Microcystis fungus, anti-inflammatory and anti-osteoporosis compound as well as preparation method and application of anti-inflammatory and anti-osteoporosis compound

Abstract

The invention discloses a microcystis fungus, an anti-inflammatory and anti-osteoporosis compound as well as a preparation method and application of the microcystis fungus and the anti-inflammatory and anti-osteoporosis compound. According to the invention, two cyclic ester peptide compounds, i.e., Microascusin A (formula I) and Microascusin B (formula II), with new structures, are obtained from sponge-derived fungus Microascusin, i.e., Microascusin A (formula I) and Microascusin B (formula II), and the microascusin A (formula I) and Microascusin B (formula II) are obtained from sponge-derived fungus Microascusin. The microcystin A and the microcystin B are natural products obtained through microbial fermentation, the raw materials are easy to obtain, and the microcystin A and / or the microcystin B and the pharmaceutical composition can be used for preventing and treating inflammation and / or osteoporosis. The microcystin A and / or microcystin B can also be combined with known medicines to form a compound preparation for preventing and treating inflammation and / or osteoporosis. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the field of medicine and biology, and specifically relates to a Microcystis fungus, an anti-inflammatory and anti-osteoporosis compound, and a preparation method and application thereof. Background Art

[0002] Osteoporosis (OP) is a common systemic bone disease characterized by decreased or lost bone mass, damage to bone tissue microstructure, increased bone brittleness, decreased bone density, and patients are prone to fractures [Kanin JA, et al. Osteoporos. Int., 1994, 4 (6): 368-381]. Osteoporosis is divided into primary osteoporosis, secondary osteoporosis, and idiopathic osteoporosis. Primary osteoporosis includes postmenopausal osteoporosis (PMOP) (type I), senile osteoporosis (type II) and idiopathic osteoporosis (including adolescent type). Secondary osteoporosis refers to osteoporosis caused by any disease and (or) drug that affects bone metabolism and other clear causes. The clinical manifestations of osteoporosis are usually back pain or general bone pain, spinal deformity and fractures. Osteoporosis is common in postmenopausal women and elderly men [Kenny A., et al. Clin Cornestone, 2000, 2 (6): 45-51]. According to statistics, about one-third of women and one-fifth of men over the age of 50 will suffer from osteoporosis-induced fractures, which seriously affects the quality of life of patients and increases mortality [Johnell O. et al, Osteoporos Int., 2005, 16 (Suppl 2): ​​S3-7]. With the aging of the population, the prevalence of osteoporosis has increased rapidly and has become an important public health issue. Bone tissue is always undergoing bone reconstruction. Bone reconstruction is an important renewal mechanism of bone tissue and is necessary to maintain its structural integrity and bone strength. The basic multicellular unit composed of osteoblasts, osteoclasts and osteocytes is completed through repeated, spatiotemporally coupled bone resorption and bone formation processes, which is called "bone reconstruction" [Chen X., et al, Connect. Tissue Res., 2018, 59 (2): 99-107]. Before adulthood, bones are constantly constructed and shaped, and bone formation is greater than bone resorption, which makes bones larger and increases bone mass; in adulthood, bone reconstruction is balanced and bone mass is maintained; with menopause and aging in women, bone resorption is greater than bone formation, and unbalanced bone reconstruction leads to bone loss and destruction of bone microstructure. The cause of osteoporosis is that osteoclast activity is greater than osteoblast activity, resulting in bone resorption greater than bone formation, unbalanced bone reconstruction, and ultimately impaired bone quality. Bone metabolism is affected by inflammation, which is an important cause of bone loss caused by chronic diseases and aging [Yu, B.; Wang, CY Periodontol. 2000, 2022, 89(1): 99-113; Adami, G. Best Pract. Res. Clin. Endocrinol. Metab. 2022, 36, 101611].Senescent cells are associated with inflammation and extracellular matrix remodeling by secreting senescence-associated secretory phenotype (SASP) factors; the proinflammatory microenvironment in turn increases cellular stress and triggers senescence of neighboring cells, forming a positive feedback loop. In addition, aging can promote the colonization of pathogenic microorganisms, and bacterial lipopolysaccharide (LPS) and other substances can trigger a proinflammatory microenvironment. In the systemic and local bone microenvironment, increased inflammation disrupts the balance between osteoclasts and osteoblasts, leading to the uncoupling of bone remodeling, ultimately leading to bone loss and increased fracture risk.

[0003] At present, the main method for treating osteoporosis is through calcium supplementation or bisphosphonate drugs, but it is accompanied by disadvantages such as poor absorption, ineffectiveness, and large side effects. The bisphosphonate drugs currently used to prevent and treat osteoporosis mainly include: alendronate sodium, zoledronic acid, rizaldronate sodium, ibandronate sodium, and minodronic acid. However, long-term use of bisphosphonates can excessively inhibit bone turnover, affect bone strength, and have nephrotoxicity. Therefore, there is an urgent need to develop anti-osteoporosis drugs with reasonable prices and better efficacy.

[0004] Marine microorganisms have diverse metabolic pathways and complex genetic backgrounds, and thus can produce more active monomer compounds with novel structures. According to statistics, the success rate of marine drug research and development is 2 to 3 times that of non-marine drugs. At present, tens of thousands of new compounds have been discovered from marine organisms, including anti-resistant bacterial infection, antiviral, cytotoxic and antiprotozoal active compounds. Marine microbial metabolites are characterized by a wide range of sources, rich structures, high activity and low toxicity, and are an important source of new drugs for the treatment of osteoporosis. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to prevent and / or treat osteoporosis.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a cyclic ester peptide compound or a pharmaceutically acceptable salt, ester, or solvate thereof.

[0008] The structural formula of the cyclic ester peptide compound is shown in Formula III:

[0009]

[0010] In the formula III, R1, R2, R3, and R4 are independently selected from any of the following groups: hydrogen, C1-C6 alkyl, and hydroxyl; R5 is selected from any of the following groups: C1-C6 alkyl, cyano, cyano-substituted C1-C6 alkyl, amino, amino-substituted C1-C6 alkyl, hydroxyl, and halogen; R6, R7, R8, and R9 are independently selected from any of the following groups: hydrogen, C1-C6 alkyl, C1-C6 unsaturated hydrocarbon group, and C6-C9 aryl group.

[0011] Furthermore, the C1-C6 alkyl group described in R1, R2, R3, and R4 may be a methyl group; the C1-C6 alkyl group substituted by a cyano group described in R5 may be a cyanomethyl group or a cyanoethyl group, and the C1-C6 alkyl group substituted by an amino group described in R5 may be an aminomethyl group or an aminoethyl group; the C1-C6 alkyl group described in R6, R7, R8, and R9 may be a methyl group, an ethyl group, a n-propyl group, an isopropyl group, a n-butyl group, an isobutyl group, a n-pentyl group, an isopentyl group, a n-hexyl group, or an isohexyl group.

[0012] Furthermore, the cyclic lipopeptide compound can be specifically microascusin A or microascusin B. Both microascusin A and microascusin B are fermentation products from Microascus croci IMB19-064.

[0013] The structural formula of the microcystin A is shown in Formula I, and the structural formula of the microcystin B is shown in Formula II:

[0014]

[0015] Hcba in Formula I and Formula II represents a 2-hydroxy-4-cyanobutyric acid residue, aIle represents an alloisoleucine residue, Val represents a valine residue, Melle represents an N-methylisoleucine residue, Sar represents an N-methylglycine residue, Gly represents a glycine residue, MeLeu represents an N-methylleucine residue, and Pip represents a piperidine-2-carboxylic acid residue.

[0016] The molecular formula of microcystin A is C 41 H 68 N8O9, molecular weight is 817; the molecular formula of microcystin B is C 40 H 66 N8O9, molecular weight is 803.

[0017] The cyclic ester peptide compounds of the present invention can be used in the form of pharmaceutically acceptable salts or solvates derived from inorganic or organic acids. The term "pharmaceutically acceptable salt" refers to salts that are suitable for contact with human and lower animal tissues without excessive toxicity, irritation, allergic reactions, etc., and are commensurate with a reasonable effect / risk ratio within the scope of reliable medical judgment. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge, et al., J. Pharmaceutical Sciences, 1977, 66: 1 describes pharmaceutically acceptable salts in detail. The salts can be prepared by reacting the free base functionality of the compounds of the present invention with a suitable organic acid.

[0018] In a second aspect, the present invention provides the use of the cyclic ester peptide compound or a pharmaceutically acceptable salt, ester or solvate thereof described in the first aspect of the present invention in the preparation of a product for preventing and / or treating inflammation and / or osteoporosis and / or bone metabolism-related diseases.

[0019] Furthermore, the product may be a medicine, a composition, a health product or other biological product.

[0020] In a third aspect, the present invention provides a product.

