CRISPR-cas12a / cas13a-based detection method for simultaneously detecting DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) of hepatitis B virus and application of CRISPR-cas12a / cas13a-based detection method

Abstract

The invention discloses a detection system for simultaneously detecting HBV (Hepatitis B Virus) DNA (Deoxyribose Nucleic Acid) and HBV RNA (Ribonucleic Acid) based on CRISPR-cas12a / cas13a. According to the invention, a PCR primer is designed to amplify conserved intervals of different genotypes of HBV DNA, and a PCR primer with a T7 promoter is designed to amplify a conserved sequence of HBV RNA. In the same detection system, crRNA of cas12a / cas13a can specifically recognize amplification products of the crRNA respectively, HBV DNA and HBV RNA can be detected in a single tube at the same time, and finally visual detection is achieved through direct color development of dual fluorescence. According to the method, HBV DNA and HBV RNA can be efficiently, specifically and accurately detected, so that the clinical antiviral curative effect of the chronic hepatitis B patient is better monitored, medication is guided, and accurate treatment on the chronic hepatitis B patient is facilitated.

Description

Technical Field

[0001] The present application relates to the technical field of hepatitis B virus, and more specifically, to a detection method and application of hepatitis B virus DNA and RNA simultaneously detected based on CRISPR-cas12a / cas13a. Background Art

[0002] Hepatitis B virus (HBV) infection remains a serious public health problem. HBV infection can lead to chronic hepatitis B (CHB) liver cirrhosis and liver cancer. Currently, the main drugs used in the treatment of CHB are nucleoside analogues (NA) and interferon, which can significantly inhibit viral replication, but are prone to rebound after drug withdrawal, so long-term medication is required. At the same time, these two types of drugs cannot completely eliminate covalently closed circular DNA (cccDNA) in hepatocytes. The persistent presence of cccDNA in the liver is a key factor in the persistent infection of CHB. Detection of cccDNA levels or transcriptional activity is a direct indicator for evaluating antiviral efficacy. However, due to the low level of cccDNA in the liver, it is difficult to detect; at the same time, since direct detection of cccDNA in the liver is an invasive test, it is difficult to promote and apply in clinical practice. Therefore, there is an urgent need for non-invasive indicators that can reflect the level or activity of viral cccDNA in the liver.

[0003] Classic HBV viral markers include serological markers and molecular biological markers. Serum HBV DNA is the most commonly used viral marker for diagnosing HBV infection and monitoring antiviral treatment, reflecting the level of viral replication. However, in some patients with chronic hepatitis B, after NAs antiviral treatment, HBV DNA decreased significantly, even below the limit of detection (LOD), and the level or activity of cccDNA in the liver can still be detected, indicating that there is a risk of viral rebound after NAs withdrawal. Therefore, it is not an ideal indicator to reflect the activity of viral cccDNA. In addition, after NAs treatment, HBsAg in HBeAg-negative patients is more derived from integrated DNA coding, so it cannot accurately reflect the activity of viral cccDNA.

[0004] Recently, HBV RNA in serum has been used as a new serum marker for hepatitis B cure, which can reflect the level or activity of cccDNA in the liver. HBV RNA in serum mainly includes pregenomic RNA (pgRNA), which exists in enveloped RNA-like particles and naked nucleocapsids without envelopes in the form of full-length and spliceosomes. Its source is mainly formed by direct transcription of HBV cccDNA. The content of pgRNA in serum is positively correlated with the content of pgRNA in hepatocytes. As a product of cccDNA transcription, HBV RNA in serum can better reflect the level and transcriptional activity of cccDNA in hepatocytes, which is an ideal detection target. Especially during NAs treatment, HBV DNA is below the detection limit. By detecting the level of HBV RNA, the response to NAs treatment can be predicted, the patient's drug withdrawal can be guided, and the risk of disease recurrence caused by drug withdrawal can be avoided. Therefore, simultaneous monitoring of HBV DNA and HBV RNA levels is helpful for the evaluation of viral replication and antiviral efficacy, and serves as a dual indicator for the evaluation of antiviral efficacy after clinical NAs treatment.

