Multiple detection method for predicting reduction of sensitivity of neisseria gonorrhoeae to cephalosporin

Abstract

The invention belongs to the technical field of molecular biological detection, and develops a molecular detection method (Six-CodonPlus) for predicting low sensitivity or drug resistance of neisseria gonorrhoeae ceftriaxone on the basis of a high resolution melting (HRM) technology, targeting at seven key gene loci of a neisseria gonorrhoeae penA gene and species identification genes opa and porA, and provides a method for predicting low sensitivity or drug resistance of neisseria gonorrhoeae ceftriaxone. And meanwhile, screening of key cephalosporin drug-resistant strains FC428 and related strains thereof, which are propagated internationally, is covered. Comprising the following steps: (1) designing primers aiming at different detection targets; (2) testing HRM-Assay1 aiming at targets of 375-377, 501 and opa; (3) testing HRM-Assay2 aiming at targets of 311, 542, 551 and porA; and (4) judging according to a result of an optimal detection strategy.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology detection, and relates to a method for detecting multiple drug resistance sites, and in particular to a method for detecting drug resistance sites of Neisseria gonorrhoeae based on high resolution melting curve analysis (HRM). Background Art

[0002] Gonorrhea is one of the major global public health problems caused by infection with Neisseria gonorrhoeae (NG). Its widespread prevalence and spread has become a huge burden on global public health. The World Health Organization's 2016-2020 "Prevention and Control of Sexually Transmitted Infections: Global Strategy" lists gonorrhea as one of the key STDs to be prevented and treated. According to statistics, the annual incidence rate of people aged 15-49 in the world in 2020 was as high as 82.4 million, ranking second among bacterial sexually transmitted diseases in the world. At the same time, under the influence of many factors such as health concepts, economic level, detection technology, and monitoring scope, the current statistics may be greatly underestimated. In addition, due to the abuse of antibiotics, the evolution of Neisseria gonorrhoeae, social and economic factors, the rapid development and spread of antimicrobial resistance in Neisseria gonorrhoeae has greatly reduced the effectiveness of multiple antibiotics in treating gonorrhea. Antimicrobial drugs that were once widely used in the treatment of gonorrhea, including penicillin, fluoroquinolones, and azithromycin, have successively withdrawn from the first-line drug team for gonorrhea treatment. As the last type of single antibiotic treatment option, the effectiveness of cephalosporins in the treatment of gonorrhea is declining, and super bacteria have emerged. Therefore, Neisseria gonorrhoeae has been listed by the World Health Organization as the only sexually transmitted pathogen that requires the development of new antimicrobial drugs.

[0003] As one of the major international cephalosporin-resistant strains of Neisseria gonorrhoeae, the drug resistance of FC428 clone has attracted global attention, especially for the last first-line antibacterial drug, ceftriaxone, which shows a typical high-level resistance, with a minimum inhibitory concentration (MIC) of 0.5 mg / L. Studies have shown that the mosaic penA gene sequence of FC428 may come from the commensal Neisseria in the oral cavity, suggesting that the source of its drug resistance genes is not limited to the species itself. At the same time, because Neisseria gonorrhoeae has good transformation ability, the spread of FC428 clone has expanded to more antibiotic-sensitive gene lineages, which has aggravated the global spread of drug resistance of Neisseria gonorrhoeae. The latest guidelines of the World Health Organization emphasize the urgency of developing specific detection methods for the FC428 strain. In particular, the A311V mutation associated with the penA-60.001 gene is used as one of the key strategies for detecting this strain.

[0004] Due to methodological limitations, most of the current analyses of cephalosporin hyposensitivity / resistance in Neisseria gonorrhoeae in my country are retrospective studies after large-scale collection of Neisseria gonorrhoeae. First, strains with low ceftriaxone sensitivity are screened out through drug phenotypic sensitivity testing, and then specific gene fragments are sequenced or whole genome sequencing is performed for confirmation. The entire identification process is time-consuming and usually cannot be completed independently in a clinical laboratory. Among the many current detection methods, nucleic acid amplification tests (NAATs) make up for the limitations of cumbersome and time-consuming traditional culture methods with their advantages such as high timeliness and automation. Among them, the high-resolution melting curve method targets small changes in the DNA sequence with its high sensitivity, high specificity, high throughput, high cost-effectiveness, and no need for probe labeling. It can detect specific resistance-related mutation sites and achieve rapid detection of drug resistance in Neisseria gonorrhoeae. Summary of the invention

[0005] The present invention aims to provide a method for detecting Neisseria gonorrhoeae-cephalosporin hyposensitivity / resistance-related mutation sites.

