Composition for preventing, treating or ameliorating metabolic disease comprising lactobacillus plantarum NCHBL-004 strain or culture solution thereof

Abstract

The present invention relates to a composition for preventing, treating or ameliorating a metabolic disease, comprising a Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof, which can not only inhibit adipocyte differentiation and weight gain, but also exhibit a hypoglycemic effect, and thus can be usefully used for preventing, treating or ameliorating a metabolic disease, and more particularly, to a composition for preventing, treating or ameliorating a metabolic disease, comprising a Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof.

Description

[Technical field]

[0001] This invention was completed with the support of the Ministry of Education of South Korea. The project inherent number is 1320213639, and the specific project number is 2021-3639. The research management agency of the project is the Korea Research Foundation, and the research project name is "Korea Creative Asset Practical Support Project". The research project name is "Animal Effectiveness Evaluation of Body Fat Inhibition and Hypoglycemic Effects of Bee-Derived Lactobacillus". The sponsor is the Chonnam National University Industry-Academia Cooperation Group, and the research period is from October 1, 2021 to January 31, 2022.

[0002] This patent application claims priority to Korean Patent Application No. 10-2022-0064168 filed with the Korean Intellectual Property Office on May 25, 2022 and Korean Patent Application No. 10-2022-0128076 filed with the Korean Intellectual Property Office on October 6, 2022, and the disclosures of the patent applications are incorporated herein by reference.

[0003] The present invention relates to a composition for preventing, treating or improving metabolic diseases, comprising a Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof, and more specifically, to a technology for preventing, treating or improving metabolic diseases such as obesity, diabetes, non-alcoholic fatty liver disease (NAFLD) and the like by using the culture solution or live bacteria of the Lactobacillus plantarum NCHBL-004 strain. [Background technology]

[0004] In recent years, with the westernization of eating habits, the incidence of adult diseases such as obesity and diabetes caused by genetic and environmental factors has continued to increase. According to statistics from the Korean Obesity Association, the country's severe obesity rate has increased by about 72% in the past 10 years, from 3.5% in 2009 to 6.01% in 2018. If this upward trend continues, it is expected that by 2030, one in ten people will suffer from severe obesity.

[0005] The resulting social costs cannot be ignored. In 2008, South Korea spent 1,792.3 billion won on obesity treatment, and the cost is increasing every year. Currently, research on substances that can prevent and treat this disease is underway, among which various health functional foods have been tried recently. Obesity is not just a state of being overweight, but is clearly classified as a disease that causes a variety of diseases and may even be life-threatening. Being overweight not only causes concomitant diseases such as osteoarthritis and sleep apnea syndrome, but also causes metabolic complications such as non-alcoholic fatty liver disease, diabetes, hypertension, hyperlipidemia, and serious cardiovascular diseases, and even causes serious diseases such as cancer.

[0006] Non-alcoholic fatty liver disease (NAFLD) accounts for 70-90% of chronic hepatitis. When oxidative stress increases or insulin resistance becomes severe, the liver may undergo an inflammatory response and may eventually deteriorate into severe fatty liver or non-alcoholic steatohepatitis (NASH). When steatohepatitis develops, the risk of further development of cirrhosis, liver failure, and hepatocellular carcinoma increases, and other chronic diseases such as cardiovascular disease may progress, leading to death, so breaking this connection is crucial.

[0007] Many domestic and foreign pharmaceutical companies are developing NASH therapeutic drugs, but no product has yet been approved by the licensing agency. Currently used obesity treatment drugs mainly act directly on the brain to induce satiety and suppress appetite. Obesity treatment drugs such as orlistat induce weight loss by reducing fat absorption. In the case of obesity treatment drugs that induce satiety, they are designated and managed as psychotropic drugs because of their dependence and tolerance, and they can increase the concentration of norepinephrine or serotonin as neurotransmitters at the nerve junction to cause satiety, or they can cause satiety by stimulating serotonin receptors or adrenaline receptors.

[0008] When taking this drug for more than 3 months, side effects such as fatigue, depression, auditory hallucinations, and sleep disorders occur, so attention should be paid to the risk of drug poisoning. Therefore, in the treatment of metabolic syndrome caused by obesity, a therapeutic strategy using a new mechanism of action of materials with high anti-obesity effects and metabolic disease improvement effects and low side effects is emerging.

[0009] On the other hand, Lactobacillus microorganisms are lactobacilli that perform homotypic or heterotypic fermentation and are commonly found in the fermentation process of dairy products or vegetables, and are mostly classified as beneficial bacteria. Recently, many studies have reported that the use of probiotics (using lactic acid bacteria or bifidobacteria as beneficial intestinal bacteria) in the obese state induced by a high-fat diet can show effects such as weight loss, improvement of inflammation of fatty liver and adipose tissue, and alleviation of intestinal microbial imbalance. [Summary of the invention]

[0010] [Technical Problems to be Solved by the Invention]

[0011] Therefore, the present inventors have confirmed that honeybee-derived Lactobacillus plantarum has excellent effects of inhibiting adipocyte differentiation and improving obesity.

[0012] Therefore, an object of the present invention is to provide a pharmaceutical composition for preventing or treating metabolic diseases, comprising the Lactobacillus plantarum NCHBL-004 strain or its culture solution.

[0013] Another object of the present invention is to provide a health functional food composition for improving metabolic diseases, comprising the Lactobacillus plantarum NCHBL-004 strain or its culture solution.

[0014] Another object of the present invention relates to the use of Lactobacillus plantarum NCHBL-004 strain or its culture solution for preventing, treating or improving metabolic diseases.

[0015]

Methods used to solve the problem

[0016] The present invention relates to a composition for preventing, treating or improving metabolic diseases, comprising Lactobacillus plantarum NCHBL-004 strain or its culture solution. The composition according to the present invention can not only inhibit adipocyte differentiation and weight gain, but also show a blood sugar lowering effect.