[0005] At present, the clinical detection methods for HBV DNA and HBV RNA mainly rely on nucleic acid-based detection, namely polymerase chain reaction (PCR) and reverse transcription-fluorescence quantitative PCR (RT-qPCR). Real-time fluorescence quantitative PCR detection of HBV DNA and HBV RNA is required respectively, and HBV DNA and HBV RNA cannot be detected simultaneously in the same system. Moreover, traditional single or multiple fluorescence quantitative detection of nucleic acids requires professional operating technicians and expensive instruments and equipment, resulting in cumbersome detection process, increased costs and reduced efficiency. Therefore, in order to better monitor the clinical antiviral efficacy of patients with chronic hepatitis B and guide medication, it is very important to develop a method for efficient and accurate detection of hepatitis B virus to facilitate accurate treatment of patients with chronic hepatitis B. Summary of the invention

[0006] In order to better monitor the clinical antiviral efficacy of chronic hepatitis B patients and guide medication, a method for efficiently and accurately detecting hepatitis B virus replication and viral activity was developed. This application provides a detection method and application of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a.

[0007] The detection method and application of CRISPR-cas12a / cas13a for simultaneous detection of hepatitis B virus DNA and RNA provided in this application adopts the following technical solutions: A detection method for simultaneously detecting hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a, comprising the following steps: S1. Design specific primers to amplify the target fragment based on the serum of HBV infected persons: Design PCR primers to amplify the conserved sequence of HBV DNA to obtain HBV DNA amplification products; Design PCR primers with T7 promoter to amplify the conservative sequence of HBV RNA and obtain HBV RNA amplification product; S2. Detection by CRISPR-Cas12a / Cas13a detection system: Establish a single system for detecting HBV DNA using the CRISPR-Cas12a detection system; Establish a single system for detecting HBV RNA using the CRISPR-Cas13a detection system; The CRISPR-Cas12a and CRISPR-Cas13a detection systems were integrated to establish a detection system for simultaneously detecting HBV DNA and HBV RNA, in which the crRNA of the Cas12a system recognized and bound to the HBV DNA amplification product, and the crRNA of the Cas13a system recognized and bound to the HBV RNA amplification product.

[0008] Preferably, when establishing a single system for detecting HBV RNA using a CRISPR-Cas13a detection system, a PCR upstream primer HBV RNA-FP and a downstream primer HBV RNA-RP are designed in the target region for detecting HBV RNA to amplify the conserved sequence of HBV RNA to obtain a target gene fragment, i.e., an HBV RNA amplification product; The nucleotide sequence of the HBV RNA-FP is shown in SEQ ID NO.1, and the nucleotide sequence of the HBV-RNA-RP is shown in SEQ ID NO.2.

[0009] Preferably, when establishing a single system for detecting HBV RNA using the CRISPR-Cas13a detection system, the target region for detecting serum HBV RNA is designed to be outside the SP1 spliceosome (nt2447-nt489), located between nt1500-nt1800; the target region for detecting HBV DNA is located in the nt100-nt800 interval.

[0010] Preferably, when establishing a single system for detecting HBV RNA using a CRISPR-Cas13a detection system, multiple crRNAs are designed for screening the HBV RNA amplification product to screen out RNA-crRNA1 with high activation activity, and the nucleotide sequence of the RNA-crRNA1 is shown in SEQ ID NO.3.

[0011] Preferably, when establishing a single system for detecting HBV DNA using a CRISPR-Cas12a detection system, a PCR upstream primer HBV DNA-FP and a downstream primer HBV DNA-RP are designed in the target region for detecting HBV DNA to amplify the conserved sequence of HBV DNA to obtain a target gene fragment, i.e., an HBV DNA amplification product; The nucleotide sequence of the HBV DNA-FP is shown in SEQ ID NO.4, and the nucleotide sequence of the HBV DNA-RP is shown in SEQ ID NO.5.

[0012] Preferably, when establishing a single system for detecting HBV RNA using the CRISPR-Cas12a detection system, multiple crRNAs are designed for screening the HBV DNA amplification product to screen out DNA-crRNA2 with high activation activity, and the nucleotide sequence of the DNA-crRNA2 is shown in SEQ ID NO.6.

