MicroRNA from extracellular vesicles of clonorchis sinensis and application of MicroRNA in cholangiocarcinoma caused by clonorchis sinensis

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to MicroRNA derived from clonorchis sinensis extracellular vesicles and application of MicroRNA in cholangiocarcinoma caused by clonorchis sinensis. According to the invention, CsEVs are extracted from a clonorchis sinensis adult supernatant, the CsEVs are sequenced, Csi-miR-190-3p is finally screened as a research object, and the Csi-miR-190-3p is proved to be capable of inhibiting migration and invasion of RBE cells in vitro; the target gene of the Csi-miR-190-3p is CXCL5, and the inhibition effect is relieved after the Csi-miR-190-3p and CXCL5 plasmids are co-transfected, so that the Csi-miR-190-3p derived from the clonorchis sinensis extracellular vesicles is expected to provide a new direction for preparing the medicine for treating the cholangiocarcinoma induced by the clonorchis sinensis.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to MicroRNA derived from extracellular vesicles of Clonorchis sinensis and application thereof in cholangiocarcinoma caused by Clonorchis sinensis. Background Art

[0002] Clonorchiasis is a major public health problem that poses a huge threat to the health of people in endemic areas. Epidemiological studies have confirmed that infection with Clonorchiasis is closely related to the incidence of bile duct cancer. Based on this, the International Agency for Research on Cancer (IARC) classified Clonorchiasis as a Class I carcinogen in 2009.

[0003] At present, the mechanism of hepatobiliary cancer caused by Clonorchis sinensis infection is still unclear. The reasons are speculated to be mechanical stimulation of the parasite, stimulation of parasite metabolites, abnormal host immune response, mixed infection and combined effects of multiple factors. Since cholangiocarcinoma still lacks effective early diagnosis, markers for judging the course of the disease and highly effective anti-tumor drugs, the five-year survival rate of cholangiocarcinoma patients is only about 5%. With the development of tumor biology and cell molecular biology, finding specific molecules involved in the pathogenesis of hepatobiliary cancer and their mechanisms of action has gradually become the focus of scholars.

[0004] The latest research results of Professor Kuang Ming's team at Zhongshan First Hospital (FASN-mediated fatty acid biosynthesis remodels immune environment in Clonorchis sinensis infection-related intrahepatic cholangiocarcinoma [J]. Journal of Hepatology [2024-10-14]. DOI: 10.1016 / j.jhep.2024.03.016.) show that infection with Clonorchis sinensis can significantly shorten the survival of patients with intrahepatic cholangiocarcinoma and inhibit the patient's response to immunotherapy. The expression of fatty acid biosynthesis and fatty acid synthase in patients with cholangiocarcinoma with Clonorchis sinensis infection is significantly upregulated, which in turn causes macrophages to polarize into tumor-associated macrophages and inhibits the tumor killing function of CD8+T cells, leading to the formation of an immunosuppressive microenvironment and malignant progression of tumors. The combined use of FASN inhibitors can enhance the efficacy of PD-1 antibodies and more effectively treat cholangiocarcinoma with Clonorchis sinensis infection. The above research background shows that infection with Clonorchis sinensis can not only induce the occurrence of cholangiocarcinoma, but also affect the prognosis and clinical treatment options of cholangiocarcinoma patients. Therefore, the study of the pathogenic mechanism of Clonorchis sinensis has important scientific significance and clinical value.

[0005] In recent years, the role of extracellular vesicles, subcellular components secreted by cells, in the pathogenesis of parasites has received extensive attention. Extracellular vesicles can protect the biologically active substances inside them from being degraded and diluted in the extracellular environment, and can be transported over long distances through blood or tissue fluid, mediating information exchange between cells, and are an important pathway for pathogen-host interaction. It has been found that many parasitic protozoa and worms such as Plasmodium, Toxoplasma gondii, Leishmania, Schistosoma, Opisthorchis civetus, and Clonorchis sinensis can secrete extracellular vesicles, and regulate the host immune microenvironment by transmitting worm-derived virulence factors, leading to infection and pathogenicity. Among them, MicroRNAs are a group of highly conserved small RNA molecules that play an important role in post-transcriptional gene regulation. In 2021, Professor Yan Chao's team from Xuzhou Medical University confirmed for the first time that CsEVs exist in the supernatant of adult Clonorchis sinensis culture, and can promote bile duct injury and macrophage M1 polarization in vivo and in vitro by delivering Csi-let-7a-5p, inducing a pro-inflammatory microenvironment, and revealing a new mechanism for bile duct injury caused by Clonorchis sinensis infection (Yan C, Zhou QY, Wu J, et al. Csi-let-7a-5p delivered by extracellular vesicles from a liver fluke activates M1-like macrophages and exacerbates biliary injuries [J]. Proceedings of the National Academy of Sciences, 2021, 118 (46): e2102206118.). However, the role of CsEVs in the malignant progression of cholangiocarcinoma caused by Clonorchis sinensis has not been fully elucidated. Therefore, it is necessary to further study whether extracellular vesicles of Clonorchis sinensis can help treat cholangiocarcinoma induced by Clonorchis sinensis. Summary of the invention

[0006] In order to overcome the shortcomings of the above-mentioned prior art, the present invention successfully extracted CsEVs from the supernatant of adult Clonorchis sinensis, and screened out a MicroRNA, namely Csi-miR-190-3p, which can inhibit the migration and invasion of cholangiocarcinoma cells in vitro, and is expected to provide a new direction for the preparation of drugs for the treatment of cholangiocarcinoma induced by Clonorchis sinensis.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides the use of a reagent for overexpressing MicroRNA derived from extracellular vesicles of Clonorchis sinensis in RBE cells in the preparation of a drug for resisting cholangiocarcinoma caused by Clonorchis sinensis, wherein the consensus mature sequence of the MicroRNA is shown in SEQ ID NO.1, and the Mimic sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] Preferably, the drug against cholangiocarcinoma caused by Clonorchis sinensis is a drug that inhibits RBE cell migration.

[0010] More preferably, the anti-cholangiocarcinoma drug caused by Clonorchis sinensis is a drug that inhibits the longitudinal and / or lateral migration of RBE cells.

[0011] Preferably, the reagent for overexpressing the MicroRNA derived from the extracellular vesicles of Clonorchis sinensis in RBE cells comprises the MicroRNA shown in SEQ ID NO.2 and SEQ ID NO.3 and a liposome transfection reagent.