[0006] Based on the bioinformatics analysis of a large number of cephalosporin hyposensitive and resistant strains in previous studies, the present invention selects 7 key gene mutation sites 311, 375-377, 501, 542, 551 and opa, porA that are prominent in the study of their genetic characteristics as detection targets. Considering the balance of the multiple detection system and the high resolution of Tm interpretation, the above sites are divided into two Assays for amplification: Assay 1 covers the internal reference gene opa and 375-377, 501 sites; Assay 2 covers the internal reference gene porA and 542, 551, 311 sites. A variety of combined target interpretation strategies were evaluated, and finally the best strategies suitable for large-scale screening at the public health level and auxiliary diagnosis at the clinical level were selected to predict the correlation between Neisseria gonorrhoeae and cephalosporin hyposensitivity (i.e., at the public health level, mosaic penA types without A311V mutations or non-mosaic penA types with 501 site mutations can be interpreted as cephalosporin hyposensitivity; at the clinical level: mosaic penA types without A311V mutations or non-mosaic penA types with 501 site mutations combined with any one of the 542 and 551 site mutations can be interpreted as cephalosporin hyposensitivity). At the same time, based on this interpretation, if the molecular type presents a mosaic penA type and contains an A311V mutation, it can be used as a criterion for cephalosporin resistance, and can also be used as a screening condition for the global concern strain FC428 and its related clones. This method covers the key sites related to cephalosporin low sensitivity / resistance in mosaic and non-mosaic types of Neisseria gonorrhoeae, providing technical support for the rapid screening of low-sensitivity / resistant strains in molecular epidemiological investigation and the formulation of correct gonorrhea treatment plans in clinical practice.

[0007] To this end, the present invention provides a method for detecting drug resistance sites of Neisseria gonorrhoeae, wherein the method uses a high-resolution melting curve method to detect the following seven drug resistance targets of Neisseria gonorrhoeae: penA_375-377, penA_501, penA_542, penA_551, penA_311, and species identification genes opa and porA. The targets cover key sites related to cephalosporin hyposensitivity / resistance in mosaic penA types and non-mosaic penA types, and can screen the internationally concerned FC428 strain and its related strains.

[0008] The method of the present invention comprises amplifying the DNA of Neisseria gonorrhoeae using primers of sequences 1-13 in the sequence table, wherein the primer sequences are as follows:

[0009]

[0010]

[0011] Based on the amplification results, determine whether the sample to be tested is Neisseria gonorrhoeae and further carry out cephalosporin low sensitivity / resistance prediction.

[0012] The method of the present invention, wherein the method for determining whether the sample to be tested is Neisseria gonorrhoeae is as follows: first, determine whether the sample to be tested is Neisseria gonorrhoeae by using the opa and porA genes, and if double positive, continue to perform cephalosporin low sensitivity / resistance judgment, and the judgment criteria are as follows: in the first step, if the 375-377 sites in Assay1 are positive, it is judged as a mosaic penA type, and if negative, it is judged as a non-mosaic penA type. In the second step, in the mosaic penA gene, the 311 site in Assay2 is used to determine whether the 311 site is a wild type or a mutant type. The wild type is judged as cephalosporin low sensitivity, and the mutant type is judged as cephalosporin resistance. At the same time, the mutant type is used as the identification condition of the FC428 clone strain and its related strains. In the third step, in the non-mosaic penA gene, In the first step, the 501 site in Assay1 is used to determine whether the 501 site is wild type or mutant. In the fourth step, the melting curve of the long product with a higher Tm value in Assay2 is used to determine whether the 542 and 551 sites are wild type, single mutant or double mutant. In the fifth step, the melting curve of the short product with a lower Tm value in Assay2 is used to determine whether the 542 site is wild type or mutant. When the 542 site is wild type, if the melting curve of the long product shows wild type, then the 551 site is wild type; if the melting curve of the long product shows a single mutant, then the 551 site is mutant. If the 542 site is mutant, if the melting curve of the long product shows a single mutant, then the 551 site is wild type; if the melting curve of the long product shows a double mutant, then the 551 site is mutant.

[0013] The present invention further includes a primer detection kit containing sequences 1-13 in the sequence table, which is not used for the treatment and diagnosis of diseases, but can be used in the experimental process of distinguishing drug-resistant strains. The kit of the present invention is used to detect low-sensitivity / drug-resistant site mutations of Neisseria gonorrhoeae and the screening of the internationally concerned drug-resistant strain FC428 and its related strains, providing technical support for the rapid screening of low-sensitivity / drug-resistant strains in molecular epidemiological investigation and the formulation of correct gonorrhea treatment plans in clinics.

[0014] The present invention further provides a method for using the kit, comprising the following steps:

[0015] 1) Nucleic acid extraction: Use a nucleic acid extraction kit to extract the swab / urine sample or its culture from the test patient;

[0016] 2) HRM-Assay1 test for 375-377, 501 target and opa gene: premixed 375-377, 501 target and opa gene primers, Forget-Me-Not TM Master Mix reagent and nuclease-free water were shaken and mixed thoroughly, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL. The system was placed in the QuantStudio 6 Flex real-time PCR instrument with preset parameters for amplification.

