Acetylesterase KpACE from klebsiella pneumoniae and application

Abstract

The invention discloses an acetylesterase KpACE derived from klebsiella pneumoniae and an application of the acetylesterase KpACE. The invention researches the influence of different acetylesterases rKpACE on the viscosity of klebsiella pneumonia and finds that the acetylesterases rKpACE can reduce the viscosity of high-toxicity klebsiella pneumonia, and the reduction degree is positively correlated with the concentration. The invention also constructs strains for overexpressing different acetylesterase KpACE, and researches on the virulence of the strains show that the biofilm forming ability of the strains for overexpressing the acetylesterase KpACE is remarkably reduced, the level of killing by human serum is improved, and the survival rate of mice infected with the strains for overexpressing the acetylesterase KpACE is remarkably improved. The results show that the acetylesterase KpACE or the polysaccharide binding domain thereof or the mutant thereof provided by the invention can regulate and control the viscosity and toxicity of bacteria by regulating and controlling the deacetylation modification of the capsular polysaccharide of the bacteria, and has great value in the aspect of preparing bacterial polysaccharide vaccines or products for treating bacterial infection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to acetylesterase KpACE derived from Klebsiella pneumoniae and application thereof. Background Art

[0002] The capsular polysaccharide of bacteria is an important biomacromolecule that determines its pathogenicity. It has a complex structure and is often modified by O-acetylation. This chemical modification is of great significance to the virulence and immunogenicity of bacteria. The acetylation modification of bacterial capsular polysaccharides is mainly responsible for acetyltransferases, while acetylesterases can hydrolyze and remove acetyl groups and are the main proteases for deacetylation modification. Therefore, acetyltransferases and acetylesterases constitute the dynamic regulatory molecular mechanism of cellular acetylation modification. Acetyltransferases have been studied more, but their natural corresponding acetylesterases in cells are rarely reported.

[0003] The capsular polysaccharide on the surface of Klebsiella pneumoniae often has acetylation modification, which is closely related to virulence. The applicant has previously identified the acetyltransferase formed by it through gene knockout methods, but the mechanism of its deacetylation modification has not been reported. Studying its deacetylation modification mechanism and clarifying its corresponding acetylesterase can be used as one of the treatment options for highly toxic Klebsiella pneumoniae infections in clinical practice, which has important drug development value. Secondly, capsular polysaccharide is also the main component of bacterial polysaccharide vaccine, and its O-acetylation modification will affect its immunogenicity, so bacterial-derived acetylesterase can be used to optimize the production of polysaccharide vaccines, which has important economic value. Thirdly, the natural acetylesterase of bacteria has binding specificity for capsular polysaccharide. As a natural receptor for capsular polysaccharide, it can block capsular polysaccharide and block its biological function. It is a new substance for the development of biological reagents and new drugs. Summary of the invention

[0004] The invention aims to provide an acetylesterase KpACE derived from Klebsiella pneumoniae and its application.

[0005] In a first aspect, the present invention claims a protein.

[0006] The protein claimed in the present invention is the protein shown in a) or b) or c) or d) below:

[0007] a) the amino acid sequence is the protein shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3;

[0008] b) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3;

[0009] c) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3;

[0010] d) A protein that has 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3 and has the same function.

[0011] In the protein described in a) above, sequence 1 consists of 388 amino acid residues, and the protein with the amino acid sequence shown in sequence 1 is named acetylesterase KpACE, and the protein with the amino acid sequence shown in positions 1-135 of sequence 1 is the polysaccharide binding domain (CBM) of acetylesterase KpACE, and it is named acetylesterase KpACE CBM .

[0012] Sequence 3 consists of 384 amino acid residues, and the protein with the amino acid sequence shown in Sequence 3 is named recombinant acetylesterase rKpACE.

[0013] In the protein described in b) above, the tag refers to a polypeptide or protein fused and expressed together with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0014] In a specific embodiment of the present invention, the fusion protein is a recombinant acetylesterase rKpACE, and the recombinant acetylesterase rKpACE is an acetylesterase KpACE with a 6His tag connected to the N-terminus (here, the acetylesterase KpACE does not contain a signal peptide).

[0015] In another specific embodiment of the present invention, the fusion protein is acetylesterase KpACE or acetylesterase KpACE with 6His tag protein connected to the C-terminus. CBM

[0016] In the protein described in above c), the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0017] In a specific embodiment of the present invention, the protein is a mutant of acetylesterase KpACE obtained by mutating the histidine at position 180 of the amino acid sequence of acetylesterase KpACE to alanine, and is denoted as KpACE H180A .

[0018] In a specific embodiment of the present invention, the protein is a mutant of acetylesterase KpACE obtained by mutating the histidine at position 370 of the amino acid sequence of acetylesterase KpACE to alanine, and is denoted as KpACE H370A .

[0019] In a specific embodiment of the present invention, the protein is a recombinant acetylesterase rKpACE mutant obtained by mutating the histidine at position 176 of the amino acid sequence of the recombinant acetylesterase rKpACE to alanine, and is recorded as rKpACE H180A .

[0020] In a specific embodiment of the present invention, the protein is a recombinant acetylesterase rKpACE mutant obtained by mutating the histidine at position 366 of the amino acid sequence of the recombinant acetylesterase rKpACE to alanine, and is recorded as rKpACE H370A .

[0021] In the protein described in d) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence Cost, Per residue gap cost and Lambda ratio are set to 11, 1 and 0.85 (default values) respectively and the identity of a pair of amino acid sequences is searched and calculated, and then the value of identity (%) can be obtained.

[0022] The identity includes an amino acid sequence having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in Sequence 1 or positions 1-135 of Sequence 1 or Sequence 3 of the present invention.