[0012] The second aspect of the present invention provides a drug for preventing bile duct cancer caused by Clonorchis sinensis, characterized in that the drug uses as a main active ingredient an agent for overexpressing the MicroRNA shown in SEQ ID NO.2 and SEQ ID NO.3 in RBE cells.

[0013] Preferably, the drug further comprises a pharmaceutically acceptable carrier.

[0014] Furthermore, the carrier is an acceptable functional pharmaceutical excipient in the pharmaceutical field, including surfactants, suspending agents, emulsifiers and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid polylactic acid copolymer (PLGA), hyaluronic acid, etc. It may also include excipients such as diluents, adhesives, lubricants, disintegrants, cosolvents, stabilizers, etc.

[0015] Preferably, the dosage form of the drug includes tablets, capsules, powders, granules and liquids. The drug preparation can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention extracts CsEVs from the supernatant of adult Clonorchis sinensis, sequences the CsEVs, and finally screens out Csi-miR-190-3p as a research object; cell migration experiments, cell invasion experiments, cell scratch experiments, etc. confirm that Csi-miR-190-3p can inhibit the migration and invasion of RBE cells in vitro; in addition, luciferase reporter gene experiments, etc. confirm that the target gene of Csi-miR-190-3p for inhibiting the migration and invasion of RBE cells is CXCL5, and this inhibitory effect is alleviated after co-transfection with CXCL5 plasmid, indicating that Csi-miR-190-3p derived from extracellular vesicles of Clonorchis sinensis is expected to provide a new direction for the preparation of drugs for treating cholangiocarcinoma induced by Clonorchis sinensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 For the isolation, purification and identification of extracellular vesicles of Clonorchis sinensis;

[0019] Figure 1 In the figure, (A) Adult Clonorchis sinensis collected from the liver of an infected cat; (B) Morphological identification of CsEVs by negative staining transmission electron microscopy, showing typical vesicle structure, scale bar: 200 nm; (C) Nanosight NS300 analyzer was used to identify the diameter and size distribution of CsEVs.

[0020] Figure 2 The sequencing results of miRNA in extracellular vesicles of Clonorchis sinensis;

[0021] Figure 2 (A) The main miRNA species in CsEV; (B) The ranking of the main miRNA contents in CsEV.

[0022] Figure 3 Function and signaling pathway analysis of the top 10 miRNA target genes in CsEV.

[0023] Figure 3A.C. GO analysis of the top 10 miRNA target genes in CsEV; the three figures are biological process (BP), cellular component (CC) and molecular function (MF), the ordinate is the enriched GO term, the abscissa is -log10 (P-value), indicating the significance of enrichment, and the color from blue to red indicates that the number of target genes in the term is from small to large; D. KEGG analysis of the top 10 miRNA target genes in CsEV; the ordinate indicates the enriched signal pathway, the abscissa indicates the Rich Factor, and the larger the Rich Factor, the higher the degree of enrichment; the size of the dot indicates the number of target genes in this signal pathway, and the color of the dot corresponds to different P value ranges, and the P value from low to high indicates that the significance of enrichment is from high to low.

[0024] Figure 4 It is the Csi-miR-190-3p sequence (the red mark is the Consensus mature sequence).

[0025] Figure 5 This is a diagram showing the research on the biological function of Csi-miR-190-3p on cholangiocarcinoma cells.

[0026] Figure 6 Csi-miR-190-3p was overexpressed in RBE cells after transfection. RT-qPCR experiments were used to detect the background expression value of Csi-miR-190-3p in RBE cells and the overexpression after transfection of mimics. The Scramble mimic (miR-NC) group was the negative control. ****P<0.0001.

[0027] Figure 7 Overexpression of Csi-miR-190-3p inhibited the longitudinal migration ability of RBE cells. Migration and invasion experiments were used to detect the effect of Csi-miR-190-3p on the longitudinal migration of cholangiocarcinoma cells. The miR-NC group served as the negative control, ****P<0.0001.

[0028] Figure 8 Overexpression of Csi-miR-190-3p inhibited the lateral migration ability of RBE cells. The scratch assay was used to detect the effect of Csi-miR-190-3p on the lateral migration of cholangiocarcinoma cells, and the miR-NC group was the negative control, ***P<0.001.

[0029] Fig. 9 It is the target gene at the intersection of TargetScan 7.0, miRDB, and miRTarBase databases.

[0030] Fig.10 (A) Luciferase reporter gene experiment for Csi-miR-190-3p target gene verification; (B) Western blotting experiment; (C) q-PCR experiment; (D) Schematic diagram of binding sites.

[0031] Fig.11 Csi-miR-190-3p inhibits the longitudinal migration of RBE cells by regulating CXCL5.

[0032] Fig.12 Csi-miR-190-3p inhibits the lateral migration of RBE cells by regulating CXCL5. DETAILED DESCRIPTION

[0033] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0034] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0035] Example 1: Isolation, purification, identification and miRNA analysis of extracellular vesicles of Clonorchis sinensis

[0036] 1. Experimental methods:

[0037] 1.1. Collection and culture of adult Clonorchis sinensis

[0038] (1) Domestic cats infected with Clonorchis sinensis were purchased from the Guangzhou Experimental Animal Farm. The domestic cats mainly came from the suburbs of Guangzhou and Foshan, including abandoned domestic cats from villagers and stray domestic cats. The domestic cats were anesthetized and their livers were removed by dissection.

[0039] (2) Use manual finger pressure to squeeze from the edge of the liver of the positive cat toward the common bile duct, pick up piles or single adults, and place them in a PBS culture dish containing 10% double antibody. Observe the morphological characteristics of adults and eggs under a light microscope to confirm that the obtained worm is Clonorchis sinensis, and then collect adults with complete morphology and good vitality.

[0040] (3) Continue to rinse the worms five times with sterile PBS containing 5% double antibody.

[0041] (4) Add 2 mL of DMEM medium containing 1% double antibody to each well of a 6-well cell culture plate, and transfer 20 to 30 adult worms of Clonorchis sinensis to the cell culture plate.

[0042] (5) Cultivate the cells in a cell culture incubator at 37°C and 5% CO2, change the medium every day, and remove dead worms promptly.

[0043] (6) Collect the supernatant of adult worm culture and store it in a 4°C refrigerator for later use.

[0044] 1.2 Isolation and purification of extracellular vesicles of Clonorchis sinensis

[0045] The extracellular vesicles of Clonorchis sinensis were separated and purified by ultracentrifugation. The specific steps are as follows:

[0046] (1) The culture supernatant of adult Clonorchis sinensis obtained above was centrifuged at 1,500 g at 4°C for 30 min, the precipitate was removed, and the supernatant was collected.