[0013] Preferably, the components of the cas12a / cas13a detection system include Lwacas13a (100nM), crRNA1 (100nM), ssRNA reporter (10μM), RNaseinhibitor, 10×reaction buffer, Cas12a (2μM), crRNA2 (2μM), ssDNA reporter (10μM), T7 RNApolymerase, rNTP MIX (25mM), HBV DNA amplification product, HBV RNA amplification product and enzyme-free water.

[0014] Preferably, the detection system integrating CRISPR-cas12a / cas13a for detecting HBV DNA and HBV RNA is visualized, and the fluorescent probe emits light of different colors after being cut, and the detection result is directly reflected by interpreting the fluorescent color under blue light or ultraviolet irradiation.

[0015] Such as the application of the above detection method in the detection of hepatitis B virus.

[0016] In summary, the present application has at least the following beneficial effects: The present invention combines PCR and CRISPR-cas12a / cas13a detection systems for the first time to simultaneously detect HBV DNA and HBV RNA in a single tube with high sensitivity and strong specificity. It can also shorten the detection time, save detection costs, and improve detection efficiency. It also realizes visualization of HBV DNA and HBV RNA detection through different fluorescent probes, which is convenient for real-time application in clinical detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of the detection principle of PCR-cas12a / cas13a for detecting HBV DNA and HBV RNA.

[0018] Figure 2 This is the sensitivity result graph of PCR-CRISPR / cas13a detection of HBV RNA; (A) Fluorescence results of PCR-CRISPR / cas13a detection of different concentrations of HBV replication plasmids (30 min); (B) LOD of HBV plasmid detected by PCR-CRISPR / cas13a.

[0019] Figure 3 This is the sensitivity result graph of PCR-CRISPR / cas12a detection of HBV DNA; (A) Fluorescence results of PCR-CRISPR / cas12a detection of different concentrations of HBV replication plasmid (30min); (B) LOD of HBV DNA detected by PCR-CRISPR / cas12.

[0020] Figure 4 It is a schematic diagram of the results of the mutual interference experiment of the PCR-cas12a / cas13a system; (A) Schematic diagram of the results when only the cas13a target was added to the cas12a / cas13a detection system; (B) Schematic diagram of the results when only the cas12a target was added to the cas12a / cas13a detection system.

[0021] Figure 5 This is the sensitivity result graph of the PCR-cas12a / cas13a detection system for simultaneous detection of HBV DNA and HBV RNA (30 min).

[0022] Figure 6 It is a schematic diagram of the visualization results of the PCR-cas12a / cas13a detection system detecting dual targets.

[0023] Figure 7 This is a schematic diagram of the visualization sensitivity of the PCR-cas12a / cas13a detection system for simultaneous detection of dual targets. DETAILED DESCRIPTION

[0024] The present application is further described in detail below with reference to the embodiments.

[0025] First, the 0-3215 bp segment of HBV genotype C (AF533983.1) was connected to the puc57 vector to construct a plasmid containing HBV DNA and HBV RNA sequences as a standard plasmid template. The specific steps are as follows: 1. Standard plasmid construction HBV genotype C (AF533983.1) was downloaded from the NCBI website and its 0-3215 bp segment was connected to the puc57 vector to construct a haploid plasmid containing HBV DNA and HBV RNA sequences as a standard plasmid template. The above plasmid construction was completed by Shanghai Sangon Biotechnology Co., Ltd.

[0026] 2. Conversion (1) Mix 20-50 ng of plasmid with 20 μL of DH5α competent cells, mix gently, place on ice for 30 min, heat at 42 °C for 45 s, and place on ice for 2 min; (2) Add 200 μL LB medium and incubate at 37°C, 200 rpm on a shaker for 45 min. (3) Take 100 μL of the culture medium, mix well, and spread it on the prepared LB plate containing Amp. Incubate it upright at 37°C for 30 min and then invert it to culture overnight. (4) After overnight, select a single white colony and place it in an appropriate amount of LB liquid culture medium containing Amp. Incubate at 37°C, 200 rpm with shaking for 12-16 hours.