[0017] 3) HRM-Assay2 test for 311, 542, 551 targets and porA gene: premixed primers related to 311, 542, 551 targets and porA gene, Forget-Me-Not TM Master Mix reagent and nuclease-free water were shaken and mixed thoroughly, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL. The system was placed in the QuantStudio 6 Flex real-time PCR instrument with preset parameters for amplification.

[0018] 4) Result interpretation: opa and porA species identification genes were used to determine whether the sample was Neisseria gonorrhoeae; if so, the 375-377 sites in Assay1 were used to determine whether it was a mosaic penA type or a non-mosaic penA type; if it was a mosaic penA type, the 311 site in Assay2 was further used to determine whether the 311 site was wild type or mutant type. The wild type was interpreted as cephalosporin hyposensitivity, and the mutant type was interpreted as cephalosporin resistance, which was also used as a screening condition for the FC428 clone and its related strains; if it was a non-mosaic penA type, the 501 site, 542 site, and 551 site were judged to be wild type or mutant type in turn. The interpretation strategy for 501, 542, and 551 was as follows: when large-scale screening was carried out at the public health level: a mutation at the 501 site was interpreted as cephalosporin hyposensitivity; during auxiliary screening at the clinical level, a mutation at the 501 site combined with a mutation at any of the two sites, 542 and 551, was interpreted as cephalosporin hyposensitivity.

[0019] The seven detection targets described in the present invention have the following functions:

[0020] 1) penA_375-377: for predicting cephalosporin hyposensitivity in mosaic type

[0021] 2) penA_501, penA_542, penA_551: used to predict cephalosporin hyposensitivity in non-mosaic types

[0022] 3) penA_311: used to predict cephalosporin resistance and screen for internationally transmitted FC428 resistant clones and related strains

[0023] In addition, opa and porA dual targets were used as a marker for the identification and confirmation of Neisseria gonorrhoeae species.

[0024] The technical route of the present invention comprises the following steps:

[0025] 1) Primer design for different detection targets:

[0026] For the species identification genes opa and porA in Assay1 and Assay2: First, the gene sequences were obtained from the GenBank database ( https: / / www.ncbi.nlm.nih.gov / genbank / ) and download the fully annotated opa and porA gene sequences of the representative strain of Neisseria gonorrhoeae (FA19) as the reference sequence, perform nucleic acid sequence BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) with the reference sequence and the nr database of NCBI, batch download the results of the comparison, and obtain more opa and porA target gene sequences. Import the batch downloaded sequences into Geneious R11 software for sequence BLAST comparison (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). According to the comparison results of the batch sequences, determine the conserved regions in the opa and porA genes for primer design;

[0027] For detection of target penA gene: Download NG-STAR website ( https: / / ngstar.canada.ca / ) were used to identify all types of penA gene sequences (penA-1.001 to penA-316.001) in the genome. All sequences were grouped into mosaic penA genes and non-mosaic penA genes according to the structural information provided by the website. The penA gene sequences in different groups were compared and analyzed, and primers were designed for specific regions.

[0028] 2) HRM-Assay1 test for 375-377, 501 targets and opa gene

[0029] Formulated system includes: Forget-Me-Not TM Master Mix reagent (Biotium), 375-377, 501 target and opa gene primer mix and nuclease-free water were thoroughly shaken and mixed, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL, which was then placed in the QuantStudio 6Flex real-time PCR instrument with preset parameters for amplification.

[0030] 3) HRM-Assay2 test for 311, 542, 551 targets and porA gene

[0031] The system is prepared as above, wherein the primer mix is ​​the optimal primer combination related to the 311, 542, 551 targets and the porA gene. It is worth noting that for the 542, 551 targets in this Assay, a forward primer (penA-542F) and two reverse primers (penA-542R, penA-551R) are designed. Among them, the forward primer (penA-542F) and the reverse primer (penA-551R) will amplify a long product, including the 542 and 551 sites, forming a melting curve with a higher temperature, through which the 542 and 551 sites as a whole can be quickly judged to be wild type or mutant (including single mutation and double mutation). In addition, the forward primer (penA-542F) and the reverse primer (penA-542R) will amplify a short product, including the 542 site, forming a melting curve with a lower temperature, through which the 542 site can be quickly judged to be wild type or mutant. Combining the long product melting curve with the short product melting curve, the genotypes of loci 542 and 551 can be quickly determined.

[0032] 4) Judge based on the results of the optimal detection strategy

[0033] The opa and porA species identification genes are used to determine whether the sample is Neisseria gonorrhoeae; if so, the 375-377 sites in Assay1 are used to determine whether it is a mosaic penA type or a non-mosaic penA type; if it is a mosaic penA type, the 311 site in Assay2 is further used to determine whether the 311 site is wild type or mutant type. The wild type is judged as cephalosporin hyposensitivity, and the mutant type is judged as cephalosporin resistance, and it is also used as a screening condition for the FC428 clone and its related strains; if it is a non-mosaic penA type, the 501 site, 542 site, and 551 site are judged to be wild type or mutant type in turn, and then predicted based on the low sensitivity interpretation strategy.

