Bacillus and complex microbial inoculant and application thereof
By using the complex bacteria agents of Bacillus A1815 and Pseudomonas A7, the growth of watermelon blight bacteria is inhibited and the growth of watermelon seedlings is promoted, and the pesticide residue and resistance problems existing in traditional control methods are solved, achieving the effect of biological control.
Patent Information
- Application Number
- CN202411689622.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-02-07
AI Technical Summary
Watermelon blight is caused by Fusarium oxysporus. Traditional crop rotation and chemical pesticide prevention and control methods have problems such as pesticide residues, drug resistance and ecological environment pollution. Biologic control methods need to be explored.
Bacillus sp. A1815 and its complex bacterial agent, combined with the bacterial solution of Pseudomonas sp. A7, inhibit the growth of watermelon blight through confrontation culture, and promote the growth of watermelon seedlings through root application. .
Effectively inhibit the growth of watermelon blight bacteria, significantly improve the disease resistance of watermelon, promote the growth of melon seedlings, and reduce dependence on chemical pesticides.
Smart Images
Figure CN119391592A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to microorganisms and application fields thereof, and in particular to a bacillus and a composite bacterial agent and application thereof. Background Art
[0002] Plant diseases are one of the main factors limiting the world's food production. The annual food loss caused by plant diseases can reach 25% of the world's food production. Among them, 70% to 80% of plant diseases are caused by plant pathogenic fungi. At present, the application of chemical pesticides is the main way to prevent and control plant fungal diseases. However, the long-term irrational use of chemical pesticides has caused a series of problems such as pesticide residues, pathogenic bacteria resistance, and ecological balance destruction, which has a great impact on food safety and the ecological environment, and has also seriously restricted the development of the agricultural industry.
[0003] Biological control of plant diseases mainly uses living microorganisms or their metabolites to inhibit the growth of pathogens. Biological control is safe for humans and animals, does not pollute the environment, has no adverse effects on plants and other natural enemies, and does not interfere with other prevention and control measures. It is an important part of the integrated prevention and control of diseases and insect pests in the future.
[0004] Biological control of plant diseases mainly refers to the technology of using beneficial microorganisms or their metabolites to inhibit pathogens and thus prevent and control diseases. Its essence is to use the direct or indirect competition, antibiotics and lytic effects of microorganisms, or to antagonize pathogens through metabolites produced by microorganisms, so as to achieve the effect of inhibiting pathogens. Biological control technology has the advantages of not easily producing resistance, not polluting the environment, being safe for humans and other organisms, and easy access to biological control materials. It plays an important role in the integrated prevention and control of pests. With the reduction of chemical pesticides, biological control will gradually replace traditional chemical control methods and has a broad application prospect.
[0005] Among plant diseases, watermelon wilt is an important disease caused by Fusarium oxysporum f.sp.niveum, which causes continuous cropping problems in watermelon. It is particularly harmful in watermelon facility cultivation. For a long time, the prevention and control of watermelon wilt has mainly relied on crop rotation and chemical agents. However, as the watermelon cultivation area gradually expands, the space available for crop rotation is becoming less and less, and the excessive use of chemical agents has seriously polluted agricultural products and the ecological environment, endangering the health of humans and animals. Therefore, in recent years, biological control has become an increasingly important way to prevent and control watermelon wilt.
[0006] Composite microorganisms are communities composed of two or more microorganisms. Composite microbial agents have more advantages than single microbial agents, can adapt to complex environments, and have stronger and more comprehensive effects. Using strains isolated from healthy melon seedlings to construct an ecologically stable bacterial community that has a control effect on Fusarium wilt, the pathogen of watermelon, can effectively improve the disease resistance of watermelon. While controlling Fusarium oxysporum, the bacterial community can also promote the growth of watermelon seedlings, thereby achieving the effect of reducing weight and medication.
[0007] Therefore, it is urgent to explore composite microorganisms for the prevention and control of watermelon wilt disease. Summary of the invention
[0008] In view of this, the present invention provides a bacillus and a composite bacterial agent and application thereof. The bacillus is Bacillus sp. A1815, which can effectively inhibit the growth of watermelon wilt pathogen.
[0009] The specific scheme of the present invention is as follows:
[0010] In one aspect, the present invention provides a bacillus, which is Bacillus sp. A1815, with a deposit number of CCTCC NO: M 20232061. It has been deposited in the China Center for Type Culture Collection on October 30, 2023, and is classified and named Bacillus sp.
[0011] The present invention also provides the use of the bacillus in preparing a biological agent for preventing and treating watermelon wilt disease. The pathogen of watermelon wilt disease is watermelon wilt pathogen (Fusarium oxysporum f.sp.niveum).
[0012] The invention also provides application of the bacillus in promoting the growth of watermelon.