[0017] The present inventors have confirmed that live bacteria or culture fluid of honey bee-derived Lactobacillus plantarum inhibits adipocyte differentiation of adipocyte precursor cells and exhibits weight gain suppressive effects and blood sugar lowering effects in a high-fat diet-induced obesity mouse model.

[0018] Hereinafter, the present invention will be described in more detail.

[0019] One aspect of the present invention is a pharmaceutical composition for preventing or treating metabolic diseases, comprising Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof.

[0020] In the present invention, the deposit number of the strain is KCTC14909BP.

[0021] In the present invention, the strain may be a live bacterium, a dead bacterium or a mixture thereof, for example, may be a live bacterium, but is not limited thereto.

[0022] In the present invention, the composition can be 5×10 5 CFU / ml to 5×10 11 The concentration of CFU / ml is preferably 5×10 5 CFU / ml to 5×10 9 CFU / ml, 5×10 5 CFU / ml to 5×10 7 CFU / ml or 5×10 7 CFU / ml to 5×10 11 The strain may be present at a concentration of 5×10 CFU / ml, for example. 7 CFU / ml to 5×10 9 The concentration of CFU / ml includes, but is not limited to, this.

[0023] In the present invention, the culture solution may be a culture supernatant obtained by removing the strain after culturing the strain, a concentrated solution thereof, a fraction thereof, or a lyophilized product thereof, for example, it may be a culture supernatant, but is not limited thereto.

[0024] In the present invention, the metabolic disease can be one or more selected from the group consisting of obesity, diabetes, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hypertension, hyperlipidemia, cardiovascular disease and hyperinsulinemia.

[0025] The pharmaceutical composition of the present invention can be used as a pharmaceutical composition comprising a pharmaceutically effective amount of Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof and / or a pharmaceutically acceptable carrier.

[0026] In the present specification, the term "pharmaceutically effective amount" refers to an amount sufficient to achieve the efficacy or activity of the above-mentioned Lactobacillus sakei CVL-001 strain culture solution.

[0027] The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is commonly used in the preparation, including lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, but not limited thereto. The pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. in addition to the ingredients.

[0028] The pharmaceutical composition according to the present invention can be administered to mammals including humans by various routes. The administration method can be all commonly used methods, for example, it can be administered by oral, cutaneous, intravenous, intramuscular, subcutaneous, etc., preferably by oral administration.

[0029] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, patient's age, weight, gender, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity, and a generally skilled physician can easily determine and prescribe an effective dosage for the desired treatment or prevention.

[0030] The pharmaceutical composition of the present invention can be formulated using pharmaceutically acceptable carriers and / or excipients according to methods that can be easily implemented by those skilled in the art, so as to be prepared in a unit volume form or by being loaded into a multi-volume container. In this case, the dosage form can be a solution, suspension or emulsion in an oily or aqueous medium, or can be an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel) form, and can further contain a dispersant or stabilizer.

[0031] Another aspect of the present invention is a health functional food composition for improving metabolic diseases, comprising the Lactobacillus plantarum NCHBL-004 strain or its culture solution.

[0032] In the present invention, the deposit number of the strain may be KCTC14909BP.

[0033] In the present invention, the strain may be a live bacterium, a dead bacterium or a mixture thereof, for example, may be a live bacterium, but is not limited thereto.

[0034] In the present invention, the composition can be 5×10 5 CFU / ml to 5×10 11 The concentration of CFU / ml is preferably 5×10 5 CFU / ml to 5×10 9 CFU / ml, 5×10 5CFU / ml to 5×10 7 CFU / ml or 5×10 7 CFU / ml to 5×10 11 The strain may be present at a concentration of 5×10 CFU / ml, for example. 7 CFU / ml to 5×10 9 The concentration of CFU / ml includes, but is not limited to, this.

[0035] In the present invention, the culture solution may be a culture supernatant obtained by removing the strain after culturing the strain, a concentrated solution thereof, a fraction thereof, or a lyophilized product thereof, for example, it may be a culture supernatant, but is not limited thereto.

[0036] In the present invention, the metabolic disease may be one or more selected from the group consisting of obesity, diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, hypertension, hyperlipidemia, cardiovascular disease and hyperinsulinemia.

[0037] When the health function food composition of the present invention is used as a food additive, the health function food composition can be directly added separately or can be used together with other foods or food ingredients, and can be appropriately used according to a conventional method. Generally speaking, when preparing food or beverage, the food composition of the present invention can be added with an amount below 15 % by weight, preferably below 10 % by weight relative to the raw material.

[0038] There is no particular limitation on the type of food. Examples of foods to which the substance can be added include meat, sausages, bread, chocolate, sugars, snacks, biscuits, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, energy drinks, alcoholic beverages, and vitamin complexes, etc., i.e., all foods in the conventional sense.

[0039] The beverage may contain various flavoring agents or natural carbohydrates as additional ingredients. The natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. The ratio of the natural carbohydrates may be appropriately determined according to the choice of those skilled in the art.

[0040] In addition to the above, the health functional food composition of the present invention can contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectin acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerol, ethanol, carbonating agents used in carbonated beverages, etc. In addition, the health functional food composition of the present invention can contain pulp used to prepare natural fruit juice, fruit juice beverages and vegetable beverages. These ingredients can be used alone or in combination. The ratio of this additive can also be appropriately selected by those skilled in the art.

[0041] [Effects of the invention]

[0042] The present invention relates to a composition for preventing, treating or improving metabolic diseases, comprising a Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof. The composition can not only inhibit adipocyte differentiation and weight gain, but also exhibit a hypoglycemic effect, so the composition can be used as an effective metabolic disease prevention, treatment or improvement purpose.