[0034] Preferably, for each target, multiple sets of HRM primer pairs are designed for testing and evaluation. After the specific primer design is completed, the theoretical Tm value of the amplicon sequence amplified by each pair of primers needs to be predicted in advance using the online Tm value prediction tool OligoCalc (http: / / biotools.nubic.northwestern.edu / OligoCalc.html). HRM primer pairs with large predicted Tm value differences that can clearly distinguish wild type and mutant types are selected for testing, and after testing, the optimal HRM primer pair is selected to form the detection system. If necessary, non-specific GC tails can be added to certain primers to prevent the Tm values ​​between amplified products from overlapping.

[0035] Preferably, a negative control is added to each reaction, wherein the negative control is nuclease-free water.

[0036] Most preferably, the detection method of the present invention comprises the following steps:

[0037] 1) Primer design for different detection targets

[0038] Based on the download of reference sequences from the GenBank database, the comparison of nucleic acid sequences from the NCBI database, and the multi-sequence BLAST of the Geneious R11 software, the conserved regions of the species identification genes opa and porA were finally determined for primer design; at the same time, the multiple sequence comparison analysis of the detection target penA gene was performed with the help of the Geneious R11 software, and specific regions were selected for primer design. Multiple sets of HRM primers designed for each target were predicted in advance by the online Tm value prediction tool OligoCalc, and appropriate primer pairs were selected for further testing. The final primers for each target are shown in Table 1.

[0039] Table 1. Six-Codon Plus Primer sequences

[0040]

[0041]

[0042] After 12 repeated tests for each group of targets, the Tm values ​​were determined and shown in Table 2.

[0043] Table 2. Six-Codon Plus Tm value of each detection target

[0044]

[0045]

[0046] 2) HRM-Assay1 test for 375-377, 501 targets and opa gene

[0047] According to the reaction system of a single sample in Table 3, calculate the total amount of different reagents added except the template according to the number of samples in the reaction. Vortex and mix thoroughly, dispense 18 μL into each well of the fluorescent quantitative PCR reaction plate, and then add 2 μL of extracted nucleic acid, and the total HRM reaction system is 20 μL.

[0048] Table 3. Six-Codon Plus -Assay1 reaction system

[0049]

[0050] After the system is prepared, apply the sealing film and press the edge of the plate with a scraper to avoid wall residue. Put it into a plate centrifuge and centrifuge at 500 rpm for 30 seconds. After sufficient shaking, centrifuge again. The amplification parameters of the QuantStudio 6 Flex real-time PCR instrument are shown in Table 4.

[0051] Table 4. Amplification parameters for the QuantStudio 6 Flex real-time PCR instrument

[0052]

[0053] 3) HRM-Assay2 test for 311, 542, 551 targets and porA gene

[0054] According to the reaction system of a single sample in Table 5, calculate the total amount of different reagents added except the template according to the number of samples in the reaction. Fully shake and mix, dispense 18μL into each well of the fluorescent quantitative PCR reaction plate, and then add 2μL of extracted nucleic acid, and the total HRM reaction system is 20μL. After the system is prepared, stick the sealing film, press the edge of the plate with a scraper, and put it into a flat centrifuge to avoid wall residues. Centrifuge at 500rpm for 30s, shake it thoroughly and centrifuge it again. The amplification parameters of the QuantStudio 6 Flex real-time PCR instrument are shown in Table 4.

[0055] Table 5. Six-Codon Plus -Assay2 reaction system

[0056]

[0057] 4) Judge based on the results of the optimal detection strategy

[0058] First, the opa and porA genes are used to determine whether the sample to be tested is Neisseria gonorrhoeae. Double positive results can continue to be interpreted as low sensitivity / resistance to cephalosporins. The interpretation criteria are as follows: Step 1. If the 375-377 sites in Assay1 are positive, it is judged as a mosaic penA type, and if it is negative, it is judged as a non-mosaic penA type. Step 2. In the mosaic penA gene, the 311 site in Assay2 is used to determine whether the 311 site is wild type or mutant. The wild type is judged as low sensitivity to cephalosporins, and the mutant type is judged as cephalosporin resistance. At the same time, the mutant type is used as the identification condition for the FC428 clone and its related strains. Step 3. In the non-mosaic penA gene, the 501 site in Assay1 is used to determine whether the 501 site is wild type or mutant. Step 4. The melting curve of the long product with a higher Tm value in Assay2 is used to determine whether the 542 and 551 sites are wild type, single mutant or double mutant as a whole. Step 5: Use the melting curve of the short product with a lower Tm value in Assay2 to determine whether site 542 is wild type or mutant. When site 542 is wild type, if the melting curve of the long product shows wild type, then site 551 is wild type; if the melting curve of the long product shows a single mutant, then site 551 is mutant. If site 542 is mutant, if the melting curve of the long product shows a single mutant, then site 551 is wild type; if the melting curve of the long product shows a double mutant, then site 551 is mutant. See the attached for the result interpretation process. Figure 1 The results of amplifying each target by Assay1 and Assay2 are shown in Figure 2.