[0013] After Bacillus A1815 and Fusarium wilt pathogen were cultured on the plate for 7 days, the single bacterium had a certain inhibitory effect.
[0014] On the other hand, the present invention also provides a composite bacterial preparation containing the Bacillus, wherein the composite bacterial preparation is a composite of Bacillus sp. A1815 or its bacterial solution and Pseudomonas sp. A7 or its bacterial solution.
[0015] The Pseudomonas sp. A7 has been deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 2020914.
[0016] The present invention also provides a method for preparing the composite bacterial preparation, wherein Bacillus sp. A1815 and Pseudomonas sp. A7 are inoculated into a culture medium for cultivation, bacterial liquids are obtained, and the composite bacterial preparation is obtained after mixing. In the embodiment of the present invention, the bacterial liquids of Pseudomonas A7 and Bacillus A1815 are mixed at a volume ratio of 10:1 to 1:10.
[0017] Preferably, the culture temperature is 30°C, and the shaking culture is performed at 180 rpm for 24-48 hours.
[0018] In another aspect, the present invention provides the use of the composite bacterial preparation in the preparation of a biological preparation for preventing and treating watermelon wilt disease.
[0019] The pathogen of watermelon wilt disease is watermelon wilt pathogen (Fusarium oxysporum f.sp.niveum).
[0020] The method for using the biological agent is: using the biological agent to irrigate the roots of plants.
[0021] After the mixed solution of Bacillus A1815 and A7 was cultured against watermelon wilt pathogen on the plate for 7 days, the growth of wilt pathogen close to the mixed solution A1815 and A7 was significantly inhibited. In addition, the treatment with biocontrol solution can not only inhibit bacteria, but also effectively promote the growth of melon seedlings. The wet weight / dry weight of melon seedling stems and leaves was significantly higher than that of water control and pathogen treatment control (P<0.01).
[0022] Beneficial effects of the present invention:
[0023] The bacillus and its bacterial liquid of the present invention or the bacillus and its bacterial liquid combined with pseudomonas and its bacterial liquid are applied in watermelon planting, which can effectively inhibit the development of symptoms of watermelon infected by Fusarium and achieve a relatively ideal prevention and control effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 is the in vitro antibacterial effect of biocontrol bacteria on Fusarium wilt; wherein A is the inhibitory effect of Bacillus A1815 and Pseudomonas A7 single bacteria or equal volume mixture on watermelon Fusarium wilt; B is the antibacterial effect of Pseudomonas A7 and Bacillus A1815 in the volume ratio range of 10:1 to 1:10, wherein K1-K11 represent the volume ratio of Pseudomonas A7 to Bacillus A1815 of 10:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:10, respectively, and FCK is the control without biocontrol bacteria;
[0025] Figure 2The potted plant control effect of the biocontrol bacteria solution on watermelon wilt;
[0026] Figure 3 This is a diagram of the transparent zone after the biocontrol bacterium Bacillus A1815 was cultured in nitrogen-fixing medium, inorganic phosphorus solid medium and organic phosphorus solid medium plates;
[0027] Figure 4 It is the growth-promoting effect of biocontrol compound bacteria and their bacterial solution on plants, where FON is the pathogenic bacteria treatment and CK is the clean water treatment;
[0028] Figure 5 To investigate the effects of biocontrol compound bacteria and their bacterial solutions on the rhizosphere microbiome of plants. DETAILED DESCRIPTION
[0029] The Pseudomonas A7 used in the present invention has been deposited in the China Center for Type Culture Collection on December 18, 2020, with a preservation number of CCTCC NO: M 2020914, and is classified as Pseudomonas sp. For details, please refer to the patent application with application number 2023105877235.
[0030] The pathogen is watermelon wilt fungus Fusarium oxysporum f.sp.Niveum, which was isolated from the roots of watermelon wilt diseased plants in the field and underwent etiological identification and pathogenicity testing.
[0031] The bacterial solution of Bacillus or Pseudomonas can be obtained by the following steps:
[0032] A single colony of Bacillus or Pseudomonas was pre-cultured in LB medium for 12 hours to prepare a seed solution, and the seed solution was inoculated into LB liquid medium at an inoculum of 1%, and cultured at 30° C. and 180 rpm for 48-72 hours to obtain a bacterial solution.
[0033] Example 1 Isolation and Identification of Biocontrol Strains
[0034] The soil used to isolate the biocontrol strain A1815 was from a watermelon field in a farm in Fengxian District, Shanghai. 10 g of soil sample was placed in 100 ml of double distilled water and cultured at 30°C and 180 rpm for 1 hour. The suspension was diluted with distilled water in a gradient manner, and 50-100 μl of each gradient was spread on an LB plate and cultured at 30°C for 24-48 hours.
