High-temperature-resistant lipase mutant and application thereof in synthesis of functional lipid

Abstract

The invention relates to the technical field of gene engineering and protein engineering, in particular to a high-temperature-resistant lipase mutant and application thereof in synthesis of functional lipid. Compared with wild lipase RL, the lipase mutant containing R163T single-point mutation provided by the invention has the advantages that the heat resistance is obviously improved, the enzyme activity residual rate is up to 69.82% after the lipase mutant is treated at 80 DEG C for 3 minutes, and an unexpected technical effect is achieved. The lipase mutant is high in heat resistance, and wide application of the lipase mutant in the fields of lipid processing and the like is facilitated.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering and protein engineering, and in particular to a thermostable lipase mutant and application thereof in synthesizing functional lipids. Background Art

[0002] Lipase is a class of enzymes with multiple catalytic abilities. It can catalyze the hydrolysis, alcoholysis, esterification, transesterification and reverse synthesis of triacylglycerol and other water-insoluble esters. In addition, it also exhibits the activities of other enzymes, such as phospholipase, lysophospholipase, cholesterol esterase, acyl peptide hydrolase, etc. The different activities of lipase depend on the characteristics of the reaction system, such as promoting ester hydrolysis at the oil-water interface, and enzymatic synthesis and ester exchange in the organic phase.

[0003] The study of the properties of lipase mainly includes the optimum temperature and pH, temperature and pH stability, substrate specificity and other aspects. So far, a large number of microbial lipases have been isolated and purified, and their properties have been studied. They differ in molecular weight, optimum pH, optimum temperature, pH and thermal stability, isoelectric point and other biochemical properties. In general, microbial lipases have a wider range of pH and temperature than animal and plant lipases, high stability and activity, and are specific to substrates.

[0004] At present, the application of lipase in the fields of medicine, oil processing, biodiesel, etc. is not widespread enough. Therefore, developing lipase with excellent performance and reducing its production cost are of great significance to promoting the application of this enzyme. Summary of the invention

[0005] The purpose of the present invention is to provide a thermostable lipase mutant. The thermostable property of the mutant is significantly improved, which is beneficial to promote its application in the synthesis of functional lipids.

[0006] The present invention relates to a lipase mutant, wherein the 163rd amino acid of the lipase with the amino acid sequence of SEQ ID NO: 1 is mutated from Arg to Thr.

[0007] The amino acid sequence of the mutant is SEQ ID NO:5.

[0008] The present invention also relates to a DNA molecule encoding the above lipase mutant.

[0009] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0010] The present invention also relates to a host cell, comprising the above recombinant expression vector.

[0011] When the above plasmid is transferred into host cells, the heat resistance of the recombinantly expressed lipase mutant is significantly improved.

[0012] The host cell is Pichia pastoris ( Pichia pastoris ).

[0013] The host cell is Aspergillus niger ( Aspergillus niger ).

[0014] The host cell is Trichoderma reesei ( Trichoderma reesei ).

[0015] The present invention also relates to the application of the lipase mutant in the synthesis of functional lipid OPL.

[0016] Compared with the wild-type lipase RL, the heat resistance of the lipase mutant containing the R163T single-point mutation provided by the present invention is significantly improved. After being treated at 80°C for 3 minutes, the residual enzyme activity rate is as high as 69.82%, achieving unexpected technical effects.

[0017] In summary, the lipase mutant provided by the present invention has stronger heat resistance, which is conducive to promoting its wide application in the fields of functional lipid processing and the like. DETAILED DESCRIPTION

[0018] The present invention discloses a lipase mutant, a preparation method and application thereof, a DNA molecule encoding the lipase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0019] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example MOLECΜLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECΜLAR BIOLOGY (Ausubel, 2003) in the method of recording. These general references provide definitions and methods known to those skilled in the art. But those skilled in the art can, on the basis of the technical scheme recorded in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0020] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0021] Culture medium formula: Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast screening medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / ml ampicillin, pH 7.0; LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / ml ampicillin, pH 7.0.

[0022] The present invention will be further described below in conjunction with embodiments: Example 1 Construction of recombinant plasmid The lipase gene was optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The lipase was named RL, its amino acid sequence was SEQ ID NO: 1, and its encoding nucleotide sequence was SEQ ID NO: 2.

[0023] The lipase gene was digested with restriction enzymes EcoR I and Not I (Fermentas); at the same time, the plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The digestion products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced for accuracy (Sangon).

[0024] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-RL.

[0025] Example 2 Screening of high temperature resistant mutants In order to further improve the thermotolerance of lipase RL, a large number of mutations of the enzyme were screened by directed evolution technology.