[0059] The detection method of the present invention involves targets that cover both mainstream detection targets in mosaic penA type and non-mosaic penA type of Neisseria gonorrhoeae, and its comprehensive detection strategy is conducive to further identifying the FC428 clone strain and its related strains that have attracted widespread attention internationally.

[0060] Based on high-resolution melting curve technology, the present invention designs a high-throughput multiplex detection method for detecting cephalosporin hyposensitivity / resistance-related sites of Neisseria gonorrhoeae, and adopts multi-dimensional evaluation, such as strain samples with known whole genome sequencing (WGS) sequencing results (known penA genotype) are used to evaluate the specificity of the method, bacterial liquid DNA / plasmid with gradient concentrations are used to evaluate the detection limit of the method, clinical swabs / urine with known quantitative data are used to evaluate the sensitivity of the method in clinical samples, swab samples from multiple centers are used to evaluate its identification ability for Neisseria gonorrhoeae, strain samples with known drug resistance phenotypes are used to evaluate the scientificity and practicality of the molecular detection strategy of the method, and non-gonococcal Neisseria gonorrhoeae strains are used to evaluate the cross-reactivity of the method. The evaluation results show that the method has the characteristics of high sensitivity, high specificity, high throughput and low-cost operation, the experimental operation is simple and easy, and it has good scalability. While being suitable for large-scale monitoring of drug resistance of Neisseria gonorrhoeae, it has more use value and promotion value in clinical medicine.

[0061] As required, the kit of the present invention may also include reagents that are beneficial to laboratory operations, such as solvents, buffer solvents, auxiliary materials, etc.

[0062] The kit of the present invention may include reagents prepared from the above components. The preparation methods of the reagents are all conventional techniques. It only requires mixing various raw materials evenly at room temperature without the need for special equipment and conditions.

[0063] The kit of the present invention can contain different reagents separately and package them together in the same packaging box, and operate according to the method described in the instructions when using.

[0064] Compared with the existing detection methods, the detection method of the present invention has the following beneficial effects:

[0065] Timeliness of the method: Current drug resistance monitoring studies mainly obtain retrospective information. Treatment guidelines based on this information always lag behind the real-time distribution of drug resistance. NAATs technology, as an important technical supplement for drug resistance monitoring of Neisseria gonorrhoeae, provides a comprehensive epidemiological basis for timely adjustment of treatment guidelines and tracking the emergence and spread of drug resistance in many countries. Among them, HRM technology, with its high sensitivity, high specificity, high throughput, high cost-effectiveness, and no need for probe labeling, has been successfully applied to the screening of internationally spread ceftriaxone-resistant FC428 clones and multi-drug resistance gene screening of Neisseria gonorrhoeae, showing great potential in the field of molecular diagnosis of drug resistance of Neisseria gonorrhoeae.

[0066] Target integrity: Based on a comprehensive analysis of all types of penA gene sequences, the present invention selects key sites related to cephalosporin hyposensitivity and incorporates A311V mutation-mediated drug resistance into the prediction strategy, making up for the limitations of previous detection methods with a single target and limited prediction level. It can realize the molecular screening of the internationally popular FC428 strain in an integrated manner.

[0067] Scalability of the method: Given the scalability of the HRM method, the detection targets can be further expanded and the interpretation strategy can be adjusted according to the local resistance situation to optimize the performance of the algorithm. This not only provides an ideal pre-test tool for clinical antimicrobial drug management, but also lays a foundation for the development of future molecular detection methods.

[0068] Further explanation of the technical terms used in this article:

[0069] Neisseria gonorrhoeae: Neisseria gonorrhoeae

[0070] Minimum Inhibitory Concentration (MIC): Minimum inhibitory concentration

[0071] Nucleic acid amplification tests (NAATs): Nucleic acid amplification tests

[0072] High Resolution Melting Curve Analysis (HRM): High Resolution Melting Curve Analysis

[0073] Whole Genome Sequencing (WGS): Whole genome sequencing BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 .Six-Codon Plus Result interpretation flow chart

[0075] Figure 2. Six-Codon Plus Method Assay1 and Assay2 amplification results

[0076] in,

[0077] Figure 2a Assay1 melting curve for 375-377, 501 target and opa gene

[0078] Figure 2b HRM-Assay2 melting curve for 542, 551 targets and porA gene

[0079] Figure 2cHRM-Assay2 melting curve for 311 target and porA gene DETAILED DESCRIPTION

[0080] The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0081] Embodiment 1, the detection method of the present invention

[0082] 1) Primer design for different detection targets

[0083] Based on the download of reference sequences from the GenBank database, the comparison of nucleic acid sequences from the NCBI database, and the multi-sequence BLAST of the Geneious R11 software, the conserved regions of the species identification genes opa and porA were finally determined for primer design; at the same time, the detection target penA gene was compared and analyzed with the help of the Geneious R11 software, and specific regions were selected for primer design. Multiple sets of HRM primers designed for each target were predicted in advance by the online Tm value prediction tool OligoCalc, and appropriate primer pairs were selected for further testing. The final primers for each target are shown in Table 1. After 12 repeated tests for each target point, the Tm values ​​were determined as shown in Table 2.