[0023] The protein described in a) or b) or c) or d) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0024] In a second aspect, the present invention claims biological materials related to the above-mentioned proteins.

[0025] The biological material related to the above-mentioned protein claimed in the present invention is any one of the following A1) to A8):

[0026] A1) a nucleic acid molecule encoding the above protein;

[0027] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0028] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0029] A4) a recombinant vector containing the expression cassette described in A2);

[0030] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0031] A6) a recombinant microorganism containing the expression cassette described in A2);

[0032] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0033] A8) A recombinant microorganism containing the recombinant vector described in A4).

[0034] In the above biological material, the nucleic acid molecule described in A1) is the gene shown in 1) or 2) below:

[0035] 1) The coding sequence is a DNA molecule shown in SEQ ID NO: 2 or SEQ ID NO: 1 to 405 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 9 or SEQ ID NO: 10;

[0036] 2) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the above protein.

[0037] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0038] Those skilled in the art can easily mutate the nucleotide sequence encoding the above protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides with 75% or higher identity to the nucleotide sequence encoding the above protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the above protein and have the same function.

[0039] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in the coding sequence 1 of the present invention or the 1st to 135th position of the sequence 1 or the sequence 3. The identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0040] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0041] In the above biological materials, the expression cassette containing the nucleic acid molecule encoding the above protein described in A2) refers to a DNA capable of expressing the above protein in a host cell, and the DNA may include not only a promoter but also a terminator. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcSE9 terminator and nopaline and octopine synthase terminators.

[0042] In the above-mentioned biological material, the recombinant vector is a vector containing the above-mentioned nucleic acid molecule or the above-mentioned expression cassette that can be constructed with an existing expression vector. The vector can be a plasmid, a cosmid, a phage or a viral vector. When constructing an expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive, and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene.

[0043] In the above biological materials, the recombinant microorganism may be a microorganism containing the above nucleic acid molecule or the above expression cassette or the above recombinant vector. The microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0044] In a third aspect, the present invention claims new uses of the above-mentioned protein or the above-mentioned biological material.

[0045] The present invention claims the use of the above protein as acetyl esterase.

[0046] The present invention also claims to protect the use of the above protein as a capsular polysaccharide binding protein.

[0047] The present invention also claims to protect the use of the above biological material in preparing acetyl esterase.

[0048] The present invention also claims to protect the use of the above protein or the above biological material in regulating the deacetylation modification of bacterial capsular polysaccharides or in preparing products regulating the deacetylation modification of bacterial capsular polysaccharides.

[0049] The present invention also claims to protect the use of the above protein or the above biological material in regulating the viscosity and / or virulence of bacteria or in preparing products for regulating the viscosity and / or virulence of bacteria.

[0050] The present invention also claims to protect the use of the above protein or the above biological material in the preparation of bacterial polysaccharide vaccines.

[0051] The present invention also claims to protect the use of the above protein or the above biological material in preparing products for preventing and / or treating bacterial infections.

[0052] In the above application, the deacetylation modification of the regulated bacterial capsular polysaccharide is to increase the deacetylation modification level of the regulated bacterial capsular polysaccharide.

[0053] The regulating bacterial viscosity is to reduce the bacterial viscosity.

[0054] The regulating bacterial virulence is to reduce the bacterial virulence.

[0055] In a fourth aspect, the present invention claims protection for any one of the following methods X1)-X3):

[0056] X1) A method for increasing the deacetylation modification level of bacterial capsular polysaccharides, comprising increasing the expression level and / or activity of the above protein in bacteria or co-culturing the above protein with bacteria;

[0057] X2) A method for reducing bacterial viscosity, comprising the step of increasing the expression level and / or activity of the above protein in bacteria or co-culturing the above protein with bacteria;

[0058] X3) A method for reducing bacterial toxicity, comprising increasing the expression level and / or activity of the above protein in bacteria or co-culturing the above protein with bacteria.

[0059] In the methods described in X1) to X3) above, the method for increasing the expression level and / or activity of the above protein in bacteria may be to overexpress the above protein in bacteria.

[0060] Furthermore, the overexpression method may be to introduce the coding gene of the above protein into bacteria.

[0061] Furthermore, the gene encoding the protein may be a DNA molecule shown in SEQ ID NO: 2 or positions 1 to 405 of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 9 or SEQ ID NO: 10.

[0062] In a specific embodiment of the present invention, the protein is acetylesterase KpACE, and the coding gene of the acetylesterase KpACE is introduced into bacteria via the recombinant plasmid pACYC184-KpACE. The nucleotide sequence of the recombinant plasmid pACYC184-KpACE is shown in Sequence 8.

[0063] In a specific embodiment of the present invention, the protein is acetylesterase KpACE CBM , the acetylesterase KpACE CBM The coding gene of CBM Introduced into bacteria. Recombinant plasmid pACYC184-KpACE CBM The nucleotide sequence is the sequence obtained by deleting the DNA molecule shown at positions 1718-2476 in the nucleotide sequence of the recombinant plasmid pACYC184-KpACE shown in Sequence 8.

[0064] In a specific embodiment of the present invention, the protein is acetylesterase KpACE H180A , the acetylesterase KpACE H180A The coding gene of H180AThe recombinant plasmid pACYC184-KpACE H180A The nucleotide sequence is the sequence obtained by replacing the coding gene sequence of acetylesterase KpACE in the above-mentioned recombinant plasmid pACYC184-KpACE nucleotide sequence with the DNA molecule shown in Sequence 9.

[0065] In a specific embodiment of the present invention, the protein is acetylesterase KpACE H370A , the acetylesterase KpACE H370A The coding gene of H370A The recombinant plasmid pACYC184-KpACE H370A The nucleotide sequence is the sequence obtained by replacing the coding gene sequence of acetylesterase KpACE in the above-mentioned recombinant plasmid pACYC184-KpACE nucleotide sequence with the DNA molecule shown in Sequence 10.