[0027] 3. Plasmid Extraction According to the instructions, use the plasmid extraction kit to extract and purify the plasmid. The specific steps are as follows: (1) Centrifuge at 10,000 × g for 1 min at room temperature to collect the cells. (2) Discard the culture medium and aspirate the residual liquid. Add 250 µL of Buffer P1 (with RNase A added, stored at 4°C), vortex and resuspend; (3) Add 250 µL of Buffer P2 and gently invert the tube 8 to 10 times to mix. (4) Add 350 µL of Buffer P3 and immediately invert 8 to 10 times to thoroughly neutralize and mix the solution; (5) Centrifuge at 13,000 × g for 10 min at room temperature; (6) Place the adsorption column in a 2 mL collection tube and pipette the supernatant into the column. Centrifuge at 13,000 × g for 1 minute at room temperature and discard the filtrate. (7) Add 500 µl of Buffer PW1. Centrifuge at 13,000 × g for 1 min at room temperature and discard the filtrate. (8) Add 600 µL Buffer PW2. Centrifuge at 13,000 × g for 1 minute at room temperature and discard the filtrate. (9) Add 600 µL of Buffer PW2. Centrifuge at 13,000 × g for 1 minute at room temperature and discard the filtrate. (10) Centrifuge at 13,000 × g for 1 min at room temperature; (11) Place the column in a sterile 1.5 mL centrifuge tube. Add 30 µL of Elution Buffer to the center of the column membrane. Let stand for 1 minute, and centrifuge at 13,000 × g for 1 minute to elute the DNA. (12) Measure the plasmid concentration and send the plasmid to Shanghai Sangon Biotechnology Co., Ltd. for sequencing verification. Store at -20℃.

[0028] like Figure 1 As shown, the detection method of the present application for simultaneously detecting hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a includes two parts: S1. Design specific primers to amplify the target fragment based on the serum of HBV infected persons: Design PCR primers to amplify the conserved sequence of HBV DNA to obtain HBV DNA amplification products; Design PCR primers with T7 promoter to amplify the conservative sequence of HBV RNA and obtain HBV RNA amplification product; S2. Detection by CRISPR-Cas12a / Cas13a detection system: Establish a single system for detecting HBV DNA using the CRISPR-Cas12a detection system; Establish a single system for detecting HBV RNA using the CRISPR-Cas13a detection system; The CRISPR-Cas12a and CRISPR-Cas13a detection systems were integrated to establish a detection system for simultaneously detecting HBV DNA and HBV RNA, in which the crRNA of the Cas12a system recognized and bound to the HBV DNA amplification product, and the crRNA of the Cas13a system recognized and bound to the HBV RNA amplification product.

[0029] Specifically: 1. CRISPR-Cas13a detection system for HBV RNA HBV RNA in the serum of HBV infected patients includes a variety of pgRNA spliceosomes, among which SP1 is the most important spliceosome. In order to avoid missed detection of serum HBV RNA, we designed the target region for detecting serum HBV RNA outside the SP1 spliceosome (nt2447-nt489). The present invention designs PCR upstream primers FP and downstream RP (as shown in Table 1) in the target region for detecting HBV RNA to amplify the HBV RNA conservative sequence to obtain the target gene fragment. In this process, 25μL PCR reaction solution was configured, including 12.5μL Premix Taq (TaKaRa), 400nM each of upstream and downstream primers, and 1μL template. The PCR reaction program is: 95℃ 5min-(95℃ 30s-60℃ 30s-72℃15s)×30-72℃ 10min -4℃.

[0030] Table 1 PCR primer sequences for amplifying HBV RNA Primer name Primer sequence (5'-3') HBV RNA-FP TAATACGACTCACTATAGGGGTGCCTTCTCATCTGCCG HBV RNA-RP GCCTCAAGGTCGGTCGTT Multiple crRNAs were designed for the HBV RNA amplification segment for screening, and crRNA1 with high activation activity was screened out (as shown in Table 2). In the detection process of Cas13a enzyme, Cas13a protein recognizes the target RNA transcribed by T7 RNA transcriptase through crRNA1, forming a ternary complex of Cas13a-crRNA1-target RNA, thereby stimulating the cis-cleavage activity of Cas13a to cut the target RNA bound to crRNA, and also activating its trans-cleavage activity, which can non-specifically cut the fluorescently labeled single-stranded RNA reporter probe to achieve the effect of signal amplification. The results are interpreted by the fluorescence after the reporter probe is cut in the detection system.