[0084] 2) HRM-Assay1 test for 375-377, 501 targets and opa gene

[0085] According to the reaction system of a single sample in Table 3, calculate the total amount of different reagents added except the template according to the number of samples in the reaction. Fully shake and mix, dispense 18μL into each well of the fluorescent quantitative PCR reaction plate, and then add 2μL of extracted nucleic acid, and the total HRM reaction system is 20μL. After the system is prepared, stick the sealing film, press the edge of the plate with a scraper, and put it into a flat centrifuge to avoid wall residues. Centrifuge at 500rpm for 30s, shake it fully and centrifuge it again. The amplification parameters of the QuantStudio 6 Flex real-time PCR instrument are shown in Table 4.

[0086] 3) HRM-Assay2 test for 311, 542, 551 targets and porA gene

[0087] According to the reaction system of a single sample in Table 5, calculate the total amount of different reagents added except the template according to the number of samples in the reaction. Fully shake and mix, dispense 18μL into each well of the fluorescent quantitative PCR reaction plate, and then add 2μL of extracted nucleic acid, and the total HRM reaction system is 20μL. After the system is prepared, stick the sealing film, press the edge of the plate with a scraper, and put it into a flat centrifuge to avoid wall residues. Centrifuge at 500rpm for 30s, shake it thoroughly and centrifuge it again. The amplification parameters of the QuantStudio 6 Flex real-time PCR instrument are shown in Table 4.

[0088] 4) Judge based on the results of the optimal detection strategy

[0089] First, the opa and porA genes are used to determine whether the sample to be tested is Neisseria gonorrhoeae. Double positive results can continue to be interpreted as low sensitivity / resistance. The interpretation criteria are as follows: Step 1. If the 375-377 sites in Assay1 are positive, it is judged as a mosaic penA type, and if it is negative, it is judged as a non-mosaic penA type. Step 2. In the mosaic penA gene, the 311 site in Assay2 is used to determine whether the 311 site is wild type or mutant. The wild type is judged as cephalosporin low sensitivity, and the mutant is judged as cephalosporin resistance. It is also used as an identification condition for the FC428 clone and its related strains. Step 3. In the non-mosaic penA gene, the 501 site in Assay1 is used to determine whether the 501 site is wild type or mutant. Step 4. The long product melting curve with a higher Tm value in Assay2 is used to determine whether the sequence between sites 542-551 is wild type, single mutant, or double mutant. Step 5: Use the melting curve of the short product with a lower Tm value in Assay2 to determine whether site 542 is wild type or mutant. When site 542 is wild type, if the melting curve of the long product shows wild type, then site 551 is wild type; if the melting curve of the long product shows a single mutant, then site 551 is mutant. If site 542 is mutant, if the melting curve of the long product shows a single mutant, then site 551 is wild type; if the melting curve of the long product shows a double mutant, then site 551 is mutant. See the attached result interpretation process for details. Figure 1 The results of amplifying each target by Assay1 and Assay2 are shown in Figure 2.

[0090] Example 2, kit

[0091] The kit provided by the present invention is used to detect 7 hyposensitive / drug-resistant related sites of Neisseria gonorrhoeae and opa and porA species identification genes, comprising the following steps:

[0092] 1. Nucleic acid extraction: Use a nucleic acid extraction kit to extract the test patient's swab / urine sample or its culture.

[0093] 2. HRM-Assay1 test for 375-377, 501 target and opa gene: premix 375-377, 501 target and opa gene primers in Table 1, Forget-Me-Not TM Master Mix reagent and nuclease-free water were shaken thoroughly and mixed, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL. The system was placed in the QuantStudio 6 Flex real-time PCR instrument with preset parameters for amplification.

[0094] 3. HRM-Assay2 test for 311, 542, 551 targets and porA gene: premix the primers related to 311, 542, 551 targets and porA gene in Table 1, Forget-Me-Not TM Master Mix reagent and nuclease-free water were shaken thoroughly and mixed, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL. The system was placed in the QuantStudio 6 Flex real-time PCR instrument with preset parameters for amplification.

[0095] 4. Interpretation of results: The opa and porA species identification genes were used to determine whether the sample was Neisseria gonorrhoeae. If so, the 375-377 sites in Assay1 were used to determine whether it was a mosaic penA type or a non-mosaic penA type. If it was a mosaic penA type, the 311 site in Assay2 was further used to determine whether the 311 site was wild type or mutant. The wild type was interpreted as cephalosporin hyposensitivity, and the mutant was interpreted as cephalosporin resistance, which was also used as a screening condition for the FC428 clone and its related strains. If it was a non-mosaic penA type, the 501 site, 542 site, and 551 site were judged to be wild type or mutant in turn. The interpretation strategy for 501, 542, and 551 was as follows: When conducting large-scale screening at the public health level: if a mutation occurred at the 501 site, it was interpreted as cephalosporin hyposensitivity; during auxiliary screening at the clinical level, if a mutation occurred at the 501 site combined with a mutation at any of the two sites, 542 and 551, it was interpreted as cephalosporin hyposensitivity.