[0066] In the methods described in X1) to X3) above, the method of co-culturing the above protein and bacteria may be adding the above protein to a bacterial culture system for co-cultivation.

[0067] Furthermore, the final concentration of the protein in the bacterial culture system is 0.01-0.03 mg / mL.

[0068] The co-culture conditions may be culturing at 37° C. and 180 rpm for 16-18 hours.

[0069] Furthermore, the bacterial culture system may be a bacterial liquid cultured in LB medium.

[0070] In the method described in X2), the protein may be recombinant acetyl esterase rKpACE or rKpACE H180A .

[0071] In the method described in X3), the protein may be acetyl esterase KpACE or KpACE H180A or KpACE H370A .

[0072] The reduction of bacterial virulence is manifested in reducing the biofilm formation ability of bacteria and / or increasing the level of bacteria being killed by serum (human serum) and / or increasing the survival rate of mammals (such as mice) infected with bacteria.

[0073] In any of the above-mentioned uses or methods, the bacteria may be Klebsiella pneumoniae; the Klebsiella pneumoniae may specifically be highly virulent Klebsiella pneumoniae ATCC43816.

[0074] The present invention first prepares recombinant acetylesterase rKpACE and its mutant rKpACE H180A and rKpACE H370A The enzyme activity was determined and it was found that the recombinant acetylesterase rKpACE, rKpACE H180A ,rKpACE H370A The enzyme activity efficiency was 21.4min -1 mM -1 、227.8min -1 mM -1 、4.7min -1 mM -1 Compared with the recombinant acetylesterase rKpACE, rKpACE H180A The catalytic activity increased significantly; while rKpACE H180A The activity was significantly reduced, indicating that the 370th histidine is the active site of the acetylesterase KpACE of the present invention. H370A The enzymatic hydrolysis activity of acetylated monosaccharides was determined and it was found that the recombinant acetylesterase rKpACE had deacetylation activity on acetylated Xyl, Gal, Glc, and Fuc. H370A The mutant lost the deacetylation activity for Xyl, Gal, Glc, and Fuc, further proving that the 370th histidine of the acetylesterase KpACE is the active site of the acetylesterase KpACE of the present invention. Next, the present invention studied the effects of different recombinant acetylesterase rKpACE on the viscosity of Klebsiella pneumoniae. The results showed that the recombinant acetylesterase rKpACE and rKpACE H180A It can reduce the viscosity of highly virulent Klebsiella pneumoniae ATCC43816, and the degree of reduction is positively correlated with the concentration, while rKpACE H370A Finally, the present invention also constructed strains overexpressing different acetylesterases KpACE and measured the biofilm formation ability of the strains, the survival rate of the strains resistant to human serum killing and the survival time of mice infected by the strains. The results showed that compared with the control strains, pkpACE and pkpACE H180A The biofilm formation ability was significantly reduced, pkpACE and pkpACE H180A The level of killing by serum increased, and the infected strains pkpACE and pkpACE H180A 、pkpACE H370AThe survival rate of mice was significantly improved. The above results show that the acetylesterase KpACE or its polysaccharide binding domain (CBM) or its mutant provided by the present invention can regulate bacterial viscosity and / or toxicity by regulating the deacetylation modification of bacterial capsular polysaccharides, and has great value in preparing bacterial polysaccharide vaccines or products for treating bacterial infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 The figure shows the protein electrophoresis of recombinant acetylesterase rKpACE and its mutants.

[0076] Figure 2 To determine the activity of recombinant acetylesterase rKpACE and its mutants towards acetylated substrates.

[0077] Figure 3 The effects of recombinant acetylesterase rKpACE and its mutants on the viscosity of Klebsiella pneumoniae.

[0078] Figure 4 The effect of acetylesterase KpACE and its mutants on the virulence of Klebsiella pneumoniae. DETAILED DESCRIPTION

[0079] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0080] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0081] The highly virulent Klebsiella pneumoniae ATCC43816 in the following examples is a product of the American ATCC strain library.

[0082] The vector pET28a in the following examples is a product of Novagen, with a catalog number of 69864. The vector has a coding sequence of a His tag and can express foreign proteins with a His tag.

[0083] The Escherichia coli BL21 (DE3) in the following examples is a product of Bomed Corporation (China), with the product number BC201.

[0084] The competent cells of Escherichia coli DH5α in the following examples are products of Bomed Corporation (China), with the product number BC116.

[0085] The 1,2,3,4-tetra-O-acetyl-β-D-xylopyranose (Xyl) in the following examples is a product of Beijing Kaisenlai Pharmaceutical Technology Co., Ltd., and its CAS number is 4049-33-6.

[0086] The 1,2,3,4,6-5-O-acetyl-β-D-galactopyranose (Gal) in the following examples is a product of Beijing Kaisenlai Pharmaceutical Technology Co., Ltd., and its CAS number is 4163-60-4.

[0087] The 1,2,3,4,6-5-O-acetyl-β-D-glucose (Glc) in the following examples is a product of Beijing Kaisenlai Pharmaceutical Technology Co., Ltd., with a CAS number of 604-69-3.

[0088] The 1,2,3,4-tetra-O-acetyl-α-L-fucopyranoside (Fuc) in the following examples is a product of Beijing Kaisenlai Pharmaceutical Technology Co., Ltd., with a CAS number of 64913-16-2.

[0089] The formula of the LB liquid culture medium in the following examples is as follows: 5 g yeast extract, 10 g tryptone, and 10 g sodium chloride per liter.

[0090] The formula of the LB solid medium in the following examples is as follows: 5 g yeast extract, 10 g tryptone, 10 g sodium chloride, and 15 g agar powder per liter.