Brief Description of the Drawings

[0043] Figure 1 The graph shows whether the culture supernatant of Lactobacillus kunkeei NCHBL-003 and Lactobacillus plantarum NCHBL-004 according to an embodiment of the present invention has cytotoxicity in 3T3-L1 preadipocyte cells.

[0044] Figure 2a This is a graph showing the effect of suppressing adipocyte differentiation of the supernatant of the culture solution of Lactobacillus kunenei NCHBL-003 and Lactobacillus plantarum NCHBL-004 in preadipocytes according to one embodiment of the present invention.

[0045] Figure 2b The photographs show the effect of suppressing the adipocyte differentiation of the supernatant of the culture solution of Lactobacillus kunenei NCHBL-003 and Lactobacillus plantarum NCHBL-004 in preadipocytes according to one embodiment of the present invention.

[0046] Figure 3 The photographs show the expression levels of transcription factors associated with adipocyte differentiation in the supernatant of the culture solution of Lactobacillus kunene NCHBL-003 and Lactobacillus plantarum NCHBL-004 in the preadipocytes of one example of the present invention.

[0047] Figure 4aThis is a graph showing the weight gain suppressive effect of live Lactobacillus kunene NCHBL-003 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0048] Figure 4b This is a graph showing the weight gain inhibitory effect of live Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0049] Figure 5a This is a graph showing the hypoglycemic effect of a glucose tolerance test using live bacteria of Lactobacillus kunene NCHBL-003 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0050] Figure 5b This is a graph showing the hypoglycemic effect of a glucose tolerance test using live Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0051] Figure 5c This is a graph showing the area under the curve of the blood sugar lowering curve of a glucose tolerance test using live bacteria of Lactobacillus kunene NCHBL-003 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0052] Figure 5d This is a graph showing the area under the curve of the blood sugar lowering curve of a glucose tolerance test using live Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0053] Figure 6a This is a graph showing the blood sugar lowering effect of live Lactobacillus kunene NCHBL-003 in an insulin tolerance test in an induced obesity mouse animal model according to one embodiment of the present invention.

[0054] Figure 6b This is a graph showing the hypoglycemic effect of live Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention in an insulin tolerance test.

[0055] Figure 6c This is a graph showing the area under the curve of the blood sugar lowering curve of an insulin tolerance test using live bacteria of Lactobacillus kunene NCHBL-003 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0056] Figure 6d This is a graph showing the area under the curve of the blood sugar lowering curve of an insulin tolerance test using live Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0057] Figure 7aThis is a graph showing the liver weight reduction effect of live bacteria Lactobacillus kunene NCHBL-003 and live bacteria Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0058] Figure 7b This is a graph showing the subcutaneous fat weight reduction effect of live bacteria of Lactobacillus kunene NCHBL-003 and live bacteria of Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0059] Figure 8a The photographs show the histological clinical symptom results of non-alcoholic fatty liver disease (NAFLD) based on live bacteria Lactobacillus kunene NCHBL-003 and live bacteria Lactobacillus plantarum NCHBL-004 in the obesity-induced mouse animal model according to one embodiment of the present invention.

[0060] Figure 8b The graph shows the histological clinical symptom results of non-alcoholic fatty liver disease based on live bacteria of Lactobacillus kunene NCHBL-003 and Lactobacillus plantarum NCHBL-004 in the obesity-induced mouse animal model according to one embodiment of the present invention.

[0061] Figure 9a The photographs show the size of fat cells in adipose tissue of the obese mouse model induced by live bacteria Lactobacillus kunene NCHBL-003 and live bacteria Lactobacillus plantarum NCHBL-004 according to one embodiment of the present invention.

[0062] Figure 9b This is a graph showing the size of fat cells in adipose tissue based on live bacteria of Lactobacillus kunene NCHBL-003 and live bacteria of Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0063] Fig.10 This is a graph showing the expression levels of metabolism-related genes in adipose tissue based on live bacteria of Lactobacillus kunene NCHBL-003 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0064] Fig.11 This is a graph showing the expression levels of genes related to adipocyte differentiation in adipose tissue based on live bacteria of Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention.

[0065] Fig.12This is a graph showing the expression levels of inflammation-related genes in adipose tissue based on live bacteria of Lactobacillus plantarum NCHBL-004 in an induced obesity mouse animal model according to one embodiment of the present invention. [Specific implementation method]

[0066] The present invention relates to a pharmaceutical composition for preventing or treating metabolic diseases, comprising a Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof. [Specific embodiment]

[0068] Hereinafter, the present invention will be described in more detail based on the following examples. However, these examples are only used to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0069] Throughout this specification, "%" used to indicate the concentration of a particular substance, unless otherwise mentioned, solid / solid is (weight / weight)%, solid / liquid is (weight / volume)%, and liquid / liquid is (volume / volume)%.

[0070] [Example 1: Preparation of culture fluid of Lactobacillus kunsii NCHBL-003 and Lactobacillus plantarum NCHBL-004 strains isolated from honey bees]

[0071] [1-1. Isolation of lactic acid bacteria]

[0072] To isolate lactic acid bacteria from the intestinal microbiota of honey bees, the target insects were first collected in the Gwangju area of ​​South Korea in early June, and then placed in a sterile collection container. Each individual was refrigerated for 10 minutes before being removed, and the gastrointestinal tract was aseptically removed using microsurgical instruments on a green bench. The intestinal microbial community of honey bees was ensured by suspending the removed gastrointestinal tract contents in 0.1% peptone saline (0.9% w / v NaCl, 0.1% w / v Tween 80, 0.1% w / v peptone) supplemented with 10 ml of sterile Tween 80.