[0031] Table 2 Cas13a detection system crRNA sequence and fluorescent reporter probe sequence sequence name Sequence (5'-3') RNA-crRNA1 GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC GUCGGUCGUUGACAUUGCUGAGAGUCCA ssRNA reporter 6-FAM-TrUrUrUrUrUrC-BHQ1 In this reaction, the target fragment amplified by HBV RNA is added to the cas13a detection system for detection, and the system includes: Cas13a, crRNA1, ssRNA reporter, cas13a reaction buffer, Murine RNase inhibitor, T7RNA polymerase, NTP mixture, RNase-free water. After the system is mixed, the fluorescence value of the FAM channel is detected once every 30 seconds at 37°C on a fluorescent quantitative PCR instrument (Bio-Rad), and the fluorescence value is collected for one hour. The detection system of cas13a is shown in Table 3.

[0032] Table 3 Cas13a detection system Components volume Lwacas13a (100nM) 2.4μL crRNA1(100nM) 1.2μL ssRNA reporter (10μM) 0.8μL RNase inhibitor 0.5μL 10×cas13a reaction buffer 2μL T7 RNA polymerase 0.5μL rNTP MIX (25mM) 0.8μL RNase-free water Make up to 20 μL PCR amplification products 2μL Lwacas13a protein and 10×cas13a buffer were purchased from Megabio; T7 RNA Polymerase was purchased from NEB (catalog number: M0251S), rNTP mixed solution was purchased from NEB (catalog number: N0466S), Murine RNase inhibitor was purchased from Nanjing Novozymes Biotech Co., Ltd. (catalog number: R301-02), crRNA1 and ssRNA reporter sequences were synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the specific sequences are shown in Table 2.

[0033] The sensitivity of PCR-CRISPR / cas13a was verified by using the HBV genotype C standard plasmid as a template and obtaining 6.57×10 4 copies / μL, 6.57×10 3 copies / μL, 6.57×10 2 copies / μL, 6.57×10 1 copies / μL, 6.57×10 0 copies / μL, 6.57×10 -1 The above templates of different concentrations were tested by PCR-CRISPR / cas13a detection method. The results showed that the sensitivity of PCR-CRISPR / cas13a in detecting HBV RNA can reach 0.65 copies / μL (such as Figure 2 -A), the lowest limit of detection (LOD) was 6.57 copies / μL (as shown in Figure 2 -B).

[0034] 2. CRISPR-cas12a detection system for HBV DNA The present invention optimizes and screens the PCR upstream primer (FP) and downstream primer (RP) in the region for detecting HBV DNA (as shown in Table 4), and amplifies the target HBV DNA gene fragment.

[0035] Table 4 PCR primer sequences for amplifying HBV DNA segments Primer sequences Sequence (5'-3') HBV DNA-FP CTTGTTGACAAGAATCCTCACAGTACCACAG HBV DNA-RP TAGTCCAGAAGAACCAACAAGAAGATGAGGC The reaction prepared 25μL PCR reaction solution, including 12.5μL Premix Taq (TaKaRa), 400nM upstream and downstream primers, and 1μL template. The PCR reaction program was set as follows: 95℃ 5min-(95℃ 30s-60℃ 30s-72℃15s)×30-72℃ 10min -4℃. Multiple crRNAs were designed for screening in the amplified segment, and the best crRNA2 was screened out. In the detection process of cas12a enzyme, cas12a protein recognizes the target DNA sequence in the amplified product through crRNA2 to form a cas12a-crRNA2-target DNA ternary complex, thereby stimulating the cis-cleavage activity of cas12a to cut the target DNA bound to crRNA, and also activating its trans-cleavage activity, which can non-specifically cut the fluorescently labeled single-stranded DNA reporter probe in the system. The results are interpreted by the fluorescence after the reporter probe is cut in the detection system.