[0035] A single colony grown on the plate was picked and transferred to an LB medium (1.0 wt% yeast extract, 0.5 wt% peptone, 1.0 wt% sodium chloride, 2.0 wt% agar powder, distilled water as solvent, pH 7.2-7.5) plate, and purified using the four-zone streak method.
[0036] The purified single colony was picked and inoculated into LB liquid medium, cultured at 30°C and 180rpm for 24h, and the bacterial solution of strain A1815 was taken as a template, and PCR amplification was performed using the universal primers of bacterial 16S rDNA gene sequence (27F: GAAGAGTTTGATCCTGGCTCAG and 1492RCTACGCTACCTTGTTACGA) to obtain a 1454bp 16SrDNA gene sequence (shown in SEQ ID No. 1). Blast was performed in the EzTaxon database (www.ezbiocloud.net), and the results showed that strain A1815 had the closest homology to Bacillus sp. Combined with morphological and physiological and biochemical characteristics (Table 1), strain A1815 was preliminarily identified as Bacillus sp. bacteria. The strain was sent to the China Center for Type Culture Collection (CCTCC) in Wuhan, China for preservation on October 30, 2023. The preservation number of A1815 is CCTCC NO: M 20232061.
[0037] Table 1 Physicochemical properties of strains
[0038]
[0039]
[0040] Example 2 Screening of biocontrol strains
[0041] A1815 and A7 strains were subjected to plate confrontation test on LB medium. The plant pathogens used included Bacillus or bacterial liquid to test the inhibitory effect on watermelon wilt pathogen.
[0042] Reconstituted bacterial solution: Pick the purified single colonies of A1815 and A7 and inoculate them into LB liquid medium, and culture them at 30℃ and 180rpm for 12h to prepare seed solution. Inoculate the seed solution into fresh LB medium at 1% inoculum, and culture at 30℃ and 180rpm until OD 600 = about 1.0, and a bacterial solution was obtained. The two bacterial solutions were mixed in equal volumes and set aside. In addition, the antibacterial effects of bacterial solutions of Bacillus A1815 and Pseudomonas A7 in the range of 1:10 to 10:1 (v:v) were similarly identified.
[0043] 1. Preliminary screening using the flat plate confrontation method
[0044] After activating the watermelon wilt pathogen on PDA solid culture medium (potato flour 20.0wt%, glucose 2.0wt%, solvent is distilled water), use a 5mm puncher to punch a bacterial cake along the edge of the hyphae for later use. Take one of the bacterial cakes, with the hyphae side facing down, and inoculate it in the center of a new PDA culture medium. Strikingly inoculate the purified Bacillus strain at an equal distance (2cm) from the indicator bacteria, inoculate three plates as replicates, and use a plate without Bacillus but only with watermelon wilt pathogen as a control. Carry out confrontation culture at 25℃, observe and measure the growth diameter of the hyphae of watermelon wilt pathogen on the 7th day, and the antibacterial situation is shown in the table below. Figure 1 A; The antibacterial effect of bacterial solution in the range of 1:10 to 10:1 (v:v) is shown in Figure 1 B.
[0045] from Figure 1 A It can be seen that after 7 days of confrontation culture of Bacillus A1815 and A7 single bacteria or mixed liquid with watermelon wilt pathogen on the plate, the single bacteria had a certain inhibitory effect, but the growth of Fusarium wilt pathogen near the composite bacterial liquid A1815 and A7 showed obvious inhibition. When the volume ratio of the composite bacterial liquid A1815 and A7 was in the range of 1:10 to 10:1, the growth of Fusarium wilt pathogen near the composite bacterial liquid A1815 and A7 showed obvious inhibition.
[0046] 2. Antibacterial re-screening of biocontrol liquid
[0047] The biocontrol bacteria suspension was centrifuged at 8000rpm for 10min, concentrated by rotary evaporation, and extracted with n-butanol after concentration. The supernatant was filtered through a 0.22μm filter membrane to obtain a filtrate extract without bacteria. The antibacterial effect was identified on PDA solid culture medium using the Oxford cup method (80μL of the concentrated filtrate was aspirated and added to the well). According to the above-mentioned plate initial screening method, a 5mm fresh bacterial cake of watermelon wilt pathogen was obtained and inoculated into the center of the cooled and solidified antibacterial plate. Three plates were inoculated as replicates, and a plate without biocontrol bacteria but only with wilt pathogens was used as a control. The confrontation culture was carried out at 26℃, and the growth diameter of the watermelon wilt pathogen antagonized by A1815 or A7 or the control group was measured on the 7th day. The antibacterial situation is shown in the figure. Figure 1 A.
[0048] Example 3 Identification of the antibacterial effect and plant growth promotion of biocontrol strains
[0049] The biocontrol strains A1815 and Pseudomonas A7 are used to control Fusarium wilt in potted watermelon. The specific steps include:
[0050] Step 1) A freshly cultured bacterial solution of A1815 and A7 in Example 1 was mixed in an equal volume ratio.
