and PUC57-R, the sequence of PUC57-F is as SEQ ID NO.1; the sequence of PUC57-R is as SEQ ID NO.

2.

6. The method according to claim 1, characterized in that The specific method of step S5 is as follows: ①Take BJ5183 competent cells from -80℃ and quickly put them in ice. After the bacterial block melts, add the linearized PoAd5 purification product and PCR product, mix gently, and let it stand in ice for 20-30 minutes; ② Heat shock in a 40-45℃ water bath for 40-50s, return to ice and let stand for 2min; ③ Add LB medium to the centrifuge tube, mix well and resuscitate for 50-70 minutes; ④ Take the culture solution and spread it on LB medium containing kanamycin; ⑤ Place the plate upside down in an incubator for overnight culture; ⑥ The next day, pick the plaques and culture them in 5 ml LB + 5 μl kana (10 mg / ml) at 200 rpm and 37°C; ⑦Extract the plasmid after 8-12 hours of culture.

7. The method according to claim 1, characterized in that The sequencing primers used for sequencing in step S6 include HVR2-F, HVR2-R, HVR5-F, and HVR5-R, the sequence of HVR2-F is shown in SEQ ID NO.3; the sequence of HVR2-R is shown in SEQ ID NO.4; the sequence of HVR5-F is shown in SEQ ID NO.5; and the sequence of HVR5-R is shown in SEQ ID NO.

6.

8. A conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus obtained by the method according to any one of claims 1 to 7.

9. Use of the conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus as claimed in claim 8 in the preparation of anti-tumor drugs.

10. Use of the conditionally replicative Ad5 / 35 chimeric oncolytic adenovirus as claimed in claim 8 in the preparation of oncolytic virus drugs.

Images