[0036] Table 5 crRNA sequence and fluorescent probe sequence of cas12a detection system sequence name Sequence (5'-3') DNA-crRNA2 UAAUUUCUACUAAGUGUAGAUCUAGGGGGAGCACCCACGUGUCC ssDNA reporter HEX—CCCCCC—BHQ1 The target fragment amplified by PCR was added to the cas12a detection system for detection. The system includes: cas12a, crRNA2, ssDNA reporter, cas12a reaction buffer, RNase inhibitor, and RNase-free water. After the system was mixed, the fluorescence value of the HEX channel was detected once every 30 seconds at 37°C on a fluorescent quantitative PCR instrument (Bio-Rad), and the fluorescence value was collected within one hour. The detection system of cas12a is shown in Table 6 Table 6 Cas12a detection system Components volume Cas12a (2 μM) 0.4μL CrRNA2 (2 μM) 0.4μL ssDNA reporter (10 μM) 1.2μL RNase inhibitor 0.5μL 10×Reaction buffer 2μL DNA amplification products 2μL Enzyme-free water 13.5μL Cas12a protein and 10× reaction buffer were purchased from Megabio, Murine RNase inhibitor was purchased from Nanjing Novozyme Biotechnology Co., Ltd. (Cat. No. R301-02), crRNA2 and ssDNA reporter sequences were synthesized by Shanghai Bioengineering Co., Ltd., and the specific sequences are shown in Table 5.

[0037] The sensitivity of PCR-CRISPR / cas12a in detecting HBV DNA was verified. Using the HBV genotype C standard plasmid as a template, 5.8×10 4 copies / μL、5.8×10 3 copies / μL, 5.8×10 2 copies / μL, 5.8×101 copies / μL, 5.8×10 0 copies / μL, 5.8×10 -1 The results showed that the sensitivity of PCR-CRISPR / cas12a in detecting HBV DNA can reach 0.58 copies / μL (e.g. Figure 3 -A), the minimum detection limit LOD was 5.8 copies / μL (as shown in Figure 3 -B).

[0038] 3. Integrate CRISPR-cas12a / cas13a detection system for HBV DNA and HBV RNA Based on the successful establishment of the single detection system of cas12a and cas13a, the present invention establishes a dual nucleic acid fluorescence detection method mediated by CRISPR / Cas12a and Cas13a. The detection principle diagram of this method is as follows: Figure 1 Here, considering the possible crosstalk between dual fluorescence detection, we chose to replace the FAM-labeled ssRNA reporter with the ROX-labeled ssRNA reporter (as shown in Table 6). The ssDNA reporter-HEX fluorescent reporter probe was used to reflect the cleavage effect of cas12a, and the ssRNA reporter-ROX fluorescent reporter probe was used to reflect the cleavage effect of cas13a.

[0039] Table 7 ssRNA fluorescent reporter probe sequences of cas12a / cas13a system sequence name Sequence (5'-3') ssRNA reporter-ROX ROX-UUUUUU-BHQ2 First, the present invention verifies whether there is mutual interference in the cas12a / cas13a cutting system. In the cas12a / cas13a cutting system, the target fragment of cas12a and the target fragment of cas13a were added respectively. The results showed that when only the target fragment of cas12a was added to start the cas12a / cas13a cutting system, only the HEX fluorescence of the cut after cas12a was activated was detected, while the ROX corresponding to cas13a was not cut, and the ROX fluorescence was not detected. Similarly, in the cas12a / cas13a cutting system to which only the target fragment of cas13a was added, only the ROX fluorescence of the activated cas13a was detected, and the HEX fluorescence was not detected. It is proved that the cas12a / cas13a detection system established by the present invention can complete the simultaneous detection of dual targets, and there is no mutual interference (such as Figure 4 as shown).

[0040] Using the HBV genotype C standard plasmid as a template, 5.8×10 4 copies / μL, 5.8×10 3 copies / μL, 5.8×10 2 copies / μL, 5.8×10 1 copies / μL, 5.8×10 0 copies / μL, 5.8×10 -1 The sensitivity of the PCR-cas12a / cas13a cleavage system for simultaneous detection of HBV DNA and HBV RNA was evaluated using the above templates of different concentrations. The detection system is shown in Table 8.