[0073] For lactic acid bacteria, 500 μl of the suspension of visceral powder was diluted with liquid culture medium (DifcoTM Lactobacilli MRS Broth, BD, USA) and then spread on solid culture medium (BBLTM LBS Agar, BD, USA) using a platinum inoculation loop and added to BD GasPak TMEZdp was cultured at 37°C until colonies were confirmed. Colonies confirmed in LBS solid medium were identified as Lactobacillus by Gram-positive results of Gram staining and catalase-negative reaction confirmed by mixing with 3% hydrogen peroxide solution. Field isolates of Lactobacillus were placed in MRS medium containing 15% glycerol and stored at -20°C and used in the next experiment.

[0074] Among the isolated strains, systematic identification of Lactobacillus kunkeei CHBL-003 and Lactobacillus plantarum NCHBL-004 was performed by base sequence analysis of 16S rRNA gene, and the 16S rRNA gene was compared with that of Lactobacillus strains based on the similarity of primary and secondary structures of 16S rRNA gene using PHYDIT program.

[0075]

Table 1

[0076]

[0077]

[0078] [1-2. Preparation of strain culture medium]

[0079] In DMEM (high glucose) medium, lactic acid bacteria isolated from the intestine of honey bees, namely, live bacteria of Lactobacillus kunsii NCHBL-003 and Lactobacillus plantarum NCHBL-004 (1×10 8 CFU / ml) for 24 hours, the supernatant was separated by centrifugation. The supernatant was adjusted to pH 7.4, sterilized using a syringe filter (0.2 μm), and stored.

[0080] [Example 2: Experiment on the inhibitory effect of adipocyte differentiation (in vitro)]

[0081] 【2-1. Cytotoxicity evaluation】

[0082] Cytotoxicity can be evaluated by measuring the free LDH (Lactate dehydrogenase) in dead cells. 3T3-L1 preadipocyte cells purchased from the Korean Cell Line Bank were maintained by subculturing in DMEM medium supplemented with 10% BCS (Bovine calf serum) and 1% PS (penicillin). The cells were cultured at 1×10 5 The cells were seeded in a 48-well plate at a density of 10 cells / ml together with a medium supplemented with 10% FBS and 1% PS (0.2 ml each). After seeding in the plate, the time when the density reached 100% was designated as day -2, and cultured for another two days to induce all the cultured cells in the plate to be in a cell cycle arrest state at the G1 phase.

[0083] In order to measure spontaneous LDH, wells without any treatment were prepared as a control group. Specifically, MDI (IBMX, dexamethasone, insulin) was added to the culture medium supplemented with 10% fetal bovine serum (FBS) from day 0 of 3T3-L1 preadipocytes, thereby inducing adipocyte differentiation. On day 2, the culture medium was replaced with a culture medium containing only insulin. From day 4, the culture medium was replaced every two days and cultured until differentiation (day 8).

[0084] In order to determine the maximum LDH, wells treated with culture fluid were prepared as experimental groups. They were prepared in the same manner as the control group, but the culture fluid (12.5%, 25%, 50%) was treated two days after the time point when 3T3-L1 preadipocytes grew to a density of 100% (day 0). DMEM medium was used for dilution with culture fluid.

[0085] After culturing the cells for 24 hours, cytotoxicity was evaluated by LDH assay. After preparing wells to which triton X-100 solution was added, LDH substrate mixture was added and absorbance was measured to calculate the percentage of toxicity.

[0086] The cytotoxicity was evaluated by calculating the percentage of free LDH based on the culture fluids (0%, 12.5%, 25%, and 50%) of Lactobacillus kunenei NCHBL-003 and Lactobacillus plantarum NCHBL-004.

[0087] As confirmed in 1, no cytotoxicity was observed at all concentrations of the treated culture medium in 3T3-L1.

[0088] [2-2. Evaluation of inhibition of adipocyte differentiation]

[0089] 3T3-L1 was used at 1×10 5 Cells were seeded at a density of 100% cells / ml in a 12-well plate with a medium supplemented with 10% FBS and 1% PS (1 ml each). Two days after the cells grew at a density of 100% (day 0), culture fluid (0%, 12.5%, 25%, 50%) and differentiation-inducing substance MDI were treated.

[0090] On the second day, the culture medium was replaced and the culture medium (0, 12.5, 25, 50%) and insulin were treated. Then, on the fourth day, the culture medium was replaced and the culture medium (0%, 12.5%, 25%, 50%) was treated. The above process was repeated every two days until differentiation. When differentiated adipocytes were observed, the culture medium was replaced with 4% formalin for adipocyte staining, and the cells were fixed for 20 minutes and then washed twice with distilled water.

[0091] Then, the adipocytes were stained for 20 minutes using a dye prepared by mixing Oil red O staining reagent and distilled water (DW) at a ratio of 6:4. After washing twice with distilled water, the cells were observed and photographed under a microscope, and then treated with 100% isopropanol to extract Oil red O staining, and the absorbance at 510 nm was measured to quantitatively analyze the degree of differentiation.

[0092] from Figure 2a and Figure 2b It was confirmed that when 3T3-L1 cells were treated with MDI, differentiation into adipocytes increased, while the number of adipocytes decreased significantly in a concentration-dependent manner due to treatment with the culture solution of Lactobacillus kunsii NCHBL-003. However, treatment with the culture solution of Lactobacillus plantarum NCHBL-004 did not result in a decrease in the number of adipocytes.

[0093] This confirmed that the culture solution of Lactobacillus kunenei NCHBL-003 can inhibit differentiation into adipocytes.

[0094] 【2-3. Evaluation of inhibition of transcription factors related to adipocyte differentiation】

[0095] During adipogenesis in adipose tissue, lipid biosynthesis, lipid droplet formation, and lipid accumulation increase through major transcription factors such as sterol regulatory element binding protein 1c (SREBP1c), peroxisome proliferator-activated receptor-γ (PPARγ), and CCAAT-enhancer binding proteinα (C / EBPα). Therefore, the protein expression levels of the above transcription factors were measured by Western blotting in 3T3-L1 cells differentiated into adipocytes, depending on whether they were treated with lactic acid bacteria culture medium.