[0021] The product comprises the cyclic ester peptide compound or a pharmaceutically acceptable salt, ester or solvate thereof as described in the first aspect of the present invention.

[0022] The active ingredient of the above-mentioned product may be the cyclic lipopeptide compound or a pharmaceutically acceptable salt, ester or solvate thereof. The active ingredient of the above-mentioned product may also contain other biological components or non-biological components. Those skilled in the art may determine the other active ingredients according to the therapeutic effect of the product.

[0023] The product has at least one of the following effects: 1) preventing and / or treating inflammation; 2) preventing and / or treating osteoporosis; 3) preventing and / or treating diseases related to bone metabolism.

[0024] The product may be a medicine, a composition, a health product or other biological product.

[0025] In the above, the product contains not only the cyclic lipopeptide compound or its pharmaceutically acceptable salt, ester or solvate, but also a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier may be 0.1-99.9% by weight of the total weight of the product.

[0026] Among them, the pharmaceutically acceptable carrier includes microcrystalline cellulose, sodium carboxymethyl cellulose, low-substituted hydroxypropyl cellulose, mannitol, sorbitol, sorbic acid or potassium salt, sodium pyrosulfite, sodium bisulfite, sodium thiosulfate, cysteine ​​hydrochloride, thioglycolic acid, methionine, vitamin A, vitamin C, vitamin E, vitamin D, azone, disodium EDTA, calcium sodium EDTA, carbonate, acetate, phosphate of monovalent alkali metal or its aqueous solution, hydrochloric acid, acetic acid, sulfuric acid, phosphoric acid, amino acid, sodium chloride, potassium chloride, sodium lactate, xylitol, maltose, glucose, Fructose, dextran, glycine, starch, sucrose, lactose, mannitol, silicon derivatives, cellulose and its derivatives, alginate, gelatin, polyvinyl pyrrolidone, glycerol, propylene glycol, ethanol, Tween 60-80, Span-80, beeswax, lanolin, liquid paraffin, cetyl alcohol, gallic acid esters, agar, triethanolamine, basic amino acids, urea, allantoin, calcium carbonate, calcium bicarbonate, surfactant, polyethylene glycol, cyclodextrin, β-cyclodextrin, phospholipid materials, kaolin, talc, calcium stearate, magnesium stearate and microcrystals.

[0027] The inflammation and osteoporosis inhibitors or anti-inflammatory and anti-osteoporosis drugs of the present invention can be prepared into any desired dosage form such as tablets, sugar-coated tablets, film-coated tablets, enteric-coated tablets, capsules, hard capsules, soft capsules, oral liquids, lozenges, granules, pills, powders, pastes, pills, suspensions, solutions, injections, suppositories, ointments, plasters, creams, sprays, and patches.

[0028] In a fourth aspect, the present invention provides a method for preparing microcystin A shown in formula I.

[0029] The preparation method of microcystin A provided by the present invention comprises the following steps: culturing Microcystis aurantii with a culture medium, collecting a fermentation product; and separating microcystin A from the fermentation product.

[0030] In a fifth aspect, the present invention provides a method for preparing microcystin B shown in formula II.

[0031] The preparation method of microcystin B provided by the present invention comprises the following steps: culturing Microcystis citrinum with a culture medium, collecting a fermentation product; and separating microcystin B from the fermentation product.

[0032] In the above-mentioned preparation method of microascus A and preparation method of microascus B, the Microascus croci is Microascus croci, whose strain number is IMB19-064, and its registration number in the General Microbiological Center of China National Microbiological Culture Collection is CGMCC No.40883.

[0033] In the above-mentioned preparation method of microcystin A and the preparation method of microcystin B, the culture medium can be a solid culture medium, a semi-solid culture medium or a liquid culture medium. The culture medium is selected from: including but not limited to rice or a solid or liquid culture medium with rice, brown rice, millet, corn, and potato as the main components. The culture medium can be a rice culture medium, a potato dextrose culture medium (PDB), a potato dextrose agar culture medium (PDA) or other fungal fermentation culture medium well known to professionals in the field. The rice culture medium can be made of rice and water, or rice, water and inorganic salts, or rice, water and nitrogen source, or rice, water, nitrogen source and inorganic salts. The potato dextrose culture medium (PDB) can be made of potato, glucose and water, or potato, glucose, water and inorganic salts, or potato, carbon source, water and nitrogen source, or potato, carbon source, nitrogen source and inorganic salts. The potato dextrose agar medium (PDA) can be made of potato, glucose, agar and water, or potato, glucose, agar, water and inorganic salts, or potato, carbon source, agar, water and nitrogen source, or potato, carbon source, agar, nitrogen source and inorganic salts. The fungal fermentation medium known to other professionals in the field can be made of one or more fast-acting and slow-acting carbon sources, one or more fast-acting and slow-acting nitrogen sources, water and / or inorganic salts. Among them, the carbon source is a type of nutrient for microbial growth, which is a carbon-containing compound, including fast-acting and slow-acting carbon sources such as sugars, oils, organic acids and organic acid esters and small molecule alcohols. Nitrogen source refers to a substance that provides nitrogen elements required for microbial nutrition, including fast-acting and slow-acting nitrogen sources such as peanut cake powder, soybean cake powder, yeast powder, peptone, ammonia water, ammonium salts and nitrates.

[0034] Furthermore, the rice can be rice or brown rice. Rice or brown rice are both products of rice. Rice refers to the fruit without removing the husk of rice, and rice is composed of husk, pericarp, seed coat, endosperm, endosperm, endosperm and embryo. Brown rice refers to the product of removing the husk of rice and retaining other parts of rice; rice refers to the product of retaining only the endosperm and removing all other parts of rice.

[0035] In the preparation method of microcystin A and the preparation method of microcystin B, the culture method can be pure culture of microcystin A or co-culture or mixed culture of microcystin A with other bacteria and fungi. The other co-cultured bacteria are selected from: including but not limited to Escherichia coli, Bacillus, Staphylococcus aureus, Pseudomonas aeruginosa and other Gram-positive or -negative bacteria and actinomycetes such as Streptomyces, Micromonospora, Nocardia and the like; the other co-cultured fungi are selected from: including but not limited to Penicillium, Aspergillus, yeast and the like.

[0036] In one embodiment of the present invention, the culture method is pure culture of Microstomella citrinum.

[0037] In another embodiment of the present invention, the culturing method is to co-cultivate Microsaccharomyces cerevisiae and Escherichia coli.

[0038] The method for preparing microcystin A and / or microcystin B can be solid fermentation to prepare microcystin A and / or microcystin B. In the solid fermentation to prepare microcystin A and / or microcystin B, the culture medium can be a solid culture medium, and the fermentation product can be a solid fermentation product.

[0039] In the above solid fermentation to prepare microcystin A and / or microcystin B, the solid culture medium can be selected from: including but not limited to rice or a solid culture medium with rice, millet, corn and / or potato as the main components. In one embodiment of the present invention, the solid culture medium is a rice solid culture medium, and its formula is: 100g rice, 0.3g peptone, 3g sea salt, 100mL deionized water, sterilized at 121°C for 15 minutes to obtain the rice solid culture medium.

[0040] In the above-mentioned solid fermentation product for preparing microcystin A and / or microcystin B, the method for isolating microcystin A and / or microcystin B from the fermentation product may include the following steps: (1) extracting the fermentation product with an organic solvent to obtain an extract; (2) subjecting the extract to silica gel column chromatography, gradient eluting with a solvent, separating the eluted active components by gel column chromatography, and then separating by HPLC to obtain microcystin A and / or microcystin B.

[0041] The method for preparing microcystin A and / or microcystin B can be liquid fermentation to prepare microcystin A and / or microcystin B. In the liquid fermentation to prepare microcystin A and / or microcystin B, the culture medium can be a liquid culture medium, and the fermentation product can be a liquid fermentation product.

[0042] In the above liquid fermentation to prepare microcystin A and / or microcystin B, the liquid culture medium can be selected from: including but not limited to rice or a liquid culture medium with rice, millet, corn and / or potato as the main components. In one embodiment of the present invention, the liquid culture medium is potato dextrose medium (PDB).

[0043] In the above-mentioned liquid fermentation product for preparing microcystin A and / or microcystin B, the method for isolating microcystin A and / or microcystin B from the fermentation product may include the following steps: (a) centrifuging the liquid fermentation product to obtain a supernatant and mycelium, subjecting the supernatant to solid phase extraction with a macroporous resin, eluting with a solvent to obtain a supernatant extract, and ultrasonically extracting the mycelium with a solvent to obtain a mycelium extract; (b) combining the supernatant extract and the mycelium extract, separating them by silica gel column chromatography, gradient eluting with a solvent, separating the eluted active components by gel column chromatography, and then separating them by HPLC preparation to obtain microcystin A and / or microcystin B.