[0041] Table 8 Cas12a / Cas13a cleavage system Components volume Lwacas13a(100nM) 2.4μL crRNA1(100nM) 1.2μL ssRNA reporter (10μM) 0.8μL RNase inhibitor 0.5μL 10×reaction buffer 2μL Cas12a (2 μM) 0.4μL crRNA2 (2 μM) 0.4μL ssDNA reporter (10 μM) 1.2μL T7 RNA polymerase 0.25μL rNTP MIX (25mM) 0.2μL HBV DNA amplification products 2μL HBV RNA amplification products 2μL Enzyme-free water Make up to 20 μL The results showed that PCR combined with cas12a / cas13a could simultaneously detect HBV DNA and HBV RNA, with a detection sensitivity of 0.58 copies / μL (e.g. Figure 5 Therefore, we established a highly sensitive PCR-cas12a / cas13a detection method for simultaneous detection of HBV DNA and HBV RNA.

[0042] 4. Visualization of the detection system integrating CRISPR-cas12a / cas13a for detecting HBV DNA and HBV RNA The fluorescent probes used in this experiment can emit light of different colors after being cut, and the detection results can be directly reflected by judging the fluorescence color under blue light or ultraviolet irradiation. When the fluorescent probe is intact, BHQ quenches the fluorescence emitted by HEX or ROX through fluorescence resonance energy transfer (FRET) and does not fluoresce. After the ROX-UUUUUU-BHQ2 fluorescent reporter probe is cut, the fluorescent group of the fluorescent probe is separated from the quenching group, and ROX produces red fluorescence; after the HEX-CCCCCC-BHQ1 fluorescent reporter probe is cut, HEX produces green fluorescence. In the cas12a / cas13a cutting system, when both fluorescent probes are cut, the green fluorescence and the red fluorescence overlap and appear as yellow fluorescence, realizing the "green-red-yellow" three-color fluorescence signal conversion to characterize the presence of dual molecular targets, which is convenient for direct judgment of the results. Cas12a detects HBV DNA sequence, corresponding to the HEX-modified ssDNA reporter group, which displays green under blue light; Cas13a detects HBV RNA sequence, corresponding to the ROX-modified ssRNA reporter group, which displays red under blue light; when both targets are present, they display yellow under blue light. Figure 6 shown.

[0043] Using HBV genotype C standard plasmid as template, 10 4 copies / μL-10 - 1 The above different concentrations were PCR amplified, and the amplified fragments were added to the cas12a / cas13a cutting system. After reacting at 37°C for 30 minutes, the results were observed directly under blue light. The results showed that the detection sensitivity of PCR-CRISPR-cas12a / cas13a visualization fluorescence was 5.8 copies / μL. At 0.58 copies / μL, the fluorescence value of HBV DNA detection was low and could not be observed under blue light. Only the red fluorescence of HBV RNA could be observed. Figure 7 Therefore, the present invention successfully established a new technology for simultaneously detecting two nucleic acid targets based on the "green-red-yellow" fluorescence signal conversion mediated by CRISPR / cas12a and Cas13a.

[0044] Note: The sequences of the fluorescent reporter probes used in the detection belong to the prior art and have been publicly reported at home and abroad, namely, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9.

[0045] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

[0046] Sequence Listing Information: Software Name: WIPO Sequence Software version: 2.3.0 Basic Information: Applicant's name: Chongqing Medical University Invention Title: Detection method and application of simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a Total number of sequences: 9 sequence: Serial Number(ID): 1 Length: 38 Molecule Type: DNA Residue: taatacgact cactataggg gtgccttctc atctgccg 38 Serial Number(ID): 2 Length: 18 Molecule Type: DNA Residue: gcctcaaggt cggtcgtt 18 Serial Number(ID): 3 Length: 64 Molecule Type: RNA Residue: gatttagact accccaaaaa cgaaggggac taaaacgtcg gtcgttgaca ttgctgagag 60 tcca 64 Serial Number(ID): 4 Length: 31 Molecule Type: DNA Residue: cttgttgaca agaatcctca cagtaccaca g 31 Serial Number(ID): 5 Length: 31 Molecule Type: DNA Residue: tagtccagaa gaaccaacaa gaagatgagg c 31 Serial Number(ID): 6 Length: 44 Molecule Type: RNA Residue: taatttctac taagtgtaga tctaggggga gcacccacgt gtcc 44 Serial Number(ID): 7 Length: 7 Molecule Type: RNA Residue: ttttttc 7 Serial Number(ID): 8 Length: 6 Molecule Type: DNA Residue: cccccc 6 Serial Number(ID): 9 Length: 6 Molecule Type: RNA Residue: tttttt 6 。