[0091] The deacetylation reaction in the following examples refers to a reaction in which acetyl esterase specifically acts on ethyl ester compounds and acetylated monosaccharides to deacetylate them.

[0092] The amino acid sequence of the acetylesterase KpACE in the present invention is shown as Sequence 1 in the sequence list, and the coding gene sequence thereof is shown as Sequence 2 in the sequence list.

[0093] Example 1. Preparation of recombinant acetylesterase rKpACE and its mutants

[0094] 1. Preparation of recombinant acetylesterase rKpACE

[0095] 1. Cloning of acetylesterase gene rKpACE

[0096] Using the genomic DNA of Klebsiella pneumoniae ATCC43816 as a template, PCR amplification was performed using the upstream primer KpACE-F1 and the downstream primer KpACE-R1 to obtain a PCR product, which is the acetylesterase gene rKpACE, and its nucleotide sequence is shown in sequence 4, positions 64-1155 in the sequence table.

[0097] KpACE-F1(5'-3'):GCGCGGCAGCCATATGgcgatgccggacccaag;

[0098] KpACE-R1(5'-3'):GCTTTGTTAGCAGCCGGATCttatttaaacagtttttgcacaaactcg.

[0099] 2. Preparation of pET-28a plasmid clone

[0100] Using pET-28a plasmid as template, upstream primer pET-28a-F and downstream primer pET-28a-R were used for PCR amplification to obtain a PCR product, which was named pET-28a plasmid clone.

[0101] pET-28a-F(5'-3'):cttgggtccggcatcgcCATATGGCTGCCGCGC;

[0102] pET-28a-R(5'-3'):cgagtttgtgcaaaaactgtttaaataaGATCCGGCTGCTAACAAAGC.

[0103] 3. Preparation of recombinant plasmid

[0104] The acetylesterase gene rKpACE obtained in step 1 was cloned and fused with the pET-28a plasmid using a high-fidelity DNA assembly cloning kit (NewEngland BioLabs, catalog number E5520S) to obtain the recombinant plasmid pET-28a-KpACE. The recombinant plasmid pET-28a-KpACE can express the recombinant acetylesterase rKpACE, and the amino acid sequence of the recombinant acetylesterase rKpACE is shown in sequence 3 in the sequence table, and the coding gene sequence is shown in sequence 4 in the sequence table.

[0105] 4. Preparation of recombinant bacteria

[0106] The recombinant plasmid pET-28a-KpACE obtained in step 3 was transformed into competent cells of Escherichia coli BL21 (DE3), spread on LB plates containing 50 mg / L kanamycin, screened for strains containing the recombinant plasmid, picked single clones for PCR amplification and product sequencing, and obtained Escherichia coli BL21 (DE3) containing the recombinant plasmid pET-28a-KpACE.

[0107] 5. Expression and purification of acetylesterase rKpACE

[0108] The E. coli BL21 (DE3) containing the recombinant plasmid pET-28a-KpACE obtained in step 4 was inoculated into a liquid LB medium containing 50 mg / L kanamycin for activation. After activation, the cells were transferred to a shake flask and cultured at 37°C and 200 rpm until the OD 600nm When the pH value reaches 0.6-0.8, IPTG inducer is added to make the final concentration of IPTG inducer 0.5mM, and culture is carried out at 28°C and 200rpm for 4-6h, then centrifuged at 8000rpm for 10min, the bacteria are collected, washed three times with phosphate buffer, and then suspended with a certain volume of buffer (20mM Tris-HCl, 300mM NaCl, 20mM imidazole, pH 8.0), and ultrasonically disrupted in an ice water bath (disruption conditions: power 300W, ultrasonic disruption 3s, pause 7s for one cycle, time 60min), centrifuged at 10000rpm for 30min after ultrasonication, and the supernatant is collected. The collected supernatant was purified by Ni column affinity chromatography, and the impurities were eluted with washing buffer (20mMTris-HCl, 300mM NaCl, 50mM imidazole, pH 8.0), and the target protein was eluted with elution buffer (20mM Tris-HCl, 300mM NaCl, 250mM imidazole, pH 8.0). The purified acetylesterase rKpACE solution was subjected to SDS-polyacrylamide electrophoresis to observe the purity.

[0109] The results are as follows Figure 1 The results show that the present invention successfully expresses and obtains high-purity recombinant acetylesterase rKpACE.

[0110] 2. Recombinant acetylesterase rKpACE mutant rKpACE H180A and rKpACE H370A Preparation

[0111] 1. Preparation of recombinant plasmid

[0112] The recombinant plasmid pET-28a-KpACE in Example 1 was subjected to site-directed mutagenesis to obtain the recombinant plasmid pET-28a-rKpACE H180A . Recombinant plasmid pET-28a-rKpACE H180A To replace the rKpACE coding gene sequence (SEQ ID NO: 4) in the recombinant plasmid pET-28a-KpACE with the DNA molecule (rKpace H180A The plasmid obtained after the recombinant plasmid pET-28a-rKpACE H180A Can express recombinant acetylesterase rKpACE mutant rKpACE H180A , recombinant acetylesterase rKpACE mutant rKpACE H180AThe amino acid sequence is the sequence obtained by mutating the histidine at position 176 of sequence 3 to alanine.

[0113] The recombinant plasmid pET-28a-KpACE in Example 1 was subjected to site-directed mutagenesis to obtain the recombinant plasmid pET-28a-rKpACE H370A . Recombinant plasmid pET-28a-rKpACE H370A To replace the rKpACE coding gene sequence (SEQ ID NO: 4) in the recombinant plasmid pET-28a-KpACE with the DNA molecule (rKpACE H370A The plasmid obtained after the recombinant plasmid pET-28a-rKpACE H370A Can express recombinant acetylesterase KpACE mutant rKpACE H370A , recombinant acetylesterase KpACE mutant rKpACE H370A The amino acid sequence is the sequence obtained by mutating the histidine at position 366 of sequence 3 to alanine.