[0051] Step 2) The watermelon wilt pathogen isolated and identified independently in the melon field was grown in a fungus incubator at 26° C. for 5-7 days, and a 5 mm fresh fungus cake was taken and inoculated into a PDB liquid medium (potato flour 20.0 wt %, glucose 2.0 wt %, and distilled water as solvent), and cultured at 26° C. and 150 rpm for about 10 days to prepare a spore suspension, adjusting the spore concentration to 100 spores / mL, and using sterile distilled water as a control.
[0052] Step 3) Take the healthy Zaojiashahai Pearl melon seeds commercially available for germination and sowing of watermelon seedlings (two leaves and one heart stage), and inoculate watermelon wilt bacteria during transplanting, with sterile water as the control. On the day of transplanting, 20mL of biocontrol bacteria solution was used to irrigate the roots and place them in a light incubator (28℃ / 13h light, 20℃ / 11h dark, 50-70% humidity), with 3 replicates per group. After 5 and 10 days of incubation, the roots were irrigated with the biocontrol compound bacteria solution, and the disease was observed every 2-3 days after the root irrigation treatment. For details, see Figure 2 (Growth effect in about 40 days).
[0053] Step 4) Take the freshly cultured bacterial solution A1815 from Example 1 and adjust the OD 600 = 1.0, take 10 μL of bacterial solution and inoculate it into the center of the cooled and solidified nitrogen-fixed, organic phosphorus or inorganic phosphorus medium plate, three replicates per plate, and three plates per treatment. Cultivate at 30°C, observe whether a transparent circle appears on the 5th day, and measure the diameter of the transparent circle.
[0054] from Figure 2 It can be seen that the melon seedlings in the sterile water control group gradually showed wilt symptoms, and the growth condition of the biocontrol bacteria treatment group was significantly better than that of the control group, indicating that the mixed bacterial solution of biocontrol bacteria Bacillus A1815 and Pseudomonas A7 can inhibit the development of watermelon wilt disease.
[0055] from Figure 3 It can be seen that the biocontrol bacteria Bacillus A1815 has transparent circles on nitrogen-fixing medium, inorganic phosphorus solid medium and organic phosphorus solid medium plates.
[0056] In addition, the plant height, root length, dry weight, wet weight, etc. of watermelon plants under different treatment conditions were tested to identify the growth-promoting ability of the biocontrol liquid on the plants. Figure 4 It can be seen that the treatment with biocontrol liquid can not only inhibit bacteria, but also effectively promote the growth of melon seedlings. The fresh weight of stems and leaves of melon seedlings was significantly higher than that of the water control and the pathogen treatment control (P<0.01); the effect on plant height and root length was not significantly different from that of the distilled water control, but was significantly better than that of the pathogen treatment control.
[0057] The rhizosphere soil of the diseased and control samples was collected, and metagenomic high-throughput sequencing was used to identify the effects of exogenous microorganisms on the rhizosphere microorganisms of the plants. Figure 5It can be seen that the abundance of rhizosphere microorganisms in the plant treatment group with exogenous addition of Pseudomonas and Bacillus, i.e., biocontrol bacteria, was significantly higher than that in the blank control and pathogenic bacteria treatment groups.
Claims
1. A Bacillus, characterized in that It is Bacillus sp. A1815, and its deposit number is CCTCCNO: M 20232061.
2. Use of the bacillus as claimed in claim 1 in preparing a biological agent for preventing and treating watermelon wilt.
3. The use according to claim 2, characterized in that The pathogen of watermelon wilt disease is watermelon wilt pathogen (Fusarium oxysporum f.sp.niveum).
4. Use of bacillus as claimed in claim 1 in promoting the growth of watermelon.
5. A composite bacterial preparation containing the Bacillus according to claim 1, characterized in that: The composite bacterial preparation is composed of Bacillus sp. A1815 or its bacterial solution and Pseudomonas sp. A7 or its bacterial solution. The Pseudomonas sp. A7 has been deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 2020914.
6. The method for preparing the composite bacterial preparation according to claim 5, characterized in that: Bacillus sp. A1815 and Pseudomonas sp. A7 are inoculated into culture medium for cultivation to obtain bacterial liquids, which are mixed to obtain the composite bacterial preparation.
7. The method for preparing the composite bacterial preparation according to claim 6, characterized in that: The culture temperature was 30°C and the shaking culture was 180 rpm for 24-48 hours.
8. Use of the composite bacterial preparation as claimed in claim 5 in the preparation of biological preparations for preventing and treating watermelon wilt.
9. The use according to claim 8, characterized in that The pathogen of watermelon wilt disease is watermelon wilt pathogen (Fusarium oxysporum f.sp.niveum).
10. The use according to claim 8, characterized in that The method for using the biological agent is: using the biological agent to irrigate the roots of plants.