[0044] In the above-mentioned liquid or solid fermentation to prepare microcystin A and / or microcystin B, the solvents of step (1) and step (a) can be selected from: chloroform, dichloromethane, ethyl acetate, alcohols with a carbon chain ≤ 4 (such as methanol, ethanol, etc.), acetone, butanone, or mixed solutions of the above solvents. In one embodiment of the present invention, in the solid fermentation to prepare microcystin A and / or microcystin B, the solvent is a mixed solvent of ethyl acetate and methanol, and the volume ratio of the two can be 9:1. In one embodiment of the present invention, in the liquid or solid fermentation to prepare microcystin A and / or microcystin B, the solvent can be acetone.

[0045] In the above liquid or solid fermentation to prepare microcystin A and / or microcystin B, the solvents of step (2) and step (b) may be selected from: including but not limited to acetone aqueous solution, alcohol solution with carbon chain ≤ 4, acetonitrile aqueous solution, methanol, one or more solvents mixed solution. In one embodiment of the present invention, the solvent is a mixed solution of dichloromethane and methanol.

[0046] In the above liquid or solid fermentation to prepare microcystin A and / or microcystin B, the mobile phase used in the silica gel column chromatography separation is a mixed solution of dichloromethane and methanol, and the elution procedure is as follows: 1) first elute with 100:1 (v / v) dichloromethane-methanol solution for 3.5 column volumes; 2) then elute with 50:1 (v / v) dichloromethane-methanol solution for 7 column volumes; 3) then elute with 20:1 (v / v) dichloromethane-methanol solution for 5 column volumes; 4) then elute with 9:1 (v / v) dichloromethane-methanol solution for 6.5 column volumes; collect the liquid eluted with the 50:1 dichloromethane-methanol solution, and name the liquid as fraction F2, and / or collect the liquid eluted with the 20:1 dichloromethane-methanol solution, and name the liquid as fraction F3. In the above fermentation preparation of microcystin A and / or microcystin B, the preparation method comprises separating microcystin A and microcystin B from the fractions F2 and / or F3.

[0047] In the above-mentioned liquid or solid fermentation to prepare microcystin A and / or microcystin B, the medium used in the gel column chromatography separation includes but is not limited to Sephadex LH-20, Tosoh Toyopearl HW-40C; in one embodiment of the present invention, it is Sephadex LH-20. The mobile phase selected in the gel column chromatography separation can be selected from: chloroform, dichloromethane, ethyl acetate, alcohols with a carbon chain ≤ 4 (such as methanol, ethanol, etc.), acetone, butanone, water, or a mixed solution of the above solvents. In one embodiment of the present invention, it is a mixed solution of dichloromethane and methanol in a volume ratio of 1:1.

[0048] In the above liquid or solid fermentation preparation of microcystin A and / or microcystin B, the chromatographic column used in the HPLC preparation and separation may include but is not limited to C18 chromatographic column, C8 chromatographic column, C3 chromatographic column and phenyl bonded column. In one embodiment of the present invention, the filler selected for the chromatographic column is Capcell C18 MG-Ⅱ.

[0049] The mobile phase used in the HPLC preparative separation can be selected from: acetone aqueous solution, alcohol solution with a carbon chain of ≤4, acetonitrile aqueous solution, methanol aqueous solution, and in one embodiment of the present invention, it is methanol aqueous solution.

[0050] In a sixth aspect, the present invention also protects the above-mentioned Microsaccharomyces citrinum.

[0051] The Microascus croci is Microascus croci, the strain number of which is IMB19-064, and the registration number of which in the General Microbiological Center of China National Microbiological Culture Collection is CGMCC No.40883.

[0052] In a seventh aspect, the present invention provides a bacterial agent for preparing anti-inflammatory and / or anti-osteoporosis drugs.

[0053] The bacterial agent for preparing anti-inflammatory and / or anti-osteoporosis drugs contains the Microsaccharum citrinum described in the sixth aspect of the present invention or / and the metabolites of the Microsaccharum citrinum.

[0054] The active ingredients of the above-mentioned bacterial agent may be the above-mentioned Microsaccharomyces citrinum and / or the metabolites of the above-mentioned Microsaccharomyces citrinum. The active ingredients of the above-mentioned bacterial agent may also contain other biological components or non-biological components. Those skilled in the art may determine the other active ingredients of the above-mentioned bacterial agent based on the anti-inflammatory and / or anti-osteoporosis effects of the bacterial agent.

[0055] In the above, the metabolite of Microsaccharum aurantifolium may be a fermentation product of Microsaccharum aurantifolium.

[0056] In an eighth aspect, the present invention provides a method for preventing and / or treating inflammation and / or osteoporosis and / or bone metabolism-related diseases.

[0057] The method for preventing and / or treating inflammation and / or osteoporosis and / or bone metabolism-related diseases provided by the present invention comprises administering to a subject in need thereof an effective amount of the cyclic ester peptide compound described in the first aspect of the present invention or a pharmaceutically acceptable salt, ester, solvate thereof or the product described in the third aspect of the present invention.

[0058] In the present invention, the inflammation may be at least one of the following: osteoporosis and osteoarthritis associated with inflammation, atherosclerosis and cardiovascular disease associated with endothelial cell inflammation, and the like.

[0059] In the present invention, the anti-inflammatory drug may be a drug for treating and / or preventing inflammatory diseases.

[0060] In the present invention, the osteoporosis may be at least one of the following: 1) primary osteoporosis, including postmenopausal osteoporosis (type I), senile osteoporosis (type II), idiopathic osteoporosis (juvenile type); 2) secondary osteoporosis, i.e. osteoporosis caused by diseases or drugs that affect bone metabolism.

[0061] In the present invention, the anti-osteoporosis drug may be a drug for treating and / or preventing osteoporosis.

[0062] In the present invention, the bone metabolism-related diseases include osteoarthritis, osteoporosis and abnormal bone metabolism diseases caused by other reasons.

[0063] Furthermore, microcystin A and microcystin B in the present invention have at least one of the following effects: promoting bone formation, inhibiting osteoclast formation, inhibiting bone resorption, and anti-osteoporosis.

[0064] The compound microcystin A shown in Formula I of the present invention and the compound microcystin B shown in Formula II can inhibit osteoclast differentiation induced by receptor activator for nuclear factor-κB ligand (RANKL) at concentrations of 0.1nM and 0.1μM, respectively, and significantly inhibit the formation of F-actin ring at concentrations of 10nM and 10μM, respectively, thereby inhibiting osteoclast differentiation. The compound microcystin A shown in Formula I of the present invention can improve the bone mineralization impairment of zebrafish model animals caused by dexamethasone to varying degrees at concentrations of 10 and 20μM, and its activity is equivalent to that of the positive drug alendronate sodium.

[0065] The compound microcystin A shown in formula I and the compound microcystin B shown in formula II of the present invention can be used for the treatment of inflammation and / or osteoporosis. Microcystin A and microcystin B are natural products obtained by microbial fermentation, and the raw materials are easily available. Therefore, they can be used as the lead compounds of anti-inflammatory and / or anti-osteoporosis drugs for structural optimization to develop anti-inflammatory and / or anti-osteoporosis drugs with better activity. Microcystin A and / or microcystin B are used as active ingredients and are compatible with one or more pharmaceutically acceptable carriers, excipients or adjuvants to prepare an anti-inflammatory and / or anti-osteoporosis pharmaceutical composition. Microcystin A and / or microcystin B and the pharmaceutical composition can be used for the clinical treatment of inflammation and / or osteoporosis. Microcystin A and / or microcystin B can also be combined with known drugs to form a compound preparation for the treatment of inflammation and / or osteoporosis.

[0066] Collection Instructions

[0067] Strain name: Microascus croci, strain number: IMB19-064, depository institution: General Microbiology Center of China Microorganism Culture Collection Administration, abbreviation of depository institution: CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, deposit date: September 21, 2023, registration number of the depository center: CGMCC No.40883. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 The high resolution electrospray ionization (HRESIMS) mass spectrum of the compound represented by formula I is shown in FIG.

[0069] Figure 2 The compound shown in formula I 1 H NMR spectrum.

[0070] Figure 3 The compound shown in formula I 13 C NMR spectrum.

[0071] Figure 4 This is the high resolution electrospray ionization (HRESIMS) mass spectrum of the compound represented by formula II.

[0072] Figure 5 The compound represented by formula II 1 H NMR spectrum.

[0073] Figure 6 The compound represented by formula II 13 C NMR spectrum.

[0074] Figure 7 The results of the inhibition of THP cell adhesion by the compound represented by compound formula I ( Figure 7 A) and the expression of inflammation-related proteins inhibited by the compound shown in Formula I ( Figure 7 (middle B).