[0114] 2. Preparation of recombinant bacteria

[0115] Same as step 4 in step 1.

[0116] 3. Expression and purification of recombinant acetylesterase rKpACE mutant

[0117] Same as step 5 in step 1.

[0118] The results are as follows Figure 1 The results show that the invention successfully expresses a highly pure recombinant acetylesterase rKpACE mutant.

[0119] Example 2: Determination of the enzyme activity of recombinant acetylesterase rKpACE

[0120] 1. Determination of the enzyme activity of recombinant acetylesterase rKpACE on ethyl ester compounds

[0121] 1. Preparation of substrate solution and reaction termination solution

[0122] 100 mM 4-Methylumbelliferyl-acetate (CAS: 2747-05-9) substrate stock solution: Weigh 0.0218 g of 4-Methylumbelliferyl-acetate, dissolve it in DMSO, and make up to 1 mL.

[0123] Reaction stop solution: 50 mM citric acid (pH 2.2).

[0124] 2. Drawing of the standard curve of 4-methylumbelliferyl (CAS: 90-33-5)

[0125] Prepare 4-methylumbelliferyl solution (DMSO as solvent) with concentration gradient of 0.0005mM, 0.001mM, 0.002mM, 0.005mM, 0.01mM, 0.02mM, and measure fluorescence value at 340nm excitation light and 520nm emission light wavelength. Fit standard curve based on the relationship between fluorescence value and concentration.

[0126] 3. Determination of the optimal pH for enzyme activity

[0127] At 37°C, 60 μg of purified recombinant acetylesterase rKpACE was reacted with 4-methylumbelliferyl acetate (1 mM) in 200 μL buffers of different pH values ​​for 20 min, including 50 mM sodium citrate pH 6.0; 50 mM Tris-HCl pH 6.8; 50 mM Tris-HCl pH 8.0; 50 mM Tris-HCl pH 8.8; and 100 mM phosphate buffer pH 7.4. The pH value of the reaction solution corresponding to the highest fluorescence value was taken as the optimal pH for enzyme activity, and the fluorescence values ​​of the reactions in the other pH buffers were divided by the highest fluorescence value, and the percentage values ​​calculated were plotted.

[0128] The results are as follows Figure 2 As shown in A, the results show that the recombinant acetylesterase rKpACE prepared by the present invention exhibits obvious activity to 4-methylacetyl umbelliferyl, and the optimum pH for the enzyme activity is 7.4.

[0129] 4. Determination of enzyme activity

[0130] At 37°C, 60 μg of purified recombinant acetylesterase rKpACE and different concentrations of 4-methylumbelliferyl acetate substrate were mixed evenly in 200 μL 100 mM phosphate buffer (pH 7.4) to obtain a reaction system. The concentration gradient of 4-methylumbelliferyl acetate substrate was 0.005 mM, 0.01 mM, 0.02 mM, 0.05 mM, 0.1 mM, 0.5 mM, 1 mM, and the reaction was carried out for 20 minutes. The reaction solution was monitored at 340 nm excitation light and 520 nm emission light wavelength to monitor the fluorescence value. The enzymatic reaction curve was drawn according to the Michaelis-Menten equation, and the enzyme catalytic efficiency (Kcat / Km) was calculated.

[0131] The activity of an enzyme is defined as the amount of enzyme required to decompose the substrate to produce 1 nmol of product per minute under certain reaction conditions.

[0132] The results are as follows Figure 2 B. The results show that the Michaelis constant Km of the acetyl esterase rKpACE prepared by the present invention is 0.16±0.03 mM.

[0133] The results are as follows Figure 2C. The results showed that recombinant acetylesterase rKpACE, rKpACE H180A ,rKpACE H370A The enzyme activity efficiency was 21.4min -1 mM -1 、227.8min -1 mM -1 、4.7min -1 mM -1 Compared with the recombinant acetylesterase rKpACE, the recombinant acetylesterase mutant rKpACE prepared by the present invention H180A The catalytic activity increased significantly; while rKpACE H180A The activity was significantly reduced, indicating that the histidine at position 370 is the active site of the acetylesterase KpACE of the present invention.

[0134] 2. Determination of the enzymatic hydrolysis activity of recombinant acetylesterase rKpACE on acetylated monosaccharides

[0135] 1. Acetylated monosaccharide samples

[0136] The acetylated monosaccharide samples were as follows: 1,2,3,4-tetra-O-acetyl-β-D-xylopyranose (Xyl), 1,2,3,4,6-5-O-acetyl-β-D-galactopyranose (Gal), 1,2,3,4,6-5-O-acetyl-β-D-glucose (Glc), and 1,2,3,4-tetra-O-acetyl-α-L-fucopyranoside (Fuc).

[0137] 2. Determination of the activity of recombinant acetylesterase rKpACE on acetylated monosaccharides

[0138] The acetic acid assay kit (Megazyme, K-ACETRM 04 / 20) was used to measure the activity of recombinant acetylesterase rKpACE and mutant rKpACE. H370A The activity of acetylated monosaccharides was tested, and no acetyl esterase was used as a control group (Mock). The specific steps are as follows: 2mM acetylated monosaccharides were taken as reaction substrates, 100mM phosphate buffer (pH7.4) was used as reaction buffer, 20μg purified acetyl esterase was added, and the reaction was catalyzed at 37°C for 2h. Then the amount of acetic acid released by the reaction was detected using an acetic acid determination kit (g / L), and the amount of acetic acid released per mM monosaccharide was calculated (μg / mM). The method for detecting the amount of acetic acid released is as follows: Take 10μL of supernatant in a UV capable 96-well flat plate and add 200μL of water. Then add 30μL of solution 1, 20μL of solution 2, 2μL of solution 3 and 2μL of solution 4 in sequence, mix well and read the absorbance value A1 at 340nm. Add solution 5 and mix well. Read the absorbance value A2 at 340nm for more than 4 minutes. The sample △A 样品=A2-A1. Each time a sample is tested, the same steps are used to test the standard solution 6. The standard solution △A 标准品 =A2-A1. The amount of acetic acid released in the sample is calculated using the following formula:

[0139] g / L=(△A 样品 / △A 标准品 )╳Concentration of standard substance (g / L).