Claims

1. A detection method for simultaneously detecting hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a, characterized in that, The steps include: S1. Design specific primers to amplify the target fragment based on the serum of HBV infected persons: Design PCR primers to amplify the conserved sequence of HBV DNA to obtain HBV DNA amplification products; Design PCR primers with T7 promoter to amplify the conservative sequence of HBV RNA and obtain HBV RNA amplification product; S2. Detection by CRISPR-Cas12a / Cas13a detection system: Establish a single system for detecting HBV DNA using the CRISPR-Cas12a detection system; Establish a single system for detecting HBV RNA using the CRISPR-Cas13a detection system; The CRISPR-Cas12a and CRISPR-Cas13a detection systems were integrated to establish a detection system for simultaneously detecting HBV DNA and HBV RNA, in which the crRNA of the Cas12a system recognized and bound to the HBV DNA amplification product, and the crRNA of the Cas13a system recognized and bound to the HBV RNA amplification product.

2. The detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 1, characterized in that: When establishing a single system for detecting HBV RNA using the CRISPR-Cas13a detection system, the PCR upstream primer HBV RNA-FP and the downstream primer HBV RNA-RP are designed in the target region for detecting HBV RNA to amplify the conserved sequence of HBV RNA and obtain the target gene fragment, i.e., the HBV RNA amplification product; The nucleotide sequence of the HBV RNA-FP is shown in SEQ ID NO.1, and the nucleotide sequence of the HBV RNA-RP is shown in SEQ ID NO.

2.

3. The detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 2, characterized in that: When establishing a single system for detecting HBV RNA using the CRISPR-Cas13a detection system, the target region for detecting serum HBV RNA was designed to be outside the SP1 spliceosome (nt2447-nt489), between nt1500-nt1800; the target region for detecting HBV DNA was located in the nt100-nt800 range.

4. The detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 2, characterized in that: When establishing a single system for detecting HBV RNA by the CRISPR-Cas13a detection system, multiple crRNAs are designed for screening the HBV RNA amplification product, and RNA-crRNA1 with high activation activity is screened out. The nucleotide sequence of the RNA-crRNA1 is shown in SEQ ID NO.

3.

5. The detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 4, characterized in that: When establishing a single system for detecting HBV DNA using the CRISPR-Cas12a detection system, the PCR upstream primer HBV DNA-FP and the downstream primer HBV DNA-RP are designed in the target region for detecting HBV DNA to amplify the conserved sequence of HBV DNA to obtain the target gene fragment, i.e., the HBV DNA amplification product; The nucleotide sequence of the HBV DNA-FP is shown in SEQ ID NO.4, and the nucleotide sequence of the HBV DNA-RP is shown in SEQ ID NO.

5.

6. The detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 5, characterized in that: When establishing a single system for detecting HBV DNA by the CRISPR-Cas12a detection system, multiple crRNAs are designed for screening the HBV DNA amplification product, and DNA-crRNA2 with high activation activity is screened out. The nucleotide sequence of the DNA-crRNA2 is shown in SEQ ID NO.

6.

7. The detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 6, characterized in that: The components of the cas12a / cas13a detection system include Lwacas13a (100nM), crRNA1 (100nM), ssRNA reporter (10μM), RNase inhibitor, 10×reaction buffer, Cas12a (2μM), crRNA2 (2μM), ssDNA reporter (10μM), T7 RNA polymerase, rNTP MIX (25mM), HBVDNA amplification product, HBV RNA amplification product and enzyme-free water.

8. The preparation method of the detection method for simultaneous detection of hepatitis B virus DNA and RNA based on CRISPR-cas12a / cas13a according to claim 7, characterized in that: The detection system integrating CRISPR-cas12a / cas13a for detecting HBV DNA and HBV RNA is visualized, and the fluorescent probe emits light of different colors after being cut, and the detection result is directly reflected by interpreting the fluorescent color under blue light or ultraviolet irradiation.

9. Use of any one of the detection methods of claims 1 to 8 in the detection of hepatitis B virus.

Images