[0047] (2) Centrifuge the supernatant obtained in the previous step at 3,500 g for 30 min at 4°C, remove the precipitate, and collect the supernatant.

[0048] (3) The supernatant obtained in the previous step was centrifuged at 12,000 g for 30 min at 4°C, the precipitate was removed, and the supernatant was collected.

[0049] (4) The supernatant obtained in the previous step was centrifuged at 20,000 g for 1 h at 4°C to remove the precipitate, and the supernatant was collected and filtered through a 0.22 μm PES filter membrane.

[0050] (5) The supernatant obtained in the previous step was transferred to a thick-walled centrifuge tube specially used for an ultracentrifuge, and centrifuged at 120,000 g for 70 min at 4°C. The supernatant was removed and the precipitate was collected to obtain CsEVs.

[0051] (6) The precipitate obtained in the previous step was resuspended in sterile PBS and centrifuged at 4°C, 120,000g for 70 min to further purify CsEVs. Finally, the supernatant was removed and the precipitate was resuspended in sterile PBS to obtain a CsEV suspension. The protein concentration was determined using the BCA method and the aliquots were stored at 4°C for short-term storage and at -80°C for long-term storage.

[0052] 1.3 Identification of extracellular vesicles of Clonorchis sinensis

[0053] (1) Observation of the size and morphology of CsEVs using a transmission electron microscope (TEM): 20 μL of fresh CsEV suspension was added to a copper mesh carbon support membrane with a pore size of 120 μm, and allowed to stand at room temperature for 3 min. The excess liquid was removed with filter paper. 10 μL of 3% phosphotungstic acid staining solution was added for negative staining for 1 to 2 min, and the excess liquid was removed with filter paper. After drying at room temperature, the copper mesh was placed on the sample holder of a transmission electron microscope, and observed under a transmission electron microscope and an image was collected.

[0054] (2) Nanoparticle tracking analysis (NTA) was used to analyze the particle size distribution and concentration of CsEVs: ddH2O was slowly injected into the sample chamber using a 1 mL syringe and placed on the nanoparticle tracking analyzer for detection and zeroing. Then 10 μL of CsEV suspension was drawn and diluted to 1,000 μL with ddH2O at a ratio of 1:100. The diluted sample was evenly injected into a clean sample chamber and placed on the nanoparticle tracking analyzer for detection, and repeated three times. The vesicle particle size distribution and particle concentration were analyzed using NTA3.3software.

[0055] 1.4 Analysis of extracellular vesicle miRNAs in Clonorchis sinensis

[0056] (1) The analysis of miRNA was performed by Guangzhou Chengqi Biotechnology Co., Ltd. After sequencing, the cutadapt software was used to remove the adapters at both ends of the reads, and the reads with a length between 18-35nt after trimming were retained. At the same time, the reads with an N base ratio of more than 10% were removed to obtain clean reads for subsequent analysis. Based on the typical hairpin structure of the miRNA precursor, miRDeep2 software was used to predict miRNA. First, the clean reads obtained above were compared with the known transcripts of the species to filter out the fragments of the known RNA; compared with the Rfam database to filter out other types of RNA, etc.; then the screened data were compared with the mature and original sequences in the miRBase database to obtain possible homologous miRNAs to assist the prediction work of the miRDeep2 software.

[0057] (2) miRNA quantitative analysis: bowtie (v1.3.0 parameter: -v0) was used to compare the clean data with the predicted miRNA to obtain the expression level of each miRNA. The expression level was normalized using RPM (RPM = readCount*1000000 / libsize, libsize: sum of mapped readCount), which is the number of reads from a gene per million reads.

[0058] (3) miRNA target gene analysis: miRanda (v3.3a, parameter -en-10) was used to perform target gene analysis on the predicted miRNA to obtain the possible target genes of miRNA.

[0059] (4) Target gene GO enrichment analysis: GO is divided into three parts: molecular function, biological process and cellular composition. Through the corresponding ID or sequence annotation, the GO number associated with the gene or protein is found. These GO numbers can be mapped to the corresponding terms, i.e., functional categories or cellular localization. This study performed this analysis on the target genes of the top 10 miRNAs with the highest expression levels detected. The analysis software was topGO, and the statistical test method was Fisher's Exact Test.

[0060] (5) KEGG Pathway enrichment analysis of target genes: KEGG Pathway enrichment analysis can be used to determine the main biochemical metabolic pathways and signal transduction pathways involved in the target genes. In this study, KEGG Pathway enrichment analysis was performed on the target genes of the predicted top 10 miRNAs. The analysis software was clusterProfiler, and the statistical test method was HypergeometricTest.

[0061] 2. Experimental results

[0062] 2.1. Acquisition and sequencing analysis of extracellular vesicles of Clonorchis sinensis

[0063] (1) Collection of extracellular vesicles of Clonorchis sinensis

[0064] In order to obtain extracellular vesicles of Clonorchis sinensis, adult Clonorchis sinensis was first collected from the hepatobiliary duct of infected domestic cats, the worms were rinsed and cultured in DMEM medium, the supernatant of adult culture was collected, and CsEVs were separated and purified from the supernatant by ultracentrifugation. Figure 1 A) Morphological characterization of CsEVs by negative staining transmission electron microscopy to determine their size and structure. Figure 1As shown in Figure B, the isolated CsEVs have a typical saucer-like or round vesicle-like structure, and their morphology, structure, and size are similar to those of previously reported extracellular vesicles. In order to further determine the diameter and particle size distribution of the obtained CsEVs, the CsEVs were identified using a visual nanoparticle analyzer. Figure 1 As shown in Figure C, the main peak value of CsEVs particle size is 79nm, and the diameter range is mainly distributed between 30 and 150nm. The above results confirm that this study successfully extracted extracellular vesicles of Clonorchis sinensis from the culture supernatant of adult Clonorchis sinensis.

[0065] (2) Sequencing analysis of extracellular vesicles of Clonorchis sinensis

[0066] Trizol was used to extract total RNA from exosomes of Clonorchis sinensis. The sequencing data was processed to obtain clean reads for subsequent analysis. miRNA sequencing analysis was performed using miRDeep2 software. The sequencing results are shown in Figure 2 As shown, the figure shows the ranking of the contents of various miRNAs in CsEVs.