[0140] The results are as follows Figure 2 As shown in D, the results show that compared with the control group, the acetic acid release of the experimental group added with recombinant acetylesterase rKpACE was significantly increased, indicating that the recombinant acetylesterase rKpACE of the present invention has deacetylation activity on acetylated Xyl, Gal, Glc, and Fuc. H370A The acetic acid release of the mutant experimental group did not change, indicating that the recombinant acetylesterase mutant rKpACE of the present invention H370A It loses the deacetylation activity to Xyl, Gal, Glc and Fuc, and the 370th histidine is the active site of the acetylesterase KpACE of the present invention.

[0141] Example 3: Effect of recombinant acetylesterase rKpACE on the viscosity of Klebsiella pneumoniae

[0142] 1. Effects of different recombinant acetylesterases rKpACE on the viscosity of Klebsiella pneumoniae

[0143] The experiment was divided into three groups as follows:

[0144] rKpACE: Recombinant acetylesterase rKpACE (final concentrations were 0.01 mg / mL, 0.02 mg / mL, and 0.03 mg / mL, respectively) was added to 5 mL of LB medium cultured highly virulent Klebsiella pneumoniae ATCC43816 culture liquid (OD 600nm =0.02), and cultured at 37°C and 180 rpm for 16-18 h to obtain a cultured bacterial liquid.

[0145] ikB H180A :Recombinant acetylesterase rKpACE mutant rKpACE H180A 5 mL of LB medium cultured highly virulent Klebsiella pneumoniae ATCC43816 (OD 600nm =0.02), and cultured at 37°C and 180 rpm for 16-18 h to obtain a cultured bacterial liquid.

[0146] ikB H370A:Recombinant acetylesterase rKpACE mutant rKpACE H370A 5 mL of LB medium cultured highly virulent Klebsiella pneumoniae ATCC43816 (OD 600nm =0.02), and cultured at 37°C and 180 rpm for 16-18 h to obtain a cultured bacterial liquid.

[0147] After the culture is completed, measure the OD of the culture solution 600nm Absorbance (total OD 600nm ), then centrifuge the cultured bacterial solution at 1000 g for 10 min, take the supernatant and measure OD 600nm Absorbance (OD 600nm ), the viscosity index of bacteria was calculated according to the following formula: supernatant OD 600nm / Total OD 600nm , and draw a concentration-viscosity curve.

[0148] The results are as follows Figure 3 As shown. The recombinant acetylesterase rKpACE and rKpACE prepared by the present invention H180A It can reduce the viscosity of highly virulent Klebsiella pneumoniae ATCC43816, and the degree of reduction is positively correlated with the concentration. H370A Unable to reduce the viscosity of highly virulent Klebsiella pneumoniae ATCC43816.

[0149] Example 4: Determination of the toxicity of acetylesterase KpACE to Klebsiella pneumoniae

[0150] 1. Construction of ATCC43816 strain pKpACE overexpressing acetylesterase KpACE or its mutants

[0151] 1. Cloning of the acetylesterase gene KpACE

[0152] Using the genomic DNA of Klebsiella pneumoniae ATCC43816 as a template, PCR amplification was performed using the upstream primer KpACE-F2 and the downstream primer KpACE-R2 to obtain a PCR product, which is the acetylesterase gene KpACE, and the nucleotide sequence of its open reading frame is shown in Sequence 2 in the sequence table. The primer sequences are as follows:

[0153] KpACE-F2(5'-3'):cctaaaattctgcgtcctcataatgtggtaagacgataactgaacg;

[0154] KpACE-R2(5'-3'):ctaGTGATGGTGATGGTGATGtttaaacagtttttgcacaaactcg.

[0155] 2. Obtaining pACYC184-PrpsL plasmid clone 1

[0156] Using pACYC184-PrpsL plasmid (the nucleotide sequence of pACYC184-PrpsL plasmid is shown in Sequence 7 in the sequence table) as a template, PCR amplification was performed using upstream primer pACYC184-F1 and downstream primer pACYC184-R1 to obtain a PCR product, which was named pACYC184-PrpsL plasmid clone 1. The primer sequences are as follows:

[0157] pACYC184-F1(5'-3'): cgagtttgtgcaaaaactgtttaaaCATCACCATCACCATCACtag;

[0158] pACYC184-R1(5'-3'): cgttcagttatcgtctttaccacattatgaggacgcagaattttagg.

[0159] 3. Acetylesterase gene KpACE polysaccharide binding domain (Carbohydrate Binding Module Family 48, CBM) KpACE CBM Clone

[0160] Using the genomic DNA of Klebsiella pneumoniae ATCC43816 as a template, PCR amplification was performed using the upstream primer KpACE-F2 (same as in step 1) and the downstream primer KpACE-R3 to obtain a PCR product, which is the nucleotides 1 to 405 of the acetylesterase gene KpACE, and the nucleotide sequence of its open reading frame is shown in the nucleotides 1 to 405 of sequence 2 in the sequence table. The primer sequences are as follows:

[0161] KpACE-F2(5'-3'):cctaaaattctgcgtcctcataatgtggtaagacgataactgaacg;

[0162] KpACE-R3(5'-3'):ctaGTGATGGTGATGGTGATGccgatcgtcaagaatactgcc.