[0096] Specifically, for 1×10 5 3T3-L1 cells were seeded into 12-well plates at a density of 10 cells / ml, treated with lactic acid bacteria culture solution according to the experimental method described above, and cultured until day 8. After collecting the cells of each group with a cell scraper, proteins were separated using a protein lysis buffer containing a protease inhibitor.

[0097] An equal amount of each protein was loaded onto an SDS-PAGE gel, separated according to the protein molecular weight, and then transferred to a polyvinylidene fluoride (PVDF) membrane. The transferred membrane was reacted with primary antibodies SREBP1c (#ab28481, Abcam), PPARγ (#2443S, Cell Signaling Technology), C / EBPα (#8178T, Cell Signaling Technology), and β-actin (#sc-47778, Santa Cruz Biotechnology) at 4°C for 18 hours, and then washed with TBST buffer.

[0098] After reacting with anti-rabbit IgG, anti-mouse IgG, and HRP-linked secondary antibody (#31640, Invitrogen) at room temperature for 2 hours, the membrane was washed with TBST. The membrane was treated with detection reagent, and the image was developed to measure the expression level of the target protein.

[0099] from Figure 3 It can be confirmed that when adipocyte differentiation is induced by MDI treatment, the protein expression of related transcription factors increases, and the expression of transcription factors is significantly reduced in a concentration-dependent manner due to treatment with the culture solution of Lactobacillus kunsii NCHBL-003. However, treatment with the culture solution of Lactobacillus plantarum NCHBL-004 does not lead to a decrease in the expression of transcription factors.

[0100] This confirmed that the culture solution of Lactobacillus kunene NCHBL-003 can inhibit adipocyte differentiation by reducing the expression of transcription factors.

[0101] [Example 3: Preparation of live bacteria of Lactobacillus kunsii NCHBL-003 and Lactobacillus plantarum NCHBL-004]

[0102] In order to prepare live bacteria for feeding mice, live bacteria of Lactobacillus kunsii NCHBL-003 and Lactobacillus plantarum NCHBL-004 (1×10 8 CFU / ml) in a solid medium (MRS agar) at 30°C for 24 hours. A single colony was collected and pre-cultured in a liquid medium (MRS broth). The pre-culture was performed for 24 hours at 150 rpm and 30°C in 5 ml of medium, then diluted to 10 times and main cultured for 3 hours under the same conditions.

[0103] In order to adjust the number of bacteria, the concentration was adjusted with PBS to an OD value of 0.6 at an absorbance of 600 nm using a spectrophotometer. Under this condition, the Lactobacillus kunsii NCHBL-003 strain was cultured at 1.57×10 9 CFU / ml, Lactobacillus plantarum NCHBL-004 strain was 1.48×10 9 Considering that each mouse is fed 0.2 ml of each strain per day, 1×10 7 CFU / mouse, 1×10 9The cells were fed at a concentration of 100 CFU / mouse, and a live bacterial culture medium was prepared by centrifugation at 3000 rpm for 15 minutes.

[0104] [Example 4: Experiment on the effect of improving obesity (in vitro)]

[0105] [4-1. Measurement of body weight changes in induced obese mice]

[0106] It is well known that when mice are fed a high fat diet consisting of 60% fat, they gain weight compared to mice fed a normal diet. Therefore, the obese mouse animal model induced by high fat diet feeding is widely used in obesity disease research.

[0107] Seven-week-old C57BL / 6 male mice were fed a live bacterial culture medium and a normal diet or a high-fat diet. After two weeks of normal or high-fat diet feeding, body weight was measured and the weight of each group was equalized. Starting from the 3rd week of normal or high-fat diet feeding, body weight was measured every week. Glucose tolerance test was performed at week 10, insulin tolerance test was performed at week 15, and autopsy was performed at week 16 to measure organ weight.

[0108] The information of each group is as follows. The number of mice in all groups was set to 10.

[0109]

Table 2

[0110] Group Name diet Oral administration G1 Normal diet feeding Phosphate buffered saline (PBS) G2 High fat diet PBS G3 High fat diet <![CDATA[Lactobacillus kunkeei NCHBL-003 1×10 7 CFU / mouse]]> G4 High fat diet <![CDATA[Lactobacillus kunkeei NCHBL-003 1×10 9 CFU / mouse]]> G5 High fat diet <![CDATA[Lactobacillus plantarum NCHBL-004 1×10 7 CFU / mouse]]> G6 High fat diet <![CDATA[Lactobacillus plantarum NCHBL-004 1×10 9 CFU / mouse]]>

[0111] Based on the results presented in Table 2, it was observed that the group fed with a high-fat diet (G2) had a significant increase in body weight compared to the group fed with a normal diet (G1).

[0112]

Table 3

[0113] G1 G2 G3 G4 G5 G6 Body weight (g, week 16) 34.25 44.25 42.64 39.21 40.4 40.73

[0114] From Table 3 and Figure 4a It was confirmed that when Lactobacillus kunsenii NCHBL-003 live bacteria were administered at a concentration of 1×10 9 The group fed with CFU concentration (G4) also showed a significant decrease in body weight compared with G2. 7 In the group fed with CFU concentration (G3), the body weight decreased on average, but it was not significant.

[0115] From Table 2 and Figure 4b It was confirmed that when Lactobacillus plantarum NCHBL-004 live bacteria were administered at 1×10 7 CFU and 1×109 The body weight of the two groups (G5 and G6) fed with CFU concentrations decreased significantly compared to G2.

[0116] This confirmed that live bacteria of Lactobacillus kunene NCHBL-003 and Lactobacillus plantarum NCHBL-004 can induce a weight loss effect.