[0067] At the same time, GO enrichment analysis was performed on the target genes of the top 10 miRNAs with the highest expression detected by sequencing. The analysis software was topGO, and the statistical test method was Fisher's Exact Test. The GO enrichment bar chart effectively displayed the distribution of the number of target genes in terms of biological process, cellular component and molecular function enrichment. Figure 3 The top 20 enriched GO term results are shown (such as Figure 3 AC). Then, KEGG Pathway enrichment analysis was performed on the target genes of the top 10 miRNAs with the highest expression levels detected. The analysis software was clusterProfiler and the statistical test method was HypergeometricTest. The results of KEGG enrichment analysis were displayed using a scatter plot. Figure 3 The 20 signaling pathways with the smallest P value, i.e., the highest enrichment, are shown (e.g. Figure 3 D).

[0068] GO analysis results showed that the target genes of the top 10 miRNAs in CsEV were mainly concentrated in cell components such as cell membrane and cell nucleus, and were involved in molecular functions such as cation binding, metal ion binding, and anion binding, involving biological processes such as the regulation of developmental processes, the regulation of cell components, and cell surface receptor signaling pathways. KEGG signaling pathway analysis results showed that the target gene signaling pathways of the top 10 miRNAs in CsEV were enriched in vitamin digestion and absorption-related pathways, cell adhesion molecule-related pathways, fatty acid biosynthesis pathways, Wnt signaling pathways, NF-kappa B signaling pathways, TGF-beta signaling pathways, and Notch signaling pathways. Among them, Csi-miR-190-3p plays a dual role of suppressing or promoting cancer in different tumors and different stages of tumor development, but its related research in cholangiocarcinoma has not been reported, so follow-up studies were carried out on it.

[0069] 2.2 Csi-miR-190-3p sequence

[0070] Consensus mature sequence (its structure is as follows Figure 4 shown):

[0071] 5-agauauguuuggguuacuuggug-3 (SEQ ID NO. 1);

[0072] Mimic (mature sequence used for experiments):

[0073] 5-agauauguuuggguuacuuggug-3 (SEQ ID NO. 2);

[0074] 5-caccaaguaacccaaacauaucu-3 (SEQ ID NO. 3).

[0075] Example 2: Study on the effect of Csi-miR-190-3p on the biological function of cholangiocarcinoma cells

[0076] Research content such as Figure 5 As shown, the details are as follows:

[0077] 1. Experimental methods

[0078] 1.1 Cell culture

[0079] (1) Cell recovery: Take out the cryotube containing RBE cells (purchased from Shanghai Pito Biotechnology Co., Ltd., item number: S002) from the liquid nitrogen tank, quickly place it in a 37°C constant temperature water bath, shake it left and right to thaw the cells quickly, disinfect the outer wall with 75% alcohol and transfer it to a biosafety cabinet. Use a pipette to transfer the cell suspension into a 15mL centrifuge tube containing an equal volume of RPMI 1640 complete medium (containing 10% fetal bovine serum and 1% double antibody), gently blow and mix, and centrifuge at 1000rpm for 5min. Discard the supernatant, resuspend the cell pellet with an appropriate amount of complete medium, inoculate it in a cell culture bottle, and culture it in an incubator at 37°C and 5% CO2. After 24 hours, observe the cell adhesion under a microscope and replace with fresh medium.

[0080] 293T cells (used only in luciferase reporter gene experiments) were cultured in the same manner, except that the culture medium was replaced with DMEM medium.

[0081] (2) Cell culture medium replacement: discard the old culture medium, add an appropriate amount of sterile PBS, gently shake the culture bottle, and rinse the cells 2-3 times. After discarding the PBS, add an appropriate amount of fresh RPMI 1640 complete culture medium and continue culturing in an incubator at 37°C and 5% CO2. Generally, the culture medium is replaced every 2-3 days.

[0082] (3) Cell passaging: Cells are passaged when they enter the logarithmic growth phase (cell confluence reaches 80%). Discard the old culture medium and add PBS to rinse the cells 2 to 3 times. After discarding, add 0.5 to 1 mL of preheated 0.25% trypsin and place in a cell culture incubator for digestion for 2 minutes. When the cells begin to shrink and become round under a microscope and the intercellular gaps widen, immediately add 2 mL of complete culture medium and use a pipette to gently blow along the wall of the bottle to make the cells fall off. Collect the cell suspension and centrifuge at 1000 rpm for 5 minutes. Discard the supernatant, resuspend the cell pellet in complete culture medium, inoculate it into a new culture bottle at a ratio of 1:2 to 1:5, and place it in an incubator for culture after replenishing the culture medium.

[0083] (4) Cell cryopreservation: Mix DMSO and fetal bovine serum in a ratio of 1:9 to prepare cell cryopreservation solution. Resuspend the cell pellet obtained from the above subculture operation with 1 mL of cryopreservation solution, adjust the cell density to 5-7×106 cells / mL, and then transfer the cell suspension to a cryopreservation tube, seal it with a sealing film and keep a record. Refrigerate the cryopreservation tube at 4°C for 30 minutes, then freeze it at -20°C for 2 hours, and then place it in a -80°C refrigerator overnight. The next day, transfer the cryopreservation tube to a liquid nitrogen tank for long-term storage for subsequent experiments.

[0084] 1.2. miRNA transfection

[0085] The miRNA mimics of Csi-miR-190-3p were synthesized by Ruibo Company, and the sequence is as follows:

[0086] 5-agauauguuuggguuacuuggug-3 (SEQ ID NO. 2);

[0087] 5-caccaaguaacccaaacauaucu-3 (SEQ ID NO. 3).

[0088] When the cells (RBE cells) proliferated to a certain number and were in the logarithmic growth phase, the cells were divided into mimics (Csi-miR-190-3p) transfection group and miR-NC (Scramble-miRNA mimics, synthesized by Ruibo Company) transfection group. 100,000 cells were plated in a single well of a six-well plate in each group. After 12 hours, the cell fusion degree in the well reached 60% to 70%. For each group of single wells, 2.5 μL of mimics or Scramble-miRNA mimics solution with a concentration of 20 nmol / L was prepared and premixed in 100 μL of Opti-MEM culture medium. In addition, 2 μL of lipofectamine 3000 transfection reagent was premixed in 100 μL of Opti-MEM culture medium. After premixing for 5 minutes, the two solutions were mixed to prepare a 200 μL Opti-MEM culture medium system of mimics + lipofectamine 3000 mixed solution. The solution was gently pipetted and mixed 5 times. After waiting for 20 minutes, it was added to the single well. The solution was changed 6 hours after transfection (if the cells have a high tolerance to lipofectamine 3000, such as RBE cells, and the number of dead cells is small, the solution does not need to be changed). The next experiment was carried out 24 to 48 hours after transfection.