[0075] Figure 8 The results of the compounds of formula I and formula II promoting osteoblast differentiation; Figure 8 Middle A is the alkaline phosphatase (ALP) staining result of MC3T3-E1 cells; Figure 8 Middle B is the result of Alizarin Red (ARS) staining of calcified nodules; Figure 8 Middle C and Figure 8 D in the middle is the quantitative graph of ARS staining results.

[0076] Fig. 9 The inhibitory effect of compounds of formula I and formula II on RANKL-induced osteoclast formation; Fig. 9 A in the middle is the TRAP staining result of the effect of the compound on RANKL-induced osteoclast formation; Fig. 9 Middle B is a quantitative graph of the inhibitory effect of the compound on RANKL-induced osteoclast formation; Fig. 9 C in the middle is the effect of the compound on the expression of osteoclast-related proteins.

[0077] Fig.10 The results are the effects of the compounds shown in Formula I and Formula II on the formation of the F-actin ring.

[0078] Fig.11 The results are the anti-osteoporosis effects of the compound of formula I in zebrafish model. DETAILED DESCRIPTION

[0079] The present invention is further described in detail below in conjunction with specific embodiments, and the examples given are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0080] The embodiments of the present invention are applicable to the preparation of microcystin A and / or microcystin B and its derivatives from any microorganism, not limited to the liquid or solid fermentation products of pure culture of Microcystis citrinum or co-culture with other bacteria or fungi. The following examples are provided to help those skilled in the art to better understand the present invention, but they do not limit the present invention in any way.

[0081] Example 1. Isolation and Identification of Microascus croci IMB19-064

[0082] 1. Isolation of strains:

[0083] Microascus croci IMB19-064 (CGMCC No.40883) (Microascus croci IMB19-064) was isolated from sponges on Weizhou Island, Beihai (21°1'35"N, 109°6'38"E). After the sponges were collected, they were brought back to the laboratory for processing the next day. The process is as follows: 1) Sponge surface cleaning: rinse the sponge surface with slow-flowing sterile artificial seawater; 2) Sponge sample surface disinfection: first wrap the sponge sample with gauze soaked in 75% alcohol and let it stand for 1 minute, rinse with 75% alcohol for 30 seconds, rinse with sterile artificial seawater 3 times, and then use sterile dry gauze paper to absorb the moisture on the sponge sample surface; 3) Sponge sample crushing: use a sterile scalpel to cut the above sponge sample into 0.5cm 2 Place sponge pieces of different sizes into a tissue crusher, add 2 mL of sterile artificial seawater, and process for 5 min to crush the sponge samples into a homogenate for subsequent bacterial strain isolation.

[0084] Method for strain isolation: Place the above-mentioned sponge sample homogenate on a sterile plate in an ultra-clean workbench, dip the homogenate with a sterile rubber stopper, and press it clockwise on the MEA separation medium (formula: peptone 5g / L, malt extract 30g / L, agar 15g / L, sea salt 30g / L, streptomycin 0.2g / L, penicillin sodium 0.25g / L, Bengal red 0.03g / L, penicillin sodium 0.2g / L) plate according to the wet mud stamp method, place it in a 28°C constant temperature incubator, culture for 1 week, pick a single colony on a newly configured PDA (formula: glucose 20g / L, potato extract powder 3g / L, agar 15g / L, sea salt 30g / L) plate, and streak purification. The purified strain IMB19-064 was transferred to PDA slant culture medium, cultured at 28°C for 7 days, and then stored at 4°C for short-term storage after growth.

[0085] 2. Identification of strains:

[0086] 2.1 Morphological characteristics

[0087] Strain IMB19-064 forms round, oval, and irregular colonies with dry surfaces on most culture media, with a maximum colony diameter of 0.9 mm; the initial mycelium is gray and dense, while the later aerial mycelium is abundant, mostly flocculent, gray to orange, and differentiated into long spore chains that are wavy; the mycelium in the base is gray-brown.

[0088] 2.2 Sequence determination and analysis: Based on the conservation of the ITS region DNA sequence in microbial species, the fungus IMB19-064 was identified. The genomic DNA of strain IMB19-064 was extracted, and its ITS gene was amplified by PCR and sequenced. The sequencing results showed that the ITS gene of strain IMB19-064 had a DNA fragment with a nucleotide sequence of sequence 1 in the sequence list. The sequence results were compared and analyzed in the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The ITS sequence similarity of strain IMB18-064 and strain Microascus croci (GenBank Accession No.MH856123) was the highest, at 99%.

[0089] The nucleotide sequence of sequence 1 is as follows:

[0090] cactgacagggccagcgagtacctccttgaccgaaaggtccgggtaatcttgttaaaccc 60

[0091] tgtcgtgctggggatagagcattgcaattattgctcttcaacgaggaatccctagtaagc 120

[0092] gcaagtcatcagcttgcgttgattacgtccctgccctttgtacacaccgcccgtcgctac 180

[0093] taccgattgaatggctcagtgaggcctccggactggcccagagaggcgggcaactgccac 240

[0094] tcagggccggaaagctgtccaaactcggtcatttagaggaagtaaaagtcgtaacaaggt 300

[0095] ctccgtaggtgaaccagcggagggatcattaccgaagttactcttcatacccatttgtga 360

[0096] acactaccccattgccgcgcgttgcctcggcggtgaggtctgcggtggggccgcgctccg 420

[0097] gcgctccccaccccgggcccccgccggccgcgccgaactcttaatttgcaaagcggactg 480

[0098] tacgttctgattaatcttgaaaaaaacaagtcaaaactttcaacaacggatctcttggtt 540

[0099] ctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtg 600

[0100] aatcatcgaatctttgaacgcacattgcgcccggcagcaatctgccgggcatgcctgtcc 660

[0101] gagcgtcatttcttccctcgagcgcggttcggtccctaggggcctgccgccgcccggtgt 720

[0102] tggggatctgcgggcgtagaagcccgcaggcccttaaatgaagtggcggtcccgccgcgg 780

[0103] cgccccctgcgtagtagtaaagcacctcgcatcgggtcccggcgtaggccagccgtcgaa 840

[0104] cctattacttttgatggtttgacctcggatcaggtagggataccccgctgaacttaagcat 900

[0105] atc 903.

[0106] According to the morphological characteristics and ITS gene sequence of strain IMB19-064, strain IMB19-064 was determined to be Microascus croci. Strain IMB19-064 was deposited in the General Microbiological Center of China Microbiological Culture Collection Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101) on September 21, 2023, with the deposit number of CGMCC No. 40883. Hereinafter referred to as Microascus croci IMB19-064.

[0107] Example 2: Isolation, preparation and structural identification of microcystin A of Formula I and microcystin B of Formula II

[0108] 1. Preparation of Seed Solution

[0109] 1.1 Preparation of seed solution of Microcystis citrinum IMB19-064

[0110] The spore liquid of Microspore citrinum IMB19-064 was inoculated on a PDA plate (formula: glucose 20 g / L, potato extract powder 3 g / L, agar 15 g / L, sea salt 30 g / L, the rest is water; sterilized at 121°C for 15 minutes to obtain PDA medium), placed in a 28°C constant temperature incubator for 5-7 days, and scratched with a sterile bamboo stick about 3 cm 2 The bacteria-containing agar block was inoculated into 100 mL of liquid PDB fermentation medium [formula: 20 g / L glucose, 3 g / L potato extract powder, 30 g / L sea salt, and the rest water; sterilized at 121°C for 15 minutes to obtain PDB liquid medium], and cultured in a 500 mL Erlenmeyer flask at 28°C, 200 r / min, with shaking for 3 days to obtain the seed liquid of Microcystis citrinum IMB19-064.

[0111] 1.2 Preparation of Escherichia coli ATCC 25922 seed solution

[0112] E. coli ATCC 25922 was inoculated on a nutrient agar plate (Beijing Sanyao Technology Development Co., Ltd.), and the plate was placed in a 37°C constant temperature incubator for 12 hours for recovery. A single colony was picked from the plate and inoculated into LB liquid culture medium, and cultured at 37°C for 12 hours. 5 mL of the above E. coli seed liquid was inoculated into 100 mL LB, and cultured at 37°C, 200 rpm, until the OD600 was between 0.2 and 0.4, to obtain the E. coli ATCC 25922 seed liquid.

[0113] 2. Preparation of compounds of formula I and formula II from the fermentation product of Microcystis citrinum IMB19-064

[0114] 2.1 Preparation of solid fermentation products and primary extracts of Microstomella citrinum IMB19-064

[0115] The seed liquid of the citrus aurantiacus IMB19-064 in step 1.1 was inoculated at a ratio of 10% into a 500mL triangular flask containing rice solid culture medium [formula: 100g rice, 0.3g peptone, 3g sea salt, 100mL deionized water, sterilized at 121°C for 15 minutes to obtain rice solid culture medium], a total of 60 bottles, and static cultured at 28°C for 30 days to obtain a solid pure culture fermentation product of the citrus aurantiacus. The solid culture product was extracted 3 times (12L×3) by ethyl acetate-methanol (9:1, v / v) ultrasonic (40kHz, 1h), and the extract was decompressed to recover the solvent to obtain 71g of the initial extract of the solid fermentation product.