[0096] Example 3: Detection effect of the present invention

[0097] 1. Specificity of the method

[0098] 1) Evaluation of the specificity of the detection reference strains / plasmids: Strains or plasmids containing the penA types in Table 6 were selected as reference samples, including 7 mosaic penA types containing A311V mutation, 2 mosaic penA types without A311V mutation, and 6 non-mosaic penA types for evaluating the specificity of Six-Codon Plus Specificity of the method. The evaluation results showed that the 375-377 sites can effectively amplify the mosaic penA gene, while the non-mosaic penA gene is not amplified; the 501, 542, and 551 sites can amplify the non-mosaic penA gene, while the mosaic penA gene is not amplified; at the same time, the 311, 501, 542, and 551 site targets can accurately distinguish between the wild type and the mutant type, among which the 311 site mutation can effectively identify the FC428 strain and its related strains.

[0099] Table 6. Six-Codon Plus Method development—specificity assessment of selected penA types

[0100]

[0101] 2) Evaluation of specificity in clinical strains: 397 clinical strain samples with known WGS sequencing data were collected to evaluate Six-Codon Plus The specificity of the method, all samples were confirmed as Neisseria gonorrhoeae by culture method, and the penA sequence of all samples was extracted by bioinformatics algorithm. The evaluation results showed that Six-Codon Plus The results of the method for detecting target sites 311, 375-377, 501, 542, and 551 were consistent with the actual sites of the penA sequence of the strain, and the specificity reached 100%.

[0102] 2. Sensitivity of the method

[0103] The strain / plasmid samples covering all the detection targets were selected, and the strain samples were quantified by fluorescent quantitative PCR. According to the initial quantitative results, the gradient dilution was 10000, 1000, 500, 200, 100, 50, 10, 2 (copies / reaction) of 8 gradient standards. The standard of each gradient was tested twelve times under the same reaction conditions. The results showed that the sensitivity of the 311, 375-377, 501, 542, 551 sites and opa, porA genes of the six-codon method was 10 copies / reaction.

[0104] 159 swab and urine samples collected from clinics were selected and quantified using fluorescent quantitative PCR. PlusThe method was tested, and the results showed that the detection rates of Assay1 and Assay2 in clinical swab samples were as high as 98.60% (141 / 143), and the detection rates of Assay1 and Assay2 in urine samples were as high as 81.25% (13 / 16). The negative results of a very small number of samples may be due to the low bacterial load in the clinical samples or the large number of internal interference factors in the clinical samples.

[0105] 3. Methods Scientific evaluation of low-sensitivity / resistance detection strategies

[0106] 773 strain samples with known drug resistance phenotype data from multiple centers were selected to evaluate the scientificity of each interpretation strategy for low sensitivity / resistance of Neisseria gonorrhoeae cephalosporins proposed in Table 1. The results showed that for large-scale screening at the public health level, strategy 3 (detection of mosaic penA gene without A311V mutation or non-mosaic penA gene with 501 site mutation) can be used as the optimal low sensitivity interpretation strategy for cephalosporins; for auxiliary screening at the clinical level, strategy 2 (detection of mosaic penA gene without A311V mutation or non-mosaic penA gene with 501 site mutation combined with any one of the two sites 542 and 551) can be used as the optimal low sensitivity interpretation strategy for cephalosporins. Furthermore, if the 311 target of the mosaic penA type is determined to be a mutant type, it can be used as a interpretation strategy for cephalosporin resistance and as a screening condition for FC428 and its related clones.

[0107] 4. Intersectionality of methods

[0108] Seventeen non-gonococcal Neisseria strains were selected for interspecies cross-identification testing. The results showed that there was no nonspecific amplification when opa and porA double positivity was used as the species identification standard.

[0109] Sequence Listing:

[0110] opa

[0111] F:CCGGCGGCTTCAGCACCTTAGGGAACCG

[0112] R:CGGCGGCCGTTGGCGGATGAACAAAAACCG

[0113] penA_375-377

[0114] F:ACGTCGGTACCAGTAAACTTTCTGC

[0115] R:CGTGATAGAAATCGTACATTTCTTT

[0116] penA_501

[0117] F:GATGTCGGCGCTAAAACC

[0118] R:AGCGGCCATTGACCAGTT

[0119] penA_542

[0120] F:CGACGAACCGACTGCCCAC

[0121] R:GCCACTACGCCGCCGTAATAG

[0122] penA_551

[0123] R:GCCCATAATTTTTTTGAAGGG

[0124] penA_311

[0125] F:CCGTTACCGACATGATCGAACCTGG

[0126] R:TTTGGCAATGGTAAACGGCTTCATG

[0127] porA

[0128] F:CCTGCTACTTTCACGCTGGA

[0129] R:CCGGAACTGGTTTCATCTGA

Claims

1. A method for detecting drug resistance sites of Neisseria gonorrhoeae, characterized in that: The high-resolution melting curve method was used to detect the following seven drug resistance targets of Neisseria gonorrhoeae: penA_375-377, penA_501, penA_542, penA_551, penA_311, and species identification genes opa and porA.