[0089] 1.3. Co-transfection of miRNA and plasmid

[0090] (1) The pcDNA3.1-CXCL5 plasmid was constructed by Guangzhou Dahong Biotechnology Co., Ltd. When the cells proliferated to a certain number and were in the logarithmic growth phase, the cells were divided into mimics (Csi-miR-190-3p) transfection group, pcDNA3.1-CXCL5+mimics transfection group, and miR-NC+pcDNA3.1-NC transfection group. 100,000 cells were plated into a six-well plate per well in each group. After 12 hours, the cell confluence in the well reached 60% to 70%.

[0091] (2) The next morning, transfect miRNA using the same steps as in 1.2;

[0092] Mix 2.5 μL of mimics or miR-NC (concentration 20 nmol / L) + 100 μL of Opti-MEM and let it stand for 5 minutes; mix 3 μL of Lipofectamine 3000 + 100 μL of Opti-MEM and let it stand for 5 minutes; after 5 minutes, mix the two into a 200 μL system, gently blow 5 times to ensure sufficient mixing, and then let it stand for 20 minutes; add it to each well, and then add 1800 μL of 10% FBS culture medium without antibiotics, and transfect for 6 hours.

[0093] (3) After 6 hours, discard the supernatant in each well and continue to set up the groups in (1). The system for transfection of plasmid in each single well is as follows: 20 ng plasmid + 100 μL Opti-MEM, mix and let stand for 5 minutes; Lipofectamine 30002 μL + 100 μL Opti-MEM, mix and let stand for 5 minutes; after 5 minutes, mix the two into a 200 μL system, gently blow 5 times to ensure sufficient mixing, then let stand for 20 minutes, add to the single well and duplicate wells of each group, and then add 1800 μL of 10% FBS medium without antibiotics, and transfect until the next day, so that the transfection time reaches at least 24 hours.

[0094] 1.4 Cell migration assay

[0095] Transfection was performed in groups according to experimental requirements. 20,000 RBE cells were resuspended in serum-free medium 24 hours after transfection and plated into the upper chamber of the Transwell chamber. After 20 hours, the chamber was removed from the incubator, the upper chamber was fixed in paraformaldehyde for 20 minutes, and then immersed in crystal violet for staining for 20 minutes. After removal, the upper chamber surface of the chamber was wiped with a cotton swab to wipe off the cells that did not penetrate the membrane in the upper chamber, and then dried. After drying, a fluorescent inverted microscope was used to take pictures, and 5 fields of view were randomly selected (the length scale bar indicated in the lower right corner of the photo results is 100 μm), and the pictures were counted and statistically analyzed.

[0096] 1.5 Cell invasion assay

[0097] Transfection was performed in groups according to experimental requirements. 24 hours after transfection, 50,000 RBE cells were resuspended in serum-free medium and spread into the upper chamber of the matrix gel invasion chamber. 500 μL of medium containing 20% ​​fetal bovine serum was placed in the lower chamber, and then placed in a constant temperature CO2 cell culture incubator for 24 hours. During this period, the cell state was observed through the matrix gel invasion chamber, and the membrane penetration time was extended in time. In actual experiments, membrane penetration can be achieved within 24 to 48 hours, which is closely related to the cell state. After 48 hours, the chamber was removed from the incubator, the upper chamber was placed in paraformaldehyde for 20 minutes, and then immersed in crystal violet for staining for 20 minutes, removed, and the upper chamber surface of the chamber was wiped with a cotton swab to wipe off the cells that did not penetrate the membrane in the upper chamber, and then dried. After drying, a fluorescent inverted microscope was used to take pictures, and 5 fields of view were randomly selected (the length scale bar indicated in the lower right corner of the photo results is 100 μm) for taking pictures, and the pictures were counted and counted.

[0098] 1.6 Cell scratch test

[0099] When the cells grow to the logarithmic growth phase, count and take 150,000 cells as the number of cells per well and spread them into the small holes of the six-well plate. Then, place the six-well plate in a constant temperature CO2 cell culture incubator for 48 hours. When the fusion degree reaches about 80% to 90%, transfection is carried out in groups according to experimental requirements. The transfection culture is carried out for 24 hours, at which time the cell fusion degree in each single well reaches 100%. Use a 200 μL pipette tip to make 4 to 5 straight scratches in the cells in each well. Immediately after completion, randomly select 4 to 5 fields of view in each scratch to take photos and record them. At the same time, mark the place where the scratches were photographed. After the cells crawled and migrated for 24 hours, find the same part as before and take photos again. Use image J software to calculate the reduced area of ​​the scratch. The algorithm is to first measure the total area of ​​the scratch at 0 hours, and then calculate the total area of ​​the scratch again after 24 hours. Due to cell migration, the total area of ​​the scratch at 24 hours will be smaller than the total area of ​​the scratch at 0 hours. At this time, the total area of ​​24 hours is divided by the total area at 0 hours with 0 hours as the reference value to obtain the percentage. The ratio is then statistically analyzed to determine whether there is statistical significance between the different groups.

[0100] 1.7 Real-time quantitative PCR (RT-qPCR)

[0101] (1) Extract total RNA using EZ-press RNA Rapid Extraction Kit

[0102] ① Cell lysis: After transfection, discard the culture medium in the 6-well plate and wash the cells with PBS; add 500 μL of lysis buffer and blow the cells about 30 times with a pipette to fully lyse the cells.

[0103] ②RNA binding: Add an equal volume of anhydrous ethanol to the lysate, mix thoroughly, transfer the liquid from each well to the matching spin column, centrifuge at 4000g for 1 min, and discard the liquid in the collection tube (if there is any liquid remaining, centrifuge again at 12,000g for 1 min).

[0104] ③DNA enzyme treatment: prepare enzyme solution according to the ratio of 2μL DNA enzyme (gDNA Remover) plus 10μL sterile ddH2O for each sample, then take 12μL from each centrifugal column and add it to the membrane in the center of the column, and let it stand at room temperature for 5 minutes.

[0105] ④ RNA washing: Add 500 μL of washing buffer directly to the centrifuge column in the previous step, centrifuge at 12,000 g for 1 min, discard the liquid in the collection tube, and centrifuge the empty column again at 12,000 g for 1 min; transfer the centrifuge column to an RNase-free 1.5 mL EP tube, open the lid and let it dry for 2 min.