[0116] 2.2 Preparation of liquid fermentation products and primary extracts of Microcystis citrinum IMB19-064

[0117] The seed liquid of the citrus spores IMB19-064 in step 1.1 was inoculated into 500mL triangular flasks containing 100mL potato dextrose medium (PDB) at a ratio of 10%, with a total of 300 flasks, and cultured at 28°C with shaking (200rpm) for 8 days to obtain the liquid pure culture fermentation product of citrus spores. The liquid fermentation product was centrifuged (6000rpm, 30min) to obtain the supernatant and mycelium. The supernatant was adsorbed by a macroporous resin (Amberlite XAD-7HP, purchased from Beijing Huideyi Technology Co., Ltd.) and eluted with acetone to obtain the supernatant extract. An equal volume of acetone was added to the mycelium and ultrasonically extracted (40kHz, 1h) 3 times, the extracts were combined, and the mycelium acetone extract was obtained after the solvent was recovered under reduced pressure. The supernatant extract and the mycelium acetone extract were combined to obtain a total of 64g of the initial extract of the liquid fermentation product.

[0118] 2.3 Preparation of solid fermentation products and primary extracts from co-culture of Microspores of Citrinum citrinum IMB19-064 and Escherichia coli

[0119] The seed solution of Escherichia coli ATCC 25922 in step 1.2 was inoculated into each bottle of 100g rice solid culture medium at a 10% inoculation ratio, and cultured at a constant temperature of 37°C for 4 days. Then, the seed solution of Microcystis citrinum IMB19-064 in step 1.1 was inoculated into a conical flask containing rice culture medium of Escherichia coli ATCC 25922 at a 10% inoculation ratio, a total of 60 bottles, and static cultured at 28°C for 30 days to obtain a co-cultured solid fermentation product of Microcystis citrinum and Escherichia coli. Ethyl acetate-methanol (9:1, v / v) was added to the co-cultured solid fermentation product and ultrasonically extracted (40kHz, 1h) 3 times (12L×3). After the extract was decompressed and the solvent was recovered, 86g of the initial extract of the co-cultured solid fermentation product was obtained.

[0120] 2.4 Separation and purification of compounds represented by formula I and formula II

[0121] The invention obtains two cyclic ester peptide compounds of new structure, Microascusin A (Formula I) and B (Formula II), from the fungus Microascus croci derived from sponge.

[0122]

[0123] The solid fermentation product primary extract, liquid fermentation product primary extract and co-culture solid fermentation product primary extract were separated by silica gel column chromatography. The medium used in the silica gel column chromatography was column chromatography silica gel (200-300 mesh, 500 g). The specifications of the silica gel column used were 60×550 mm (diameter×length), and the column volume was 1550 mL. The elution mobile phase is a mixed solution of dichloromethane and methanol, and the elution procedure is as follows: 1) first use a 100:1 dichloromethane-methanol solution (a liquid composed of dichloromethane and methanol, the volume ratio of dichloromethane to methanol in the liquid is 100:1) to elute 5500mL, and the fraction is collected and named as fraction F1; 2) then use a 50:1 dichloromethane-methanol solution to elute 11000mL, and the fraction is collected and named as fraction F2; 3) then use a 20:1 dichloromethane-methanol solution to elute 8000mL, and the fraction is collected and named as fraction F3; 4) then use a 9:1 dichloromethane-methanol solution to elute 10000mL, and the fraction is collected and named as fraction F4.

[0124] The fraction F2 (liquid eluted with a 50:1 dichloromethane-methanol solution) and / or F3 (liquid eluted with a 20:1 dichloromethane-methanol solution) collected by silica gel column chromatography was concentrated by a rotary evaporator, and the concentrate was subjected to gel column chromatography, with a dichloromethane-methanol (1:1, v / v) solution as the mobile phase. The separation medium used in the gel column chromatography was Sephadex LH-20, the column specifications were 23×98 mm (diameter×length), and the column volume was 414 mL. The elution procedure was as follows: 780 mL was eluted with a 1:1 dichloromethane-methanol solution (a liquid composed of dichloromethane and methanol, in which the volume ratio of dichloromethane to methanol was 1:1). The eluted liquid was continuously collected from the beginning of the elution procedure, 15 mL was collected in each tube, and a total of 52 tubes were collected. The collected effluent was detected by TLC and combined to obtain 11 fractions, namely fraction F 2-1 To F 2-11 and / or F 3-1 To F 3-11 Fraction F 2-2 and / or F 3-2(i.e., the collected liquid from tubes 8 to 15) was subjected to HPLC preparative separation, eluted with a methanol-water solution (a liquid composed of methanol and water, wherein the volume ratio of methanol to water in the liquid is 66:34) (flow rate 4 mL / min), and the elution peak with a retention time of 24.0 min was collected to obtain the compound shown in formula II (2.8 mg was separated from the co-culture solid fermentation product, 0.9 mg was separated from the pure culture solid fermentation product, and 0.5 mg was separated from the pure culture liquid fermentation product), and the elution peak with a retention time of 30.3 min was collected to obtain the compound shown in formula I (53.0 mg was separated from the co-culture solid fermentation product, 7.0 mg was separated from the pure culture solid fermentation product, and 3.0 mg was separated from the pure culture liquid fermentation product). The separation medium used in the HPLC preparative separation was Capcell C18 MG-Ⅱ, the filler particle size was 5 μm, the chromatographic column had a diameter of 10 mm, and a length of 250 mm.

[0125] 3. Structural Identification of Compounds Represented by Formula I and Formula II

[0126] 3.1 Compound represented by formula Ⅰ: Structural identification of microascusin A

[0127] 3.1.1 Identification of the planar structure of the compound represented by Formula I

[0128] White powder, easily soluble in methanol, DMSO, chloroform, etc. High-resolution electron spray mass spectrometry (HRESIMS) shows a single charge [M+H] at the high mass end + Quasi-molecular ion peak m / z 817.5188 (C 41 H 69 N8O9 theoretical value is 817.5188) and 1 [M+Na] + Adduct ion peak m / z 839.5047 (C 41 H 68 The theoretical value of N8O9Na is 839.5007)( Figure 1 ), and its molecular formula is estimated to be C 41 H 68 N8O9, the degree of unsaturation is 12. The IR spectrum of the compound represented by formula I is at 3301, 1751 and 1647 cm -1 The characteristic absorption peaks of amino, amide and ester bonds are shown at 2248 cm -1 It also shows the characteristic absorption peak of cyano group.

[0129] The compound shown in formula I 1 H NMR spectrum (CDCl3, 0℃, Figure 2 ) shows a better resolved signal, 13C NMR spectrum (CDCl3, 0°C, Figure 3 ) showed 123 discernible carbon signals. Compounds of Formula I 1 The H NMR spectrum showed three groups of similar but differently integrated hydrogen signals, with the ratio of the integrals of each group of hydrogen signals being 1.6:1.3:1. 13 The carbon signal in the CNMR spectrum also shows a similar intensity ratio. Combined with the mass spectrum data of the compound represented by Formula I, it is suggested that the compound represented by Formula I has three conformations A to C under this measurement condition, accounting for 41%, 33% and 26% respectively. 1 H NMR showed typical features of peptide compounds, including the low-field δ H There are 3 groups of 9 active hydrogen signals in the range of 6.52 to 8.61. H There are 33 α-aminomethyl, methylene or oxymethyl signals in the range of 3.29 to 5.81. H 0.51~1.11 showed 24 methyl signals. H 2.94~3.43 showed 3 groups of 9 nitrogen methyl signals. 13 The C NMR spectrum showed 3 groups of 123 carbon signals, each with 41 carbon signals. According to the DEPT spectrum, it was determined that there were 27 quaternary carbons (including C There are 3 groups of 24 carbonyl carbons in the range of 167.7 to 176.2. C There are 3 sp or sp in the range of 119.8 to 121.0 2 quaternary carbon), 30 methines (18 of which are nitrogen- or oxygen-linked methines: δ C 49.6~73.7), 33 methylene groups (including 9 nitrogen-containing methylene groups: δ C 40.3~54.0) and 33 methyl signals. The elemental composition determined according to the molecular formula of the compound shown in Formula I, infrared 2248cm -1 The characteristic absorption peaks and carbon spectrum chemical shifts indicate that δ C The quaternary carbon in the range of 119.8 to 121.0 is a cyano carbon. Based on the above data, it is preliminarily inferred that the compound shown in Formula I is a polypeptide compound composed of 8 amino or hydroxy acid units, including 11 methyl groups, 11 methylene groups, 10 methine groups, 8 carbonyl groups and 1 cyano group.