[0117] 【4-2. Evaluation of blood glucose in induced obese mice】

[0118] When mice are orally fed glucose, blood sugar levels rise temporarily but tend to drop again due to normal insulin secretion in the body. However, it is well known that in mouse animal models fed a high-fat diet, blood sugar levels always remain at a high level.

[0119] Each group of mice prepared in Example 4-1 was kept fasting for 12 hours from 9:00 pm the day before the experiment to 9:00 am the next day, and then used for glucose tolerance test. A 10% glucose (glucose in PBS) solution sterilized by 0.2 μm filtration was prepared, and 2 mg (glucose / g, volume (μl) = body weight (g) x 20) was orally fed to each subject. The mice were returned to the cage, and blood was collected from the tail, and blood glucose values ​​were measured at 0 minutes, 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes, respectively.

[0120] In the present study, it was observed that the G2 group fed with a high-fat diet maintained significantly higher blood glucose values ​​compared to the G1 group fed with a normal diet.

[0121]

Table 4

[0122] Glucose load blood sugar (mg / dL) G1 G2 G3 G4 G5 G6 0 minutes 115.3 175 160.3 195.2 159.3 160.7 15 minutes 263.5 400.3 356.2 372.2 383 378.7 30 minutes 238.8 341.7 312.2 325.5 298.7 293.8 60 minutes 188.8 260.7 234.8 223.2 207.8 207.2 90 minutes 131.8 215.3 180.8 192.8 167.5 154.8 120 minutes 98.5 187.7 160.3 168.5 140.5 152.5

[0123] From Table 4, Figure 5a and Figure 5b It was confirmed that the blood sugar values ​​of the groups (G3 to 6) fed with live bacteria of Lactobacillus kunsii NCHBL-003 and Lactobacillus plantarum NCHBL-004 along with a high-fat diet were lower than those of G2. In particular, in the case of Lactobacillus plantarum NCHBL-004, the blood sugar values ​​were significantly lowered at each time of blood sugar measurement.

[0124] from Figure 5c and Figure 5d It can be confirmed that in the AUC result of calculating the area under the curve of the glucose tolerance test curve, the live bacteria of Lactobacillus kunsii NCHBL-003 were added at 1×10 7The group (G3) fed with 1×10 CFU concentration was significantly reduced compared to G2. 7 , 1×10 9 The concentration of CFU in the two groups (G3 and G4) fed separately showed a significantly reduced level compared to G2.

[0125] In other words, the glucose tolerance test confirmed that Lactobacillus kunenei NCHBL-003 and Lactobacillus plantarum NCHBL-004 had a blood sugar lowering effect in the high-fat diet-induced obesity model.

[0126] 【4-3. Evaluation of insulin tolerance and blood glucose in induced obese mice】

[0127] It is well known that in mouse models fed a high-fat diet, blood sugar levels remain very high. When insulin is injected intraperitoneally into these mouse models, blood sugar levels temporarily drop, but the drop in blood sugar levels is relatively small in mouse models fed a high-fat diet.

[0128] Each group of mice prepared in the above-mentioned Example 4-1 was fasted for 4 hours from 9 am to 1 pm, and then used for insulin tolerance test. A solution of insulin (insulin in PBS) sterilized by 0.2 μm filtration was prepared, and 0.5 IU / kg (BW.Vol=20 μl) was intraperitoneally administered to each subject (27-gauge sterile needle). The mice were returned to the cage, and blood was collected from the tail, and blood glucose values ​​were measured at 0 minutes, 15 minutes, 30 minutes, 60 minutes, 90 minutes, 120 minutes, and 150 minutes, respectively.

[0129] In the present study, group G2, which was fed a high-fat diet, maintained significantly higher blood glucose values ​​compared to group G1, which was fed a normal diet.

[0130]

Table 5

[0131] Insulin tolerance blood glucose (mg / dL) G1 G2 G3 G4 G5 G6 0 minutes 150.0 185.1 204.4 207.2 193.4 186.0 15 minutes 104.0 211.3 226.1 186.9 171.8 173.7 30 minutes 67.6 160.1 146.7 145.9 103.7 111.6 60 minutes 65.9 147.3 129.3 120.0 94.9 100.7 90 minutes 76.8 163.8 133.1 129.4 104.6 111.8 120 minutes 83.7 160.9 133.5 143.0 115.4 126.3 150 minutes 94.1 169.4 140.0 138.9 116.6 132.5

[0132] From Table 5, Figure 6a and Figure 6b It can be confirmed that, in particular, in the groups (G3-G6) fed with live bacteria of Lactobacillus kunsii NCHBL-003 and Lactobacillus plantarum NCHBL-004 along with a high-fat diet, blood sugar values ​​were reduced compared to G2. In particular, in the case of Lactobacillus plantarum NCHBL-004, blood sugar was reduced at a significant level at each time of measuring blood sugar.

[0133] from Figure 6c and Figure 6dIt can be confirmed that in the AUC results of calculating the area under the curve of the insulin tolerance test curve, the blood glucose value of Lactobacillus kunsii NCHBL-003 (G3, G4) was lower than that of G2, but not significantly. In the AUC results, it was confirmed that when the live bacteria of Lactobacillus plantarum NCHBL-004 were added at 1×10 7 CFU, 1×10 9 The concentration of CFU in the two groups (G5 and G6) fed separately showed a significantly lower level compared to G2.

[0134] In other words, the insulin tolerance test confirmed that Lactobacillus kunenei NCHBL-003 and Lactobacillus plantarum NCHBL-004 had a blood sugar lowering effect in the high-fat diet-induced obesity model.

[0135] 【4-4. Determination of organ weights in induced obese mice】

[0136] In the high-fat diet-induced obesity mouse model, autopsies were performed at week 16, and organ weights were measured and compared.