[0106] ⑤ RNA elution: Add 20-30 μL of elution buffer to the membrane in the center of the centrifuge column, let it stand at room temperature for 2 minutes, and centrifuge it at 12,000 g for 1 minute; add the liquid obtained by centrifugation back into the centrifuge column, place it in a 4°C refrigerator for 5 minutes (to fully dissolve the RNA and increase the yield), centrifuge it again at 4°C, 12,000 g for 1 minute, discard the centrifuge column, and obtain the RNA solution.

[0107] ⑥ RNA concentration determination: Take 2 μL RNA and use Nanodrop 2000 micro-spectrophotometer to determine the total RNA concentration (OD 260 / 280 Should be between 1.90 and 2.30).

[0108] (2) Reverse transcription of mRNA

[0109] Add 1 μg of total RNA and 4 μL of 5×Evo M-MLV RT Master Mix to a 0.2 mL EP tube on ice, and then add RNase-free sterile water to a total volume of 20 μL. Vortex and mix well, centrifuge briefly, and perform reverse transcription on a PCR instrument. Set the conditions as follows: 37°C for 15 min, 85°C for 5 s, and store at 4°C. After obtaining cDNA, add 80 μL of RNase-free sterile water to make a working concentration and store in a -20°C refrigerator.

[0110] (3) Reverse transcription of miRNA

[0111] According to the instructions of the riboSCRIPTTM Reverse Transcription Kit (Cat. No. C11027-2) provided by RiboBio, 1 μg of total RNA and 1 μL of Bulge-Loop were added to a 0.2 mL EP tube on ice. TM miRNA RT Primer, 2μL 5×Reverse Transcription, 2μL RTase Mix, and then add RNase-free sterile water to a total volume of 10μL. Vortex and mix well, centrifuge briefly, and perform reverse transcription on a PCR instrument. The setting conditions are: 42℃60min, 70℃10min, and store at 4℃. After obtaining cDNA, add 80μL RNase-free sterile water to make a working concentration and store in a -20℃ refrigerator.

[0112] (4) qPCR amplification of mRNA

[0113] ① Prepare a 96-well plate, use the obtained cDNA as a template, use SYBR Green-I for qPCR amplification, the detection primers used are synthesized by Shanghai Bioengineering, and the reaction system is shown in Table 1.

[0114] Table 1 RT-qPCR reaction system

[0115]

[0116] The detection primers are as follows:

[0117] CXCL5:

[0118] F: GCTACCACTTCCACCTTG (SEQ ID NO.4);

[0119] R: CCACTATGAGCCTVVTGT(SEQ ID NO.5);

[0120] GAPDH:

[0121] F: GTCGCCAGCCGAGCCACATC (SEQ ID NO. 6);

[0122] R: CCAGGCGCCCAATACGACCA (SEQ ID NO. 7).

[0123] ②After adding the sample, apply a transparent film and centrifuge at 2200rpm for 1min.

[0124] ③ Detection on the machine, set the qPCR reaction program as follows: 95℃ pre-denaturation for 30s, 95℃ denaturation for 5s, 60℃ extension for 30s, amplification for 40 cycles. 95℃ for 15s, 65℃ for 15s to detect the melting curve, 55℃ for 1min to cool the system and end the amplification. GAPDH was used as the internal reference, and 2 -ΔΔCt The relative quantitative analysis method was used for calculation. The experiment was set up with 3 replicate wells and repeated 3 times.

[0125] (5) qPCR amplification of miRNA

[0126] ① Prepare a 96-well plate, use the obtained cDNA as a template, use SYBR Green-I for qPCR amplification, the detection primers used are synthesized by RiboBio (the primer sequence is the same as the qPCR amplification of mRNA), and the reaction system is shown in Table 2.

[0127] Table 2 RT-qPCR reaction system

[0128]

[0129]

[0130] ②After adding the sample, apply a transparent film and centrifuge at 2200rpm for 1min.

[0131] ③ Detection on the machine, set the qPCR reaction program as follows: 95℃ pre-denaturation for 10min, 95℃ denaturation for 2s, 60℃ extension for 20s, 70℃ extension for 10s; amplification for 40 cycles. 95℃ for 15s, 65℃ for 15s to detect the melting curve, 55℃ for 1min to cool the system and end the amplification. Use U6 as the internal reference and 2 -ΔΔCt The relative quantitative analysis method was used for calculation. The experiment was set up with 3 replicate wells and repeated 3 times.

[0132] 1.8. Western blot

[0133] (1) Total protein extraction

[0134] Prepare protein lysis buffer (the volume ratio of RIPA to protease inhibitor is 100:1); after transfection, discard the culture medium in the 6-well plate, wash the cells with PBS, add 100 μL of lysis buffer to each well, place on ice for lysis for 20 min, then scrape the cells with a cell scraper, transfer the lysate to a 1.5 mL EP tube, centrifuge at 4°C, 12,000g for 15 min, collect the supernatant to obtain a total protein solution.

[0135] (2) Determination of total protein concentration by BCA method

[0136] ① Prepare BCA working solution: According to the number of standards and samples, prepare the working solution at the ratio of BCA reagent: CuSO4 reagent = 50:1, and then add 200 μL of BCA working solution to each measurement well of the 96-well plate.

[0137] ② Add 0.5 mg / mL protein standard to the standard wells of a 96-well plate at 0, 1, 2, 4, 8, 12, 16, and 20 μL, and add ddH2O to make up to 20 μL, which is equivalent to the standard concentration of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively.

[0138] ③ Take 2 μL of the protein sample to be tested and add it to the sample wells of the 96-well plate, add ddH2O to make up to 20 μL (diluted 10 times), and set up 3 replicate wells for each sample.

[0139] ④ Add 200 μL of BCA working solution to each well and incubate at 37°C in the dark for 30 min.

[0140] ⑤ Use an enzyme-labeled instrument to detect the absorbance value of each well at a wavelength of 562 nm, and draw a standard curve with the concentration of the protein standard as the horizontal axis and the absorbance value as the vertical axis; calculate the concentration of the protein sample based on the standard curve and the absorbance value of the sample.

[0141] (3) SDS-PAGE electrophoresis

[0142] ① Prepare 12.5% / 10% / 7.5% PAGE gel according to the operating instructions of the PAGE gel rapid preparation kit (Yazyme), and select the appropriate concentration of gel according to the molecular weight of the protein.

[0143] ② Calculate the sample volume of the protein to be tested based on the amount of 20-30 μg of protein, add 4 μL of 5× loading buffer respectively, and use RIPA lysis buffer to make up the less than 20 μL to 20 μL sample system; after mixing, heat in a 100℃ water bath for 5 minutes to fully denature the protein.