[0130] The planar structure of the compound shown in formula I is 1 H- 1 The 2D NMR spectral data such as H COSY, TOCSY, HSQC, HMBC and ROESY were further confirmed. 1 H- 1The correlation peak signals of H COSY and TOCSY confirmed that there were 7 groups of spin coupling systems and 1 pair of mutually coupled methylene protons in the compound of formula I. Further, through the correlation of NH or α-methine, methylene and carbonyl carbon in the HMBC spectrum, it was determined that there was an isoleucine residue (Ile 2 ), 1 valine residue (Val 3 ), 1 N-methylisoleucine residue (MeIle 4 ), 1 N-methylglycine residue (Sar 5 ), 1 glycine residue (Gly 6 ), 1 N-methylleucine residue (MeLeu 7 ) and one pipecolic acid residue (Pip 8 In addition to the above structural fragments, the compounds of formula I 13 There are still 5 carbon signals in the C NMR spectrum that have not been assigned, including 1 carbonyl carbon and 1 cyano carbon, as well as 3 carbon atoms assigned to the -CH-CH2-CH2- spin system. The chemical shift of the methine in this spin system (δ C 73.2, 73.6, 73.7), indicating that it is an oxygen-linked methylene group. In the HMBC spectrum, it was observed that the two pairs of methylene protons of the spin system O-CH-CH2-CH2- had correlation signals with the cyano carbon and carbonyl carbon signals, respectively. Therefore, it was determined that there was a cyano-substituted α-hydroxy acid unit in the structure, 2-hydroxy-4-cyanobutyric acid (Hcba 1 ). So far, it is determined that there are 8 amino acid structural units and 11 unsaturations in the compound represented by formula I, and there is still 1 unsaturation that has not been assigned, suggesting that the compound represented by formula I is a cyclic ester peptide compound.

[0131] Further analysis of the relevant signals of the HMBC spectrum and the ROESY spectrum determined the connection order of the amino acid units in the compound shown in Formula I. 2 The NH and α-methine protons in the unit are 1 The carbonyl group in the unit is related, indicating that Ile 2 With Hcba 1 Connected by peptide bonds; Val 3 The NH and α-methine protons in the unit are connected to Ile 2 The carbonyl-related peaks in the unit indicate that Val 3 With Ile 2 Connected by peptide bonds; MeIle 4 The N-Me proton and α-methine proton in Val 3 The carbonyl-related peaks in 4 With Val 3 Connected by peptide bonds; Sar5 N-Me proton and H2-2 in the unit and MeIle 4 The carbonyl groups in the 5 Unit and Meile 4 Connected by peptide bonds; Gly 6 NH and H2-2 in Sar 5 The carbonyl groups of the units all have related peaks, suggesting that Gly 6 With Sar 5 Units are linked by peptide bonds; MeLeu 7 The N-Me proton and α-methine proton in the unit are related to the Gly 6 The carbonyl groups in the 7 With Gly 6 Connected to by peptide bond; Pip 8 The α-methine proton in MeLeu 7 There are related signals for the carbonyl group in Pip 8 With MeLeu 7 connected by peptide bonds; finally, by Hcba 1 α-protons in the unit and Pip 8 The relevant signal of the carbonyl carbon of the unit is determined by Hcba 1 With Pip 8 The planar structure of the compound shown in Formula I was determined by connecting them through ester bonds. The cleavage fragment information in the HRESIMS / MS secondary mass spectrum of the compound shown in Formula I was analyzed to confirm the amino acid connection order in the compound shown in Formula I. Through 2D NMR spectrum data analysis, it was verified that there were three conformers (conformer A, B, C) with the same planar structure in the compound shown in Formula I, and the proton and carbon signals in each conformation were accurately assigned (Table 1).

[0132] Table 1. Compounds of Formula I 1 H NMR (CD3Cl, 600 MHz, 0°C) and 13 C NMR data (CD3Cl, 150 MHz, 0°C)

[0133]

[0134]

[0135] 3.1.2 Identification of the stereochemical structure of the compound represented by Formula I

[0136] The absolute configuration of the amino acid unit in the compound of formula I is determined by comparing with standard amino acids and Hcba standard Lu obtained by chiral synthesis using the advanced Marfey method. The compound of formula I is subjected to acid hydrolysis, and the hydrolysis products are derivatized with reagents such as L- and D-FDLA (1-fluoro-2,4-nitrophenyl-5-leucinamide), respectively. The derivatized products are analyzed by LC-MS and compared with the retention time of L / D-FDLA derivatives of standard reference substances. The retention times of L-FDLA derivatives of amino acid or hydroxy acid standards are: L-Hcba: 10.2min; L-Ile: 18.5min; L-allo-Ile: 17.9min; L-NMe-Leu: 19.8min; L-NMe-Ile: 21.3min; D-NMe-allo-Ile: 23.3min; L-Val: 15.4min; L-Pip: 17.0min. The retention times of D-FDLA derivatives of amino acid or hydroxy acid standards are: L-Hcba: 13.3min; L-Ile: 23.3min; L-allo-Ile: 23.1min; L-NMe-Leu: 22.1min; L-NMe-Ile: 23.0min; D-NMe-allo-Ile: 21.8min; L-Val: 19.9min; L-Pip: 15.4. The retention times of L-FDLA derivatives of each unit in the compound of formula I are: Hcba: 10.2min; allo-Ile: 17.9min; NMe-Leu: 19.8min; NMe-Ile: 21.4min; Val: 15.3min; L-Pip: 17.0min. Therefore, the configuration of Hcba and each amino acid unit in the compound of formula I is determined to be L-configuration, wherein the Ile and MeIle units are determined to be L-allo-Ile and L-NMe-Ile, respectively. Therefore, the structure of the compound of formula I is determined to be (L-2-hydroxy-4-cyanobutyryl-L-alloisoleucyl-L-valyl-LN-methylisoleucyl-LN-methylglycyl-L-glycyl-LN-methylleucyl-L-piperidinyl ester), and is named microascusin A.

[0137] The physical and chemical data of the compound microascusin A shown in formula I: white powder, easily soluble in methanol, DMSO, chloroform, etc. [α] 25 D -41.87(c 1.07,MeOH); UV(MeOH, HPLC)λ max 201nm; ECD(c 3.06×10 -4 M)λ max(Δε)224(-7.30)nm; IR v max :3301,2962,2936,2875,2248,1751,1647,1510,1466,1405cm -1 ; 1 H-NMR (CDCl3, 600MHz) and 13 C NMR (CDCl3, 150 MHz) data are shown in Table 1. HRESIMS: m / z 817.5188 [M+H] + (C 41 H 69 The theoretical value of N8O9 is 817.5188).

[0138] 3.2 Compound represented by formula II: Structural identification of microascusin B

[0139] 3.2.1 Identification of the planar structure and stereo configuration of the compound represented by Formula II

[0140] White powder, easily soluble in methanol, chloroform, and DMSO. HRESIMS shows a single charge [M+H] at the high mass end + The base peak of the adduct molecular ion peak is m / z 803.5030 (C 40 H 67 N8O9 calculated value 803.5031) and 1 [M+Na] + The adduct molecular ion peak m / z 825.4850 (C 40 H 66 N8O9Na calculated value 825.4890), its molecular formula is estimated to be C 40 H 66 N8O9 has one less CH2 unit than the compound shown in formula I. The compound shown in formula II is measured in CDCl3 at room temperature. 1 The H NMR spectrum is similar to that of the compound of formula I (Table 2), but only two groups of hydrogen signals (group A and group B) are shown, and the integral ratio of the protons of the two groups is about 3:1, indicating that the compound of formula II has two main conformational isomers under this condition. 1 The H NMR spectrum shows 4 exchangeable active proton signals in the low field region, which is one more active proton signal than the compound shown in Formula I; in the high field region, the compound shown in Formula II shows 2 N-CH3 proton signals, which is one less N-CH3 signal than the compound shown in Formula I. 13The C NMR spectrum signal is similar to that of the compound shown in Formula I, showing two groups of carbon signals, each with 40 carbons, and the DEPT spectrum shows that each group includes 9 quaternary carbons (8 of which are carbonyl carbons and 1 cyano carbon), 10 methines, 11 methylenes (9 of which contain nitrogen) and 10 methyl signals (2 of which are N-CH3). The above data indicate that the compound shown in Formula II is a denitromethyl derivative of the compound shown in Formula I.