[0137] For histochemical analysis, the liver and adipose tissue fixed in 10% formalin solution were embedded in paraffin and sliced ​​at a thickness of 3um to prepare slides. After staining the nucleus and cytoplasm with H&E dye consisting of hematoxylin and eosin, observation was performed at a magnification of 100 times using an optical microscope and a digital camera mounted on the microscope. For the evaluation of the histological clinical symptoms of non-alcoholic fatty liver, the following benchmarks were established and evaluated: steatosis (0-3), hepatocellular ballooning (0-3), lobular inflammatroy cell infiltration (0-2). The size of the adipocytes in the adipose tissue was determined using the Image J program.

[0138] Compared with the normal diet group G1, the liver weight and subcutaneous fat weight of group G2 fed with a high-fat diet were increased.

[0139] from Figure 7a It can be confirmed that the live bacteria of Lactobacillus kunsii NCHBL-003 were 1×10 9 In group G4 fed with a concentration of 1×10 CFU, a decrease in liver weight was observed, but it was not significant. It was confirmed that in the groups (G5 and G6) fed with live Lactobacillus plantarum NCHBL-004 bacteria along with a high-fat diet, a decrease in liver weight was observed. 9 The concentration of CFU was significantly reduced in the fed group G6.

[0140] from Figure 7b It was confirmed that in the groups (G3 and G4) fed with live Lactobacillus kunsii NCHBL-003 along with a high-fat diet, subcutaneous fat weight decreased. 9 The concentration of CFU in the group fed with the high-fat diet (G4) was significantly reduced. In the groups fed with live Lactobacillus plantarum NCHBL-004 bacteria (G5, G6) together with the high-fat diet, the subcutaneous fat weight was reduced, and the concentration of CFU in the group fed with 1×10 7 The concentration of CFU decreased significantly in the fed group (G5).

[0141] 【4-5. Evaluation of clinical symptoms of fatty liver in induced obese mice】

[0142] It is well known that in mouse animal models fed a high-fat diet, lipids accumulate in liver tissue, leading to clinical symptoms of non-alcoholic fatty liver disease.

[0143] Total RNA was isolated from adipose tissue using TRIzol reagent solution. The isolated total RNA was quantified using a Nanodrop spectrophotometer, and for reverse transcription, cDNA was synthesized from RNA using TOPscript RT DryMIX (Enzynomics, Korea) and analyzed. The synthesized cDNA was used as a template, and each primer and kit (TOPreal SYBR Green PCR kit, Enzynomics, Korea) were added, and amplified using a real-time PCR (Rotor-Gene Q, QIAGEN) instrument, and then analyzed using quantitative software.

[0144] The products amplified by real-time PCR were quantified using the comparative cycle threshold (Ct) method, and the housekeeping gene 18S rRNA was used as an internal control to correct the expression level of each sample. The primer sequences of each gene used in PCR are shown in Table 6.

[0145]

Table 6

[0146] SEQ ID NO. name sequence 2 18S rRNA forward primer AGGAGCTGAAGGGCCACGGG 3 18S rRNA reverse primer TGGGAACAGTGACGCGGGTC

[0147] from Figure 8a and Figure 8bIn the study, it was confirmed that after 16 weeks of high-fat diet feeding, steatosis, hepatocellular ballooning, and lobular inflammatory cell infiltration in the liver were observed. When Lactobacillus kunsii NCHBL-003 was fed together with the high-fat diet, these clinical symptoms were reduced and the results were not statistically significant. 9 The CFU concentration in the group fed with a high-fat diet (G4) showed a significant decrease. Both groups (G5 and G6) fed with live Lactobacillus plantarum NCHBL-004 bacteria along with a high-fat diet showed a reduction in clinical symptoms, which was confirmed to be a significant level compared to G2 fed only with a high-fat diet.

[0148] [4-6. Histological evaluation of adipose tissue in induced obese mice]

[0149] It is well known that in mouse animal models fed a high-fat diet, adipocyte size increases concurrently with increased lipid accumulation in adipose tissue.

[0150] from Figure 9a and Figure 9b It was confirmed that when Lactobacillus kunsenii NCHBL-003 live bacteria were administered at a concentration of 1×10 9 In the group fed with a concentration of 1×10 CFU (G4), the average size of adipocytes decreased. As a result of feeding live bacteria of Lactobacillus plantarum NCHBL-004 together with a high-fat diet, the average size of adipocytes decreased, especially when the live bacteria were fed at a concentration of 1×10 9 The concentration of CFU was significantly decreased in the fed group (G6).

[0151] [4-7. Evaluation of gene expression in epididymal adipose tissue based on Lactobacillus kunenei NCHBL-003 in induced obese mice]

[0152] The mice in each group prepared in Example 4-1 were autopsied at week 16, and RNA was extracted from epididymal fat to evaluate the expression of metabolism-related genes. The primers used to evaluate the expression are shown in Table 7 below.

[0153]

Table 7

[0154]

[0155]

[0156] It is well known that adiponectin is mostly produced in adipocytes, increases the regulation of sugar and lipid metabolism and insulin sensitivity, and is reduced in metabolic syndrome. Glucose transporter type 4 (GLUT4) plays a role in mediating glucose absorption in peripheral tissue cells through the stimulation of insulin, and when insulin resistance occurs, the translocation of GLUT4 from the cytoplasm to the cell membrane is inhibited.

[0157] Hormone-sensitive liase (HSL) and neutral lipase (adipse triglycerde lipase (ATGL)), which are important in lipid metabolism, are mainly activated in adipose tissue and play a role in breaking down neutral fat. Carnitine Palmitoyltransferase 1A (CPT1A) promotes mitochondrial fatty acid β-oxidation.