[0144] ③ Assemble the prepared PAGE gel into the electrophoresis tank, fill it with electrophoresis solution, and add 4 μL of pre-stained marker and the above-prepared protein sample into the sample wells of the gel in turn; turn on the power of the electrophoresis instrument, and set the electrophoresis program to constant voltage 80V, 30min (the protein sample runs through the upper layer of concentrated gel during electrophoresis); 120V, about 60min (the protein sample runs through the lower layer of separation gel during electrophoresis to the lower edge of the colloid).

[0145] (4) Transfer

[0146] ① Soak the gel after electrophoresis in transfer buffer, cut the PVDF membrane according to the size of the protein site on the gel, soak it in methanol for a few seconds to activate it, and soak it in transfer buffer together with filter paper for later use.

[0147] ② Assemble the filter paper, gel, PVDF membrane, and filter paper into a "sandwich" structure in the order from negative electrode to positive electrode. The structure should be kept moist during the process, and bubbles should be avoided between the gel and the PVDF membrane.

[0148] ③ Place the assembled "sandwich" structure into the electrophoresis tank, add freshly prepared transfer buffer, place it on ice and start transfer. Set the transfer program to a constant current of 250mA for 150min.

[0149] (5) Closed

[0150] After the transfer, carefully separate the PVDF membrane from the gel and rinse it three times with 1×TBST, each time for 3 to 5 minutes. Use 1×TBST solution to prepare 50 mL of 5% skim milk powder as blocking solution, soak the PVDF membrane in 5% skim milk powder, and place it on a shaker at room temperature for 1 to 2 hours.

[0151] (6) Primary antibody hybridization

[0152] After blocking, the PVDF membrane was rinsed three times with 1×TBST, each time for 3 to 5 minutes; according to the molecular weight of the protein labeled by the marker, the area containing the protein to be tested was cut into appropriate sizes, the corresponding primary antibody was added (Table 3), and it was incubated on a shaker at 4°C overnight.

[0153] Table 3 Primary antibodies for Western blot

[0154]

[0155] (7) Secondary antibody hybridization

[0156] The primary antibody was recovered the next day and stored in a -20°C refrigerator. The PVDF membrane was placed on a shaker at room temperature and quickly rinsed with 1×TBST three times, 10 min each time; after removing TBST, the corresponding secondary antibody (rabbit secondary antibody, diluted to an appropriate working concentration with antibody diluent according to the antibody instructions) was added and incubated on a shaker at room temperature for 1 to 2 hours.

[0157] (8) Chemiluminescence

[0158] The secondary antibody was recovered and stored in a -20°C refrigerator. The PVDF membrane was placed on a shaker at room temperature and quickly rinsed with 1×TBST three times, 10 min each time; the excess liquid on the membrane was removed with filter paper, and an appropriate amount of ECL luminescent liquid was added (evenly covering the entire membrane), and the membrane was placed in a chemiluminescence instrument for development and image collection. The grayscale value of the protein band was analyzed by ImageJ, and the relative expression of the target protein was calculated using GAPDH as an internal reference.

[0159] 1.9. Luciferase reporter gene assay

[0160] (1) Construction of dual-fluorescein reporter vector

[0161] TargetScan 7.0, miRDB, and miRTarBase were used to analyze the target genes of Csi-miR-190-3p, and the possible target genes of Csi-miR-190-3p were obtained. Then, according to the results of Targetscan analysis, the sequence and random mutations of the target site were queried near the target site of the CXCL5-3′UTR gene sequence. The following sequence was synthesized by Qingke Biotechnology, using pmirGLO as a vector, Amp+ resistance, and the restriction site was NheI-XhoI.

[0162] pmirGLO CXCL5 3'UTR-WT:

[0163] GCTAGCaacctaggtaattaatggttgtgaatttctatttttgctttgtttttaatgaacatttgtctttcagaataggattctgtgataatatttaaatggca aaaacaaaacataattttgtgcaattaacaaagctactgcaagaaaaataaaacatttcttggtaaaaacgtatgtatttatatattatatttatatataat atatattatatatttagcattgctgagctttttagatgcctattgtgtatcttttaaaggttttgaccattttgttatgagtaattacatatatattacattca ctatattaaaattgtacttttttactatgtgtctcattggttcatagtctttattttgtcctttgaataaacattaaaagatttctaaacttcaCTCGAG(SEQ ID NO.8, the first and last capital letters are the restriction sites).

[0164] pmirGLO CXCL5 3'UTR-MUT:

[0165] GCTAGCaacctaggtaattaatggttgtgaatttctatttttgctttgtttttaatgaacatttgtctttcagaataggattctgtgataatatttaaatggca aaaacaaaacataattttgtgcaattaacaaagctactgcaagaaaaataaaacatttcttggtaaaaacgtatgtatttatatattatatttatatataat atatattatatatttagcattgctgagctttttagatgcctattgtgtatcttttaaaggttttgaccattttgTTATCTAGAATTACAGATACATTAcattca ctatattaaaattgtacttttttactatgtgtctcattggttcatagtctttattttgtcctttgaataaacattaaaagatttctaaacttcaCTCGAG(SEQ ID NO.9, the first and last capital letters are the restriction sites, and the middle capital letter is the mutation sequence).

[0166] (2) Cell transfection

[0167] 293T cells were used for the experiment. Before the experiment, the cell growth state should be observed (logarithmic phase is the most suitable), and the cells required for the experiment were taken out of the incubator, and then the plasmid was transfected. The specific method of transfection was the same as step 1.3. The transfection groups were: pmirGLO-CXCL5 3'UTR-WT (wild type) and pmirGLO-CXCL5 3'UTR-MT (mutant).

[0168] (3) Dual luciferase activity detection

[0169] 48 hours after transfection, 293T cells were removed, gently washed with PBS, and then 100 μL of cell lysate used in the luciferase reporter system was added. After complete lysis on ice for 30 minutes, the cell lysate was added to a centrifuge tube at room temperature and centrifuged at 12,000 rpm for 5 minutes to remove excess cells for the next step of detection. Then 20 μL of each sample was added to a 96-well white plate, and 3 replicates of each sample were spread for biological repetition. Turn on the fluorescence detection according to the instrument instructions, add 100 μL of firefly luciferase detection reagent thawed at room temperature to the 96-well plate, and mix slowly with a pipette. This step must be protected from light. After incubation at room temperature for 5 minutes, turn on the microplate reader for luminescence detection and record the fluorescence value (FLU). At the same time, take the 96-well plate, add 100 μL of Renilla luciferase detection solution, slowly pipette, mix thoroughly, incubate at room temperature for 5 minutes, and when the emission signal is stable, use a microplate reader for luminescence detection and record the fluorescence value (RLU).