[0141] The planar structure of the compound represented by Formula II was accurately determined by 2D NMR data analysis. 1 H- 1 The HCOSY and TOCSY related signals showed that the structure contained a spin coupling system of 1 Hcba unit, 2 Ile units, 1 Val unit, 1 Leu unit, 1 Pip unit and 2 Gly units. The above structural units were further confirmed by the related signals of HMBC, among which the 2 Ile spin coupling systems were attributed to 1 Ile and 1 MeIle residues, respectively, while the Leu spin coupling system was attributed to the MeLeu residue, suggesting that the Sar unit of the compound of formula I was replaced by the Gly unit in the compound of formula II. Further analysis of the related signals of NH, α-proton or N-CH3 proton and adjacent carbonyl carbon in the HMBC spectrum determined the connection order of each amino acid unit in the compound of formula II. Based on the biogenic pathway and the similar ECD spectrum Cotton effect, it is speculated that each amino acid and hydroxy acid unit in the compound shown in formula II has the same absolute configuration. Therefore, the structure of the compound shown in formula II was determined to be cyclic (L-2-hydroxy-4-cyanobutyryl-L-alloisoleucyl-L-valyl-LN-methylisoleucyl-LN-glycyl-L-glycyl-LN-methylleucyl-L-piperidinate), and was named microascusin B.

[0142] Table 2. Compounds of Formula II 1 H NMR (CD3Cl, 600 MHz) and 13 C NMR data (CD3Cl, 150 MHz)

[0143]

[0144]

[0145] The physical and chemical data of the compound microascusin B shown in formula II: white powder, easily soluble in methanol, chloroform and DMSO. [α] 25 D -37.59(c 0.21,MeOH); UV(MeOH,HPLC)λ max200nm; ECD(c 3.11×10 - 4 M)λ max (Δε)232(-6.46)nm; IR v max :3295,2962,2936,2875,2248,1751,1647,1511,1466,1405cm -1 ; 1 H-NMR (CDCl3, 600MHz) and 13 C NMR (CDCl3, 150 MHz) data are shown in Table 2. HRESIMS: m / z 803.5030 [M+H] + (C 40 H 67 The theoretical value of N8O9 is 803.5031).

[0146] Example 3. Anti-inflammatory activity test of microcystin A and microcystin B

[0147] The following human umbilical vein endothelial cells (HUVECs, purchased from PromoCell, Germany) and human acute monocytic leukemia cells (THP-1, purchased from the Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences) are available to the public from the applicant. The biomaterials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0148] The compound of formula I was accurately weighed, dissolved in DMSO, and prepared into a stock solution with a concentration of 20 mM for activity testing.

[0149] HUVECs cells were seeded in 6-well plates, and when the confluence of the cells reached 90%, different concentrations of the compound of formula I (0.1, 1, 10, 100 nM) diluted with culture medium were added for 18 hours, and the negative control group and TNFα model group were added with corresponding concentrations of DMSO; then the TNFα model group and the compound administration group were added with TNFα at a final concentration of 10 ng / mL for 6 hours. Subsequently, proteins were extracted for Western blot experiments or monocyte adhesion experiments.

[0150] Monocyte adhesion assay: 0.5 mL THP-1 (density 5×10 6 The cells were cultured for 30 min and then gently rinsed with serum-free medium for 3 times to remove THP-1 that was not attached to HUVECs cells. The cells were observed under a microscope and representative fields were selected for photographing.

[0151] Experimental results: The results of monocyte (THP-1) adhesion showed ( Figure 7A), compared with the negative control group (without TNFα), TNFα can significantly increase the number of monocytes adhered to HUVECs, indicating that TNFα can induce increased endothelial cell inflammation; compared with the TNFα group, the compound represented by Formula I can reduce the adhesion of monocytes at 0.1, 1, 10, and 100 nM, and there are significant differences at the concentrations of 0.1, 10, and 100 nM, indicating that it has an anti-inflammatory effect.

[0152] Western Blot Results( Figure 7 B) shows that compared with the negative control group (without TNFα), TNFα can significantly increase the expression of cell adhesion molecules VCAM-1 and ICAM-1 in HUVECs cells, and TNFα can also significantly increase the expression of proinflammatory cytokine IL-1β; the compound shown in Formula I can reduce the expression of cell adhesion molecule ICAM-1 and proinflammatory cytokine IL-1β at 10nM and 100nM. The above results show that the compound shown in Formula I has significant anti-inflammatory activity and can be used to treat inflammation-related diseases.

[0153] Example 4: Effects of microcystin A and microcystin B on promoting bone formation

[0154] 1. Alkaline phosphatase (ALP) staining experimental method

[0155] The mouse osteoblast precursor cells MC3T3-E1 described below are preserved by this laboratory. The public can obtain the biological material from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0156] The compounds of formula I and II were accurately weighed, dissolved in DMSO, and prepared into a mother solution with a concentration of 20 mM for activity testing.

[0157] MC3T3-E1 cells were plated in 12-well plates at an appropriate cell density. After adherence, the culture medium was discarded and replaced with osteogenic induction medium containing different concentrations of compounds or blank controls for 7 days of induction; the culture medium was replaced every 1-2 days (depending on the cell state). After the induction, the supernatant of the culture medium was discarded, rinsed twice with 1mL / well PBS, and the residual liquid was aspirated. 0.5-1mL / well of 4% paraformaldehyde (PFA) was added and fixed at room temperature for 15-20min. During the fixation period, the staining solution was prepared, and the Biyuntian BCIP / NBT alkaline phosphatase colorimetric kit was used; the principle is: BCIP / NBT is a common substrate for alkaline phosphatase. Under the catalysis of alkaline phosphatase, BCIP will be hydrolyzed to produce a highly reactive product, which will react with NBT to form an insoluble dark blue to blue-purple NBT-formazan.

[0158] Alkaline phosphatase staining ( Figure 8A) The results showed that the compounds of Formula I and Formula II were able to significantly increase the differentiation of osteoblasts at concentrations of 0.1, 1, 10 nM and 0.1, 1, 10 μM, respectively, for 7 days.

[0159] 2. Experimental method of calcified nodules Alizarin red (ARS) staining

[0160] MC3T3-E1 cells were seeded in a 12-well plate. After the cell confluence reached 80% under the microscope, the original ordinary cell culture medium was discarded and replaced with differentiation induction medium containing different concentrations of compounds. The induction medium was continued for 21 days, and the culture medium was replaced every 1-2 days (depending on the cell state). After the induction culture, the culture medium was discarded, rinsed twice with 1mL / well PBS, and the liquid was discarded. Add 70% ethanol to fix, 1mL / well, and fix at room temperature for 1h. Discard the fixative, rinse the sample with double distilled water, 1mL / well; rinse 2-3 times, and discard the liquid. Add the staining solution preheated at 37℃ in advance, Alizarin Red S staining solution (1%, pH 4.2). Place at 37℃ for staining for 15-20min, discard the staining solution after staining, and rinse the cells with distilled water. Take pictures.

[0161] Quantification: Prepare 100mM cetylpyridinium chloride solution with double distilled water, add 500μL cetylpyridinium chloride solution to each well, and incubate at room temperature for 1h. Detection: Take a 96-well transparent plate, aspirate 200μL / well of supernatant, and detect the absorbance value at 562nm; and adjust the absorbance value detected by the pure supernatant without adding Alizarin Red to zero, repeat each sample three times, and calculate the average value.

[0162] The results show that Figure 8 B, C, D), after treatment with compounds of formula I and II at 0.1, 1, 10 nM and 1, 10 μM concentrations for 21 days, the ARS staining area increased significantly. The above results show that microcystin A and microcystin B have good effects in promoting bone formation and resisting osteoporosis.

[0163] Example 5. Inhibitory effects of microcystin A and microcystin B on osteoclast formation

[0164] 1. Experimental method for inhibiting osteoclast differentiation

[0165] The following mouse mononuclear macrophages (RAW264.7, purchased from Guangzhou Geneo Biotechnology Co., Ltd.) are available to the public from the applicant. The biomaterial is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0166] The compounds of formula I and II were accurately weighed, dissolved in DMSO, and prepared into a mother solution with a concentration of 20 mM for activity testing.

[0167] Mouse macrophage RAW264.7 cells were cultured at 2 × 10 2 The cells were inoculated in 96-well plates, and after the cells adhered to the wall, the osteoclast differentiation induction medium was replaced. The cells were induced for 6 days at 37°C and 5% CO2, and the medium was changed every 2 days. After the induction, the culture medium was discarded, and the fixative (25.5% citrate solution + 66.3% acetone + 8.2% 37% formaldehyde solution, 100μL / well) was added to fix for 30s, washed with distilled water, and the prepared mixed solution (naphthol AS-BI phosphate and tartrate solution, 200μL / well) was added to incubate at 37°C in the dark for 1h. After washing with distilled water, hematoxylin was used for 2min, and tap water was used to rinse for a few minutes; after drying naturally, it was placed under a microscope (Leica, DMIL) for observation. TRAP-positive cells with ≥3 nuclei were selected as osteoclasts and counted. I and II (0.1nM, 1.0nM, 10.0nM / 0.1μM, 1.0μM, 10.0μM) acted on RAW264.7 cells induced by 100ng / mL RANKL for 3d, and then the formation of osteoclasts was detected by Trap staining.