[0158] from Fig.10 It was confirmed that the expression of the gene in epididymal fat was significantly increased when live bacteria of Lactobacillus kunsii NCHBL-003 were fed together with a high-fat diet. 7 The increase in GLUT4 gene expression in the group (G3) fed with a concentration of 1.5 CFU and the increase in CPT1α gene expression in the G3 and G4 groups were not significant. Therefore, it was confirmed that when feeding with live Lactobacillus kunsii NCHBL-003 bacteria, the expression of metabolism-related genes in adipose tissue can be regulated.

[0159] [4-8. Evaluation of gene expression in epididymal adipose tissue using Lactobacillus plantarum NCHBL-004 in induced obese mice]

[0160] Mice with high-fat diet-induced obesity were autopsied at 16 weeks, and RNA was extracted from epididymal fat to evaluate the expression levels of genes related to adipocyte differentiation and inflammation.

[0161]

Table 8

[0162] SEQ ID NO. name sequence 14 C / EBPα forward primer GAACAGCAACGAGTACCGGGTA 15 C / EBPα reverse primer CCATGGCCTTGACCAAGGAG 16 PPARγ forward primer GGTGAAACTCTGGGAGATTC 17 PPARγ reverse primer CAACCATTGGGTCAGCTCTT 18 aP2 forward primer ACATGATCATCAGCGTAAATGGG 19 aP2 reverse primer TCATAACACATTCCACCACCAGC 20 TNF-α forward primer CGTCAGCCGATTTGCTATCT 21 TNF-α reverse primer CGGACTCCGCAAAGTCTAAG 22 Caspase1 forward primer AGGAATTCTGGAGCTTCAATCAG 23 Caspase1 reverse primer TGGAAATGTGCCATCTTCTTT

[0163] The transcription factors PPARγ (peroxisome proliferator-activated receptor-γ) and C / EBPα (CCAAT-enhancer binding protein) that act on adipocyte differentiation promote adipocyte differentiation by regulating the expression of their respective target genes. Adipocyte protein 2 (aP2) is a gene found in mature adipocytes.

[0164] like Fig.11 It was confirmed that when Lactobacillus plantarum NCHBL-004 live bacteria were administered at a concentration of 1×10 7 CFU concentration (G5), the expression of the genes was reduced, and in the case of C / EBPα and aP2, it was significantly reduced. 9 When fed with 1000 μg / mL CFU of G6, the gene expressions of PPARγ and aP2 were decreased, but not significantly.

[0165] In the development of metabolic diseases, inflammatory responses occur at low levels for a long time, which can induce insulin resistance and is the pathophysiological mechanism of metabolic diseases caused by obesity. It is well known that in adipocytes, inflammation-related genes TNFα (tumor necrosis factorα) and MCP1 (monocyte chemoattractant protein-1) are the main inflammatory cytokines secreted in adipocytes, and cysteine ​​protease-1 (caspase-1) plays a major role in macrophage-derived inflammation in adipose tissue.

[0166] from Fig.12 It can be confirmed that the live bacteria of Lactobacillus plantarum NCHBL-004 were 1×10 7 CFU concentration (G5), the expression of the genes was significantly reduced, and when the live bacteria of Lactobacillus plantarum NCHBL-004 were fed at 1×10 9 When the cells were fed with a concentration of 0.1 CFU (G6), the expression of the genes was reduced, especially the expression of caspase-1 was significantly reduced.

[0167] This confirmed that when live Lactobacillus plantarum NCHBL-004 is fed, the expression of genes related to adipocyte differentiation and inflammation in adipose tissue can be regulated.

[0168] [Industrial Applicability]

[0169] The present invention relates to a composition for preventing, treating or improving metabolic diseases, comprising a Lactobacillus plantarum NCHBL-004 strain or a culture solution thereof, and more specifically, to a technology for preventing, treating or improving metabolic diseases such as obesity, diabetes, non-alcoholic fatty liver disease (NAFLD) and the like by using the culture solution or live bacteria of the Lactobacillus plantarum NCHBL-004 strain.

[0170] [Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure]

[0171] Original deposit certificate issued in accordance with Regulation 7.1

[0172] To: Chonnam National University Industry-Academic Cooperation Group

[0173] Chonnam National University Industry-Academic Cooperation Group

[0174] No. 77, Yongbong-ro, Buk-gu, Gwangju

[0175] South Korea

[0176]

[0177] BP / 4 form (KCTC Form 17) single page.

Claims

1. A pharmaceutical composition for preventing or treating metabolic diseases, wherein the composition comprises Lactobacillus plantarum NCHBL-004 strain or its culture solution.

2. The pharmaceutical composition according to claim 1, wherein the deposit number of the strain is KCTC14909BP.

3. The pharmaceutical composition according to claim 1, wherein the strain is a live bacterium, a dead bacterium or a mixture thereof.

4. The pharmaceutical composition according to claim 1, wherein the composition is in the form of 5×10 5 CFU / ml to 5×10 11 The concentration of CFU / ml contained the strains.

5. The pharmaceutical composition according to claim 1, wherein the metabolic disease is one or more selected from the group consisting of obesity, diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, hypertension, hyperlipidemia, cardiovascular disease and hyperinsulinemia.

6. A health functional food composition for preventing or treating metabolic diseases, wherein the composition comprises Lactobacillus plantarum NCHBL-004 strain or its culture solution.

7. The health functional food composition according to claim 6, wherein the deposit number of the strain is KCTC14909BP.

8. The health functional food composition according to claim 6, wherein the strain is live bacteria, dead bacteria or a mixture thereof.

9. The health functional food composition according to claim 6, wherein the composition is 5×10 5 CFU / ml to 5×10 11 The concentration of CFU / ml contained the strains.

10. The health functional food composition according to claim 6, wherein the metabolic disease is one or more selected from the group consisting of obesity, diabetes, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, hypertension, hyperlipidemia, cardiovascular disease and hyperinsulinemia.

Images