[0170] (4) Data analysis

[0171] Calculate the luminescence ratio of firefly luciferase and Renilla luciferase. Take Renilla luciferase as the internal reference, and divide the FLU value measured by firefly luciferase by the RLU value measured by Renilla luciferase. Detection value ratio = firefly luciferase detection value / Renilla luciferase detection value.

[0172] 1.10 Statistical analysis

[0173] All data were statistically analyzed using GraphPad Prism 8.0. All results were based on three independent experiments, and the results were expressed as mean ± standard deviation (Mean ± SD). The differences between the two groups were analyzed using unpaired t-test, and the differences between multiple groups were analyzed using One-way ANOVA (single-factor analysis of variance). P < 0.05 was considered statistically significant.

[0174] 2. Experimental results

[0175] 2.1. Csi-miR-190-3p inhibits RBE cell migration and invasion in vitro

[0176] (1) RT-qPCR detection of Csi-miR-190-3p expression in RBE cells after transfection with mimics

[0177] First, RT-qPCR was used to detect the background expression value of Csi-miR-190-3p in RBE cells and the overexpression after transfection with mimics ( Figure 6 ). It can be seen that the expression level of the overexpression group increased significantly, indicating that the transfection was successful.

[0178] (2) Migration and invasion assay

[0179] In order to explore whether Csi-miR-190-3p affects the invasion ability of RBE, this study used Matrigel invasion chamber experiments to detect and quantitatively analyze the results. First, Csi-miR-190-3p and Scramble-miRNA mimics were transfected and overexpressed in RBE cells. 24 hours after transfection, the cells were plated into Transwell and Matrigel Transwell chambers, and culture media with different concentrations of fetal bovine serum were injected into the upper and lower chambers (the upper chamber was a cell culture medium without fetal bovine serum, and the lower chamber was a cell culture medium containing 20% ​​fetal bovine serum), and then migration and invasion chamber experiments were performed. The results showed that ( Figure 7 ), the number of cells that passed through the chamber in the overexpression group within 24 h was significantly decreased compared with that in the NC group, indicating that Csi-miR-190-3p inhibited the longitudinal migration of RBE cells in vitro.

[0180] (3) Scratch test

[0181] The results of the cell scratch test showed that the 24h migration rate of the overexpression group cells decreased, suggesting that Csi-miR-190-3p inhibited the lateral migration of RBE cells in vitro. After overexpressing Csi-miR-190-3p mimics and Scramble-miRNA mimics in RBE cells that were grown on a six-well plate, a 200μL pipette tip was used to make several scratches of uniform thickness in a single well of a six-well plate that was full of cells. After taking pictures at a fixed position, take another picture at an interval of 24 hours to measure the distance of cell migration. The results showed ( Figure 8 ), the 24h migration rate of the overexpression group cells decreased, and the difference between the two groups was statistically significant (P<0.001), indicating that overexpression of miR-490-5p inhibited the lateral migration ability of RBE cells.

[0182] 2.2. Prediction and verification of Csi-miR-190-3p target genes

[0183] (1) Prediction of Csi-miR-190-3p target genes

[0184] TargetScan 7.0, miRDB, and miRTarBase were used to analyze the target genes of Csi-miR-190-3p, and 420 target genes including HIATL2, MLLT10, CXCL5, RP11-322L20.1, and CREBZF were obtained. Fig. 9). Among them, CXCL5 ranked in the top three in terms of prediction score and has been shown to play a role in a variety of tumors. At the same time, the expression of this gene decreased after transfection with mimic in the qPCR pre-experiment, so CXCL5 was selected for study.

[0185] (2) Verification of Csi-miR-190-3p target genes

[0186] The results of luciferase reporter gene assay showed that ( Fig.10 ), there was no significant difference in luciferase activity between the Csi-miR-190-3p group and the NC group in cells transfected with the mutant plasmid, while in the wild type, the luciferase activity in the Csi-miR-190-3p group was lower than that in the NC group (P<0.005). Western blotting was used to detect the expression of CXCL5 protein after transfection, and the results showed that the protein expression level in the overexpression Csi-miR-190-3p group decreased. In the q-PCR experiment, the expression of CXCL5 in the overexpression group also decreased (****P<0.0001). The above results indicate that CXCL5 is a target gene of Csi-miR-190-3p.

[0187] 2.3. Csi-miR-190-3p inhibits the migration of RBE cells by regulating CXCL5

[0188] (1) Migration and invasion assay

[0189] Migration and invasion experiments showed that Fig.11 ), overexpression of CXCL5 alleviated the inhibitory effect of Csi-miR-190-3p on the longitudinal migration ability of RBE cells.

[0190] (2) Scratch test

[0191] Scratch test showed that ( Fig.12 ), overexpression of CXCL5 alleviated the inhibitory effect of Csi-miR-190-3p on the lateral migration ability of RBE cells.

[0192] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. Use of a reagent for overexpressing microRNA derived from extracellular vesicles of Clonorchis sinensis in RBE cells in the preparation of a drug for preventing cholangiocarcinoma caused by Clonorchis sinensis, characterized in that: The consensus mature sequence of the MicroRNA is shown in SEQ ID NO.1, and the Mimic sequence is shown in SEQ ID NO.2 and SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The drug for resisting cholangiocarcinoma caused by Clonorchis sinensis is a drug for inhibiting the migration of RBE cells.

3. The use according to claim 2, characterized in that: The drug for resisting cholangiocarcinoma caused by Clonorchis sinensis is a drug for inhibiting the longitudinal and / or lateral migration of RBE cells.

4. The use according to claim 1, characterized in that: The reagent for overexpressing the MicroRNA derived from the extracellular vesicle of Clonorchis sinensis in RBE cells comprises the MicroRNA shown in SEQ ID NO.2 and SEQ ID NO.3 and a liposome transfection reagent.

5. A drug for preventing bile duct cancer caused by Clonorchis sinensis, characterized in that: The drug comprises as a main active ingredient an agent for overexpressing the MicroRNA shown in SEQ ID NO.2 and SEQ ID NO.3 in RBE cells.

6. The drug for preventing bile duct cancer caused by Clonorchis sinensis according to claim 5, characterized in that: The medicament further includes a pharmaceutically acceptable carrier.

7. The drug for preventing cholangiocarcinoma caused by Clonorchis sinensis according to claim 5, characterized in that: The dosage forms of the drug include tablets, capsules, powders, granules and liquids.

Images