2. The method according to claim 1, characterized in that The targets mentioned herein cover key sites related to cephalosporin hyposensitivity / resistance in mosaic penA types and non-mosaic penA types, and can also screen the internationally-focused FC428 strain and its related strains.

3. The method according to claim 1, characterized in that The method comprises amplifying the DNA of Neisseria gonorrhoeae using primers of sequences 1-13 in the sequence table, wherein the primer sequences are as follows: Based on the amplification results, determine whether the sample to be tested is Neisseria gonorrhoeae and make a prediction of cephalosporin low sensitivity / resistance.

4. The method according to claim 3, characterized in that The method for determining whether the sample to be tested is Neisseria gonorrhoeae is as follows: first, determine whether the sample to be tested is Neisseria gonorrhoeae through the opa and porA genes. If the double positive result is, the cephalosporin low sensitivity / resistance can be judged. The judgment criteria are as follows: Step 1, if the 375-377 sites in Assay1 are positive, it is judged as a mosaic penA type, and if it is negative, it is judged as a non-mosaic penA type. Step 2, in the mosaic penA gene, the 311 site in Assay2 is used to determine whether the 311 site is a wild type or a mutant type. The wild type is judged as cephalosporin low sensitivity, and the mutant type is judged as cephalosporin resistance. At the same time, the mutant type is used as the identification condition for the FC428 clone strain and its related strains. Step 3, in the non-mosaic penA gene, through The 501 site in Assay1 determines whether the 501 site is wild type or mutant. The fourth step is to determine whether the 542 and 551 sites are wild type, single mutant or double mutant as a whole through the melting curve of the long product with a higher Tm value in Assay2. The fifth step is to determine whether the 542 site is wild type or mutant through the melting curve of the short product with a lower Tm value in Assay2. When the 542 site is wild type, if the melting curve of the long product shows wild type, then the 551 site is wild type; if the melting curve of the long product shows a single mutant, then the 551 site is mutant. If the 542 site is mutant, if the melting curve of the long product shows a single mutant, then the 551 site is wild type; if the melting curve of the long product shows a double mutant, then the 551 site is mutant.

5. A kit, characterized in that: Comprising the primer described in claim 3.

6. The kit according to claim 5 is used to detect low-sensitivity / drug-resistant site mutations of Neisseria gonorrhoeae and screen the internationally concerned drug-resistant strain FC428 and its related strains, providing technical support for the rapid screening of low-sensitivity / drug-resistant strains in molecular epidemiological investigation and the clinical formulation of correct gonorrhea treatment plans.

7. The method for using the kit according to claim 5, characterized in that: The following steps are involved: 1) Nucleic acid extraction: Use a nucleic acid extraction kit to extract the swab / urine sample or its culture from the test patient; 2) HRM-Assay1 test for 375-377, 501 target and opa gene: premixed 375-377, 501 target and opa gene primers, Forget-Me-Not TM Master Mix reagent and nuclease-free water were thoroughly shaken and mixed, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL. The system was placed in the QuantStudio 6Flex real-time PCR instrument with preset parameters for amplification. 3) HRM-Assay2 test for 311, 542, 551 targets and porA gene: premixed primers related to 311, 542, 551 targets and porA gene, Forget-Me-Not TM Master Mix reagent and nuclease-free water were thoroughly shaken and mixed, and 18 μL was dispensed into the fluorescence quantitative PCR reaction plate. Then 2 μL of extracted nucleic acid was added to the final volume of the system to 20 μL. The system was placed in the QuantStudio 6Flex real-time PCR instrument with preset parameters for amplification. 4) Result interpretation: Use opa and porA species identification genes to determine whether the sample is Neisseria gonorrhoeae; if so, use loci 375-377 in Assay1 to determine whether it is a mosaic penA type or a non-mosaic penA type; if it is a mosaic penA type, further use loci 311 in Assay2 to determine whether loci 311 is wild type or mutant type. The wild type is interpreted as cephalosporin hyposensitivity, and the mutant type is interpreted as cephalosporin resistance. It is also used as a screening condition for FC428 clones and related strains; If it is a non-mosaic penA type, determine whether sites 501, 542, and 551 are wild-type or mutant in turn. The interpretation strategy for 501, 542, and 551 is as follows: when conducting large-scale screening at the public health level: if a mutation occurs at site 501, it is interpreted as low sensitivity to cephalosporins; during auxiliary screening at the clinical level, if a mutation occurs at site 501 combined with a mutation at any of sites 542 or 551, it is interpreted as low sensitivity to cephalosporins.

Images