[0026] Design of PCR primers RL-F1, RL-R1: RL-F1: GGA gaattc GTCCCTGTCGCTGGCCATAAA (SEQ ID NO: 3, the underline indicates the restriction endonuclease EcoRI recognition site); RL-R1: ATA GGCGGCCG TTACAGGCAGGAGCCCTCGTT (SEQ ID NO: 4, the underline indicates the recognition site of restriction endonuclease NotI).

[0027] The RL gene (SEQ ID NO: 1) was used as a template and PCR amplification was performed using the above primers using the GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plates, and cultured inverted at 37°C. After the transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, and 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were cultured at 37°C and 220 rpm for about 6 h, and the supernatant was discarded after centrifugation. The cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain Escherichia coli cell lysate containing lipase.

[0028] The enzyme activity of lipase was determined at 37°C and pH 7.5. 20 μl of lysate was taken out to two new 96-well plates, one of which was treated at 80°C for 3 min, and 80 μl of substrate solution was added to both 96-well plates (the substrate solution was made up of solution A and solution B in a ratio of 1:9, slowly mixed, and prepared before use. Solution A: 18 mg of p-nitrophenol palmitate was accurately weighed and dissolved in 30 ml of isopropanol. Solution B: 50 mmol / L phosphate buffer pH 7.5), reacted at 37°C for 10 min, and then 80 ul of anhydrous ethanol was added to terminate the reaction, and the absorbance was measured at 410 nm.

[0029] The experimental results showed that some mutations had no effect on the heat resistance of lipase RL, and some mutations even made it worse, which did not meet the requirements. Finally, a mutation site was screened that could significantly improve the heat resistance of lipase RL without affecting its original enzymatic properties: R163T.

[0030] Based on the above wild-type lipase RL, the present invention provides a mutant comprising a single mutation site R163T, whose amino acid sequence is SEQ ID NO:5.

[0031] Example 3 Expression of lipase in Pichia pastoris 3.1 Construction of expression vector The gene sequences of lipase RL and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0032] According to the method described in Example 1, the gene sequences of the synthesized lipase RL and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector that had been digested with the same enzymes at 16°C overnight, and transformed into Escherichia coli DH5a, spread on LB+Amp plates, and inverted cultured at 37°C. After the transformants appeared, colony PCR (reaction system: template-picked single clone, rTaq DNA polymerase 0.5μl, 10× Buffer 2.0μl, dNTPs (2.5mM) 2.0μl, 5'AOX primer (10mM): 0.5μl, 3'AOX primer: 0.5μl, ddH 2 O 14.5μl, reaction procedure: 95℃ pre-denaturation 5min, 30 cycles: 94℃ 30sec, 55℃ 30sec, 72℃ 2min, 72℃ 10min). The positive clones were verified and the correct recombinant expression plasmid was obtained after sequencing verification.

[0033] 3.2 Construction of Pichia pastoris engineered strains 3.2.1 Preparation of competent yeast The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. The activated GS115 monoclonal was inoculated into 6 ml YPD liquid medium. The culture was incubated at 30°C and 220 rpm for about 12 h. The bacterial solution was transferred to a conical flask containing 30 ml YPD liquid medium and cultured at 30°C and 220 rpm for about 5 h. The bacterial density was detected by a UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 ml of the bacterial cells were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The remaining supernatant was absorbed with sterile filter paper and resuspended with 1 ml of precooled sterile water. The cells were centrifuged at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The cells were washed with 1 ml of sterile water again. The cells were centrifuged at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The cells were washed with 1 ml of sterile water again. The cells were centrifuged at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The cells were washed with 1 ml of precooled sorbitol (1 mol / L); centrifuge at 4°C, 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the cells in 100-150 μl pre-cooled sorbitol (1 mol / L).

[0034] 3.2.2 Transformation and screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / ml-8 mg / ml).

[0035] The obtained transformants were transferred to BMGY medium and cultured at 30°C and 250 rpm for 1 day; then transferred to BMMY medium and cultured at 30°C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 days; the bacteria were removed by centrifugation at 9000 rpm for 10 minutes to obtain the fermentation supernatant containing lipase RL and lipase mutants, respectively.

[0036] 3.3 Lipase activity assay (1) Definition of lipase activity unit Under the conditions of 40°C and pH 7.5, the amount of enzyme required to hydrolyze the substrate to produce 1 μmol of titratable fatty acid in 1 min is one enzyme activity unit U.

[0037] (2) Enzyme activity determination method Weigh 40g of polyvinyl alcohol (PVA: degree of polymerization 1750±50), add 800ml of water, soak for 4-6h, heat in a boiling water bath, stir until completely dissolved, stir and cool, then make up to 1000ml, filter with clean 6-8 layers of gauze, and set aside the filtrate.

[0038] Take 150ml of the above filtrate, add 50ml of olive oil, and process it with a high-speed homogenizer for 10 minutes (process it 4 times, with an interval of 5 minutes, and each time for 2-3 minutes), and you will get a milky white PVA emulsion. Prepare it before use.