[0168] The results show that ( Fig. 9 ), the compound of formula I and the compound of formula II can inhibit RANKL-induced osteoclast differentiation at concentrations of 0.1 nM and 0.1 μM, respectively. The compound of formula I and the compound of formula II can significantly reduce the protein expression of NFATc1 and MMP-9, osteoclastogenesis markers, in RAW264.7 cells. The above results show that microcystin A and microcystin B have good inhibitory effects on osteoclast formation and anti-osteoporosis.

[0169] Example 6. Inhibitory effects of microcystin A and microcystin B on bone resorption

[0170] RAW264.7 cells were inoculated into 24-well plates. The next day, 100 ng / mL RANKL osteoclast induction medium was added and cultured for 3 days (except the control wells). Then different concentrations of compounds I and II (0.1 nM, 1.0 nM, 10.0 nM / 0.1 μM, 1.0 μM, 10.0 μM) were added for a total of 3 days of induction, and the medium was changed every 1 day. After the induction, the medium was discarded and rinsed twice with 0.5 mL / well PBS and discarded. 0.3 mL / well 4% paraformaldehyde (PFA) was added for fixation for 10 min and rinsed 3 times with PBS. 0.5% TritonX-100 was permeabilized for 10 min and rinsed 3 times with PBS. Then blocked with 1% BSA for 30 min. Rhodamine-labeled phalloidin staining solution (diluted according to the instructions) was added and stained in the dark for 30 min. After adding DAPI to stain the nucleus, the cells were washed with PBS for 10 min / time and washed 3 times. The slides were sealed with sealing medium and observed under a microscope (Leica, DMIL, Germany) or stored at 4°C in the dark.

[0171] The F-actin ring is a characteristic skeleton of mature osteoclasts. Fig.10 As shown, the compound of formula I and the compound of formula II significantly inhibited the formation of F-actin ring at concentrations of 10 nM and 10 μM, respectively, thereby inhibiting osteoclast formation. The above results show that microcystin A and microcystin B have good effects in inhibiting bone resorption and preventing osteoporosis.

[0172] Example 7: Experimental method for determining the anti-osteoporosis activity of compounds using zebrafish model animals

[0173] The zebrafish model organism is an important tool that has been widely used in high-throughput drug screening in recent years. The zebrafish osteoporosis model, which uses glucocorticoids to induce reduced bone mineralization in zebrafish larvae, has the advantages of low compound dosage, simplicity, and high efficiency, and can be effectively used for anti-osteoporosis activity evaluation. Alizarin red forms a chelate with calcium ions and can stain mineralized bone matrix. The cumulative optical density value of alizarin red staining is used as an indicator to quantify the amount of zebrafish bone mineralization.

[0174] The following AB zebrafish model animal (Hu Z, Chen B, Zhao Q. Biol Open, 2019, 8(5): bio040840) is available to the public from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes. The reagents used in the experiment are dexamethasone (100129-201105) and alizarin red (sigma, A5533). The instrument used is a stereo microscope (OLYMPUS, MVX10).

[0175] The compound of formula I was accurately weighed, dissolved in DMSO, and prepared into a stock solution with a concentration of 20 mM for activity testing.

[0176] First, the zebrafish model animals were grouped as follows: Control (normal control group); dexamethasone group (osteoporosis model); the samples to be tested were grouped according to 0.1, 0.5, 1, 10, and 20 μM; 10 zebrafish in each group. All test solutions contained 0.1% DMSO. Zebrafish embryos were exposed to dexamethasone (100 mg / L, 6-72 hpf), the solution was changed, and the test compound was given and incubated until 6 dpf, fixed with 4% paraformaldehyde, stained with alizarin red, and the lateral and dorsal sides of the zebrafish head were photographed under a stereo microscope. Image proplus6.0 software was used to analyze the cumulative optical density (IOD) of the staining. The results were expressed as mean ± standard error (Mean ± SD), and one way ANOVA was used for comparison between groups, and Dunnett's t test was used for comparison between the two groups. P < 0.05 was considered statistically significant.

[0177] The experimental results show that ( Fig.11 ), the compound shown in Formula I at concentrations of 10 and 20 μM can improve the bone mineralization impairment caused by dexamethasone in zebrafish model animals to varying degrees, reduce bone loss, increase bone density, promote bone formation, and has the effect of treating osteoporosis.

[0178] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. The cyclic ester peptide compound represented by formula III or its pharmaceutically acceptable salt, ester, solvate: In the formula III, R1, R2, R3, and R4 are independently selected from any of the following groups: hydrogen, C1-C6 alkyl, and hydroxyl; R5 is selected from any of the following groups: C1-C6 alkyl, cyano, cyano-substituted C1-C6 alkyl, amino, amino-substituted C1-C6 alkyl, hydroxyl, and halogen; R6, R7, R8, and R9 are independently selected from any of the following groups: hydrogen, C1-C6 alkyl, C1-C6 unsaturated hydrocarbon group, and C6-C9 aryl group.

2. The cyclic ester peptide compound or a pharmaceutically acceptable salt, ester or solvate thereof according to claim 1, characterized in that: In the formula III, the C1-C6 alkyl group described in R1, R2, R3, and R4 is a methyl group; the C1-C6 alkyl group substituted by a cyano group described in R5 is a cyanomethyl group or a cyanoethyl group, and the C1-C6 alkyl group substituted by an amino group described in R5 is an aminomethyl group or an aminoethyl group; the C1-C6 alkyl group described in R6, R7, R8, and R9 is a methyl group, an ethyl group, a n-propyl group, an isopropyl group, a n-butyl group, an isobutyl group, a n-pentyl group, an isopentyl group, a n-hexyl group, or an isohexyl group.

3. The cyclic ester peptide compound or a pharmaceutically acceptable salt, ester or solvate thereof according to claim 1 or 2, characterized in that: The cyclic ester peptide compound is microcystin A or microcystin B; The structural formula of the microcystin A is shown in Formula I, and the structural formula of the microcystin B is shown in Formula II:

4. The method for preparing microcystin A or microcystin B as claimed in claim 3, comprising the following steps: culturing Microcystis citrinum in a culture medium and collecting a fermentation product; isolating microcystin A and / or microcystin B from the fermentation product; The Microascus croci is Microascus croci, the strain number of which is IMB19-064, and the registration number of which in the General Microbiological Center of China National Microbiological Culture Collection is CGMCC No.40883.

5. Use of the cyclic ester peptide compound or a pharmaceutically acceptable salt, ester or solvate thereof according to any one of claims 1 to 3 in at least one of the following aspects: a) Use in the preparation of products for preventing and / or treating inflammation; b) Use in the preparation of products for preventing and / or treating osteoporosis; c) Use in the preparation of products for preventing and / or treating diseases related to bone metabolism.

6. A product comprising the cyclic ester peptide compound or a pharmaceutically acceptable salt, ester or solvate thereof according to any one of claims 1 to 3; The product has at least one of the following effects: 1) preventing and / or treating inflammation; 2) preventing and / or treating osteoporosis; 3) preventing and / or treating diseases related to bone metabolism.

7. The product according to claim 6, characterized in that: The inflammation is selected from at least one of the following: osteoporosis and osteoarthritis associated with inflammation, atherosclerosis and cardiovascular disease associated with endothelial cell inflammation; And / or, the osteoporosis is selected from at least one of the following: 1) primary osteoporosis, including postmenopausal osteoporosis (type I), senile osteoporosis (type II), idiopathic osteoporosis (juvenile type), 2) secondary osteoporosis, i.e. osteoporosis caused by diseases or drugs that affect bone metabolism; And / or, the bone metabolism-related diseases include osteoarthritis, osteoporosis and abnormal bone metabolism diseases caused by other reasons.

8. The product according to claim 6 or 7, characterized in that: The product has at least one of the following effects: promoting bone formation, inhibiting osteoclast formation, inhibiting bone resorption, and anti-osteoporosis; And / or, the product is a medicine, a composition, a health product or other biological product.

9. Microcystis citrinum, characterized in that: The Microascus croci is Microascus croci, the strain number of which is IMB19-064, and the registration number of which in the General Microbiological Center of China National Microbiological Culture Collection is CGMCC No. 40883.

10. A bacterial agent comprising the Microsaccharum citrinum according to claim 9 and / or a metabolite of the Microsaccharum citrinum.

Images