[0163] 4. Obtaining pACYC184-PrpsL plasmid clone 2

[0164] Using pACYC184-PrpsL plasmid as template, upstream primer pACYC184-F2 and downstream primer pACYC184-R2 were used for PCR amplification to obtain a PCR product, which was named pACYC184-PrpsL plasmid clone 2. The primer sequences are as follows:

[0165] pACYC184-F2(5'-3'):ggcagtattcttgacgatcggCATCACCATCACCATCACtag;

[0166] pACYC184-R2(5'-3'):cgttcagttatcgtctttaccacattatgaggacgcagaattttagg.

[0167] 5. Preparation of recombinant plasmid

[0168] The acetylesterase gene KpACE obtained in step 1 was fused with the pACYC184-PrpsL plasmid clone 1 obtained in step 2 using a high-fidelity DNA assembly cloning kit (New England BioLabs, catalog number E5520S) to obtain the recombinant plasmid pACYC184-KpACE. The nucleotide sequence of the recombinant plasmid pACYC184-KpACE is shown in sequence 8, and the plasmid can express the acetylesterase KpACE with a 6His tag protein at the C-terminus, and the amino acid sequence of the acetylesterase KpACE is shown in sequence 1 in the sequence table.

[0169] The recombinant plasmid pACYC184-KpACE was obtained by site-directed mutagenesis. H180A and pACYC184-KpACE H370A .

[0170] Recombinant plasmid pACYC184-KpACE H180A The nucleotide sequence is obtained by replacing the DNA molecule (cat) shown at positions 1850-1852 in the nucleotide sequence of the recombinant plasmid pACYC184-KpACE shown in Sequence 8 with gct. H180A A mutant of acetylesterase KpACE with a 6His tag at the C-terminus can be expressed H180A The acetylesterase KpACE mutant KpACE with a 6His tag at the C-terminus H180A The coding gene sequence is shown as Sequence 9 in the sequence listing.

[0171] Recombinant plasmid pACYC184-KpACE H370AThe nucleotide sequence is obtained by replacing the DNA molecule (cat) shown at positions 2420-2422 in the nucleotide sequence of the recombinant plasmid pACYC184-KpACE shown in Sequence 8 with gct. H370A Can express acetylesterase KpACE mutant KpACE with 6His tag protein at C-terminus H370A The acetylesterase KpACE mutant KpACE with a 6His tag at the C-terminus H370A The coding gene sequence is shown as Sequence 10 in the sequence listing.

[0172] The acetylesterase gene KpACE fragment KpACE obtained in step 3 CBM The recombinant plasmid pACYC184-KpACE was obtained by fusion with the pACYC184-PrpsL plasmid clone 2 obtained in step 4 using a high-fidelity DNA assembly cloning kit (New England BioLabs, catalog number E5520S). CBM . Recombinant plasmid pACYC184-KpACE CBM The nucleotide sequence is the sequence obtained by deleting the DNA molecule shown at positions 1718-2476 in the nucleotide sequence of the recombinant plasmid pACYC184-KpACE shown in Sequence 8. CBM Can express acetylesterase KpACE with 6His tag at the C-terminus CBM , acetylesterase KpACE CBM The amino acid sequence is shown in sequence 1, positions 1-135 in the sequence listing.

[0173] 6. Preparation of recombinant bacteria

[0174] The recombinant plasmid pACYC184-KpACE obtained in step 5 was transformed into competent cells of Escherichia coli DH5α, and coated on LB plates containing 100 mg / L spectinomycin to screen strains containing the recombinant plasmid, and single clones were selected for PCR amplification and product sequencing to obtain Escherichia coli DH5α containing the recombinant plasmid pACYC184-KpACE. The recombinant plasmid pACYC184-KpACE extracted from Escherichia coli DH5α was electroporated into the Klebsiella pneumoniae ATCC43816 strain to obtain the ATCC43816 strain overexpressing the acetylesterase KpACE, which was recorded as pkpACE.

[0175] According to the same method, the recombinant plasmid pACYC184-KpACE H180A , pACYC184-KpACE H370A and pACYC184-KpACECBM The overexpressed acetylesterase mutant KpACE was obtained by introducing it into Klebsiella pneumoniae ATCC43816 strain. H180A , KpACE H370A and KpACE CBM ATCC43816 strain, and were respectively denoted as pkpACE H180A 、pkpACE H370A and pkpACE CBM .

[0176] The pACYC184-PrpsL plasmid was introduced into the Klebsiella pneumoniae ATCC43816 strain to obtain the ATCC43816 strain containing the pACYC184-PrpsL plasmid as a control, which was recorded as vector.

[0177] 2. Determination of the biofilm-forming ability of strains

[0178] The strains pKpACE and pKpACE obtained in step 1 were respectively H180A ,pKpACE H370A ,pKpACE CBM The biofilms were grown in 96-well plates containing LB medium containing 5% glucose, and the inoculum size was 10 6 CFU / mL, the growth condition was static growth in a 37°C incubator for 24 hours, and the crystal violet staining method was used to detect the biofilm formation ability after the culture. The specific steps refer to the method in the literature "Heiden SE, Hübner NO, Bohnert JA, Heidecke CD, Kramer A, Balau V, et al. A Klebsiella pneumoniae ST307 outbreak clone from Germany demonstrates features of extensive drug resistance, hypermucoviscosity, and enhanced iron acquisition. Genome Med. 2020; 12(1): 113."