[0039] Take two 100ml Erlenmeyer flasks, add 4ml of substrate solution and 5ml of pH 7.5 phosphate buffer to the blank bottle (A) and the sample bottle (B), respectively, then add 15ml of 95% ethanol to the blank bottle (A), and preheat in a 40℃ water bath for 5min; Add 1 ml of the enzyme solution to be tested to the blank bottle (A) and the sample bottle (B), mix well and time immediately. After the reaction lasts for 15 minutes, use a sample pipette to immediately add 15 ml of 95% ethanol to the sample bottle (B) to terminate the reaction and take it out; Pour the above reaction solution into a 50ml beaker, add 5ml of pure water to the conical flask, shake well and pour into the 50ml beaker, add 2 drops of phenolphthalein indicator; Using a pH meter calibrated for alkaline conditions, add 0.05 mol / L sodium hydroxide solution to the beaker under stirring and titrate to a pH of 9.92. Titrate until the pH value does not change within 20 seconds as the endpoint, and record the volume of the sodium hydroxide standard solution consumed.

[0040] Enzyme activity calculation formula: X=[( V1- V2)×C×50×n] / (0.05×15).

[0041] X——lipase activity, U / ml; V1——the volume of sodium hydroxide standard solution consumed when titrating the sample, ml; V2——the volume of sodium hydroxide standard solution consumed when titrating the blank, ml; C——Concentration of sodium hydroxide standard solution, mol / L; 50——1ml of 0.05mol / L sodium hydroxide solution is equivalent to 50μmol of fatty acid; n——enzyme solution dilution multiple; 0.05——Conversion coefficient of sodium hydroxide standard solution concentration; 15——Time conversion factor.

[0042] (3) Enzyme activity assay results The enzyme activity was tested according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the Pichia pastoris recombinant strain expressing the recombinant lipase RL and its mutants constructed above was 480-540 U / ml.

[0043] Example 4 Analysis of heat resistance of lipase mutants The fermentation supernatant of the Pichia recombinant strain expressing the recombinant lipase RL and its mutants constructed above was diluted to about 20 U / ml with a phosphate buffer of pH 7.5, and the residual enzyme activity was determined after treatment at 80°C for 3 min. The enzyme activity of the untreated sample was taken as 100% to calculate the residual enzyme activity rate. The specific results are shown in Table 1.

[0044] Table 1 Analysis of heat resistance of lipase mutants Lipase mutant Residual enzyme activity after treatment at 80℃ for 3 minutes Wild-type RL 31.00% R163T 69.82% From the results in Table 1, it can be seen that compared with the wild-type lipase RL, the lipase mutant containing the single mutation site R163T provided by the present invention has an enzyme activity residual rate of up to 69.82% after being treated at 80°C for 3 minutes, and the heat resistance is significantly enhanced, achieving unexpected technical effects.

[0045] Example 5 Preparation of immobilized lipase and its application in OPL synthesis 5.1 Preparation of immobilized lipase Take 500 ml of the concentrated enzyme solution of the lipase mutant, add 100 g of macroporous resin, and stir at 30° C. and 200 rpm for 12 hours. After stirring, filter the solution, and dry the resin in a fluidized bed to obtain the immobilized lipase mutant.

[0046] 5.2 Preparation of OPL structured lipids Take 100g of palmitic acid stearin, add 200g of oleic acid, 400g of linoleic acid, and 15g of immobilized lipase, and stir at 60°C and 300rpm for 12h. After stirring, the solution is filtered, and after the immobilized lipase is separated, the contents of OPO, OPL, and LPL in the reaction solution are detected by high performance liquid chromatography-evaporative light scattering detector (HPLC-ELSD).

[0047] The results showed that the immobilized lipase mutant provided by the present invention catalyzed the transesterification of palmitic stearin with oleic acid and linoleic acid, and the contents of OPL, OPO and LPL in the generated reaction solution were as high as 4.56%, 1.73% and 2.49%, respectively.

[0048] In summary, the lipase mutant provided by the present invention has stronger heat resistance and is more suitable for application in the fields of functional lipid processing than the wild type, and has broad prospects.

Claims

1. A lipase mutant, characterized in that: The amino acid sequence of the mutant is SEQ ID NO:

5.

2. A DNA molecule encoding the lipase mutant according to claim 1.

3. A recombinant expression vector comprising the DNA molecule of claim 2.

4. A host cell comprising the recombinant expression vector according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ) or Aspergillus niger ( Aspergillus niger ) or Trichoderma reesei ( Trichoderma reesei ).

6. Use of the lipase mutant according to claim 1 in synthesizing functional lipids.

7. The use according to claim 6, characterized in that The functional lipid is 1-oleyl-2-palmityl-3-linoleyl triglyceride.