[0179] The results are as follows Figure 4 A. The results show that compared with vector, pkpACE and pkpACE H180A The biofilm formation ability was significantly reduced, indicating that kpACE and kpACE H180A Both can reduce the biofilm formation ability of highly virulent Klebsiella pneumoniae ATCC43816, and KpACE with enzyme activity can degrade biofilm.H370A and pkpACE CBM The biofilm formation ability was significantly improved, indicating that KpACE H370A and kpACE CBM Both can improve the biofilm formation ability of highly virulent Klebsiella pneumoniae ATCC43816, and KpACE without enzyme activity H370A Mutants and KpACE with only the polysaccharide binding domain CBM It has the biological function of promoting biofilm formation, which may be caused by binding to polysaccharides in the biofilm matrix.

[0180] 3. Determination of the killing ratio of strains resistant to human serum

[0181] Normal human serum: normal human serum (normal human serum is the mixed serum from apparently healthy people who underwent health examinations at a physical examination center) was prepared into a 25% serum working solution using phosphate buffer (pH 7.4).

[0182] The strains pkpACE and pkpACE obtained in step 1 were respectively H180A 、pkpACE H370A The vector and 20% normal human serum were mixed to obtain a phosphate buffer bacterial suspension with a bacterial concentration of about 10 6 CFU / mL, incubate at 37℃ for 1 hour and detect the killing ratio of strains resistant to human serum according to the following method:

[0183] 1. Add 40 μL of phosphate buffered saline bacterial suspension (10 6 CFU / ml) was mixed with 160 μL of 25% serum working solution and added to a 96-well flat-bottom microplate. At this time, 20 μL of bacterial suspension was taken for bacterial counting, which was the 0-h value.

[0184] 2. Place the 96-well plate at 37°C for 1 hour of static growth, mix well, and take 20 μL of the bacterial suspension for bacterial count, which is the 1-hour value.

[0185] 3. Calculate the human serum killing survival rate of bacteria according to the following formula: 1-h value / 0-h value.

[0186] The results are as follows Figure 4 B. The strains pkpACE and pkpACE prepared by the present invention H180 The level of killing by serum increased, indicating that kpACE and kpACE H180 It can improve the level of killing of highly virulent Klebsiella pneumoniae ATCC43816 by serum. H370A No change.

[0187] IV. Determination of survival time of mice after infection with strains

[0188] Test mice: CD1 female mice aged 6-8 weeks (Beijing Weitonglihua Experimental Animal Technology Co., Ltd.).

[0189] The strains pkpACE and pkpACE obtained in step 1 were respectively H180A 、pkpACE H370A The lung infection model was formed by nasal inhalation of the vector into mice. There were at least 12 mice in each group. The strain inhalation volume was 2000 CFU, and the survival time of the mice after infection was tested.

[0190] The results are as follows Figure 4 C. Compared with vector, the infection strains pkpACE and pkpACE H180A 、pkpACE H370A The survival rate of mice was significantly improved, indicating that kpACE, kpACE H180A and kpACE H370A Both can reduce the virulence of mice infected with Klebsiella pneumoniae ATCC43816. At the same time, it shows that there are other mechanisms for reducing virulence besides enzyme activity, such as KpACE CBM polysaccharide binding function.

[0191] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, wherein the protein is a protein as shown in a) or b) or c) or d) below: a) the amino acid sequence is the protein shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3; b) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3; c) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3; d) A protein that has 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or positions 1 to 135 of SEQ ID NO: 1 or SEQ ID NO: 3 and has the same function.

2. The biological material related to the protein according to claim 1, which is any one of the following A1) to A8): A1) a nucleic acid molecule encoding the protein according to claim 1; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4).

3. The biomaterial according to claim 2, characterized in that: A1) The nucleic acid molecule is the gene shown in 1) or 2) below: 1) The coding sequence is a DNA molecule shown in SEQ ID NO: 2 or SEQ ID NO: 1 to 405 or SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 9 or SEQ ID NO: 10; 2) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the protein of claim 1.

4. Use of the protein according to claim 1 as an acetylesterase; Or, use of the protein according to claim 1 as a capsular polysaccharide binding protein; Or, use of the biomaterial according to claim 2 or 3 in the preparation of acetyl esterase.

5. Use of the protein according to claim 1 or the biomaterial according to claim 2 or 3 in regulating the deacetylation modification of bacterial capsular polysaccharides; Or, use of the protein according to claim 1 or the biomaterial according to claim 2 or 3 in the preparation of a product for regulating the deacetylation modification of bacterial capsular polysaccharides.

6. Use of the protein according to claim 1 or the biomaterial according to claim 2 or 3 in regulating the viscosity and / or virulence of bacteria; Or, use of the protein according to claim 1 or the biomaterial according to claim 2 or 3 in the preparation of a product for regulating bacterial viscosity and / or virulence.

7. Use of the protein according to claim 1 or the biological material according to claim 2 or 3 in the preparation of bacterial polysaccharide vaccines.

8. Use of the protein according to claim 1 or the biomaterial according to claim 2 or 3 in the preparation of a product for preventing and / or treating bacterial infection.

9. Any of the following methods 1)-3): X1) A method for increasing the deacetylation modification level of bacterial capsular polysaccharides, comprising increasing the expression level and / or activity of the protein of claim 1 in bacteria or co-culturing the protein of claim 1 with bacteria; X2) A method for reducing bacterial viscosity, comprising increasing the expression level and / or activity of the protein of claim 1 in bacteria or co-culturing the protein of claim 1 with bacteria; X3) A method for reducing bacterial toxicity, comprising increasing the expression level and / or activity of the protein of claim 1 in bacteria or co-culturing the protein of claim 1 with bacteria.

10. The use according to any one of claims 5 to 8 or the method according to claim 9, characterized in that: The bacteria is Klebsiella pneumoniae.

Images