Method for establishing somatic cell sex reversal model

Abstract

The invention discloses a method for establishing a somatic cell sex reversal model, which comprises the following steps: S1, separating male and female gonad somatic cells, and carrying out sex identification and culture; s2, determining marker genes: screening E18.5 d male and female middle-high expression differential genes, designing an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer, and detecting in separated gonad somatic cells; and S3, constructing a reverse model: taking sex hormone as an inducer, determining effective sex hormone induction concentration of the reverse model, and determining to construct the reverse model by utilizing marker gene quantification and flow detection. The method not only has important significance in theoretical research, but also has wide application prospects and social and economic benefits, and has a positive promotion effect on promoting scientific and technological progress and industrial development in related fields.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for establishing a somatic cell sex reversal model. Background Art

[0002] In the field of biology, sex determination is a complex and delicate process involving the interaction of multiple genes, hormones and environmental factors. With the rapid development of molecular biology technology, scientists have a deeper understanding of the mechanism of sex determination. However, the regulatory mechanism of bird cell autonomous sex identity (CASI) and sexual development has yet to be fully understood and studied.

[0003] The sex determination of chickens has always been a technical problem that has plagued the poultry farming industry. Egg-laying farms need female chicks, while broiler farms need more male chicks, which means that some chicks will be eliminated at an early stage, which will cause potential waste of biological resources. It is also a considerable loss for the farming industry itself and the entire ecosystem. On the other hand, this behavior also touches on sensitive areas of ethics and morality, triggering extensive discussions on deep-seated issues such as animal welfare, respect for life, and sustainable use of resources.

[0004] In the sex determination of poultry such as chickens, the development and differentiation of gonads are key links. Female gonads (ovaries) and male gonads (testes) show obvious differences in gene expression during development, and these differences are mainly regulated by specific sex-determining genes. For example, genes such as CYP19A1, FOXL2, and WNT4 are highly expressed in female gonads, while genes such as DMRT1, SOX9, and AMH are highly expressed in male gonads. The expression patterns of these genes not only reflect the sex characteristics of the gonads, but also directly participate in the development and differentiation of the gonads. However, traditional sex determination methods often rely on genetic selection or physical methods (such as eliminating non-target sex after sex identification), which have the disadvantages of low efficiency, high cost, and great impact on animal welfare. Therefore, exploring a more efficient and accurate sex regulation method has become an important research direction in the poultry farming industry and biomedical fields.

[0005] In recent years, with the in-depth study of sex hormones and their receptors, scientists have discovered that sex hormones play an important role in sex determination and gonadal development. By adding exogenous sex hormones or their analogs, sex reversal of gonadal cells can be induced, thereby achieving precise control of the sex ratio. This method has the advantages of simple operation, significant effect, and low cost, so it has broad application prospects in poultry farming and biomedical fields.

[0006] However, most of the current research on sex hormone-induced sex reversal remains at the overall level, lacking in-depth research on the sex reversal mechanism of gonadal cells. Therefore, constructing a cell model that can simulate the sex hormone-induced sex reversal process is of great significance for revealing the mechanism of sex determination and screening and developing sex-regulating drugs. Summary of the invention

[0007] Technical problems to be solved: In response to the above technical problems, the present invention provides a method for establishing a somatic cell sex reversal model, which aims to separate and identify male and female gonadal cells, use sex hormones to construct a sex reversal model, and verify the success of the model construction through molecular biological technology detection. The establishment of this model will provide a new experimental platform and tools for the study of sex determination mechanisms, and also provide new ideas and methods for sex regulation in the poultry farming industry and biomedical fields.

[0008] Technical solution: A method for establishing a somatic cell sex reversal model, comprising the following steps:

[0009] S1. Isolate male and female glandular cells, and perform sex identification and culture;

[0010] S2. Determine marker genes: Screen the genes with high expression difference between males and females at E18.5 d, design RT-PCR primers, and detect them in isolated gonadal somatic cells;

[0011] S3. Construct a reversal model: Use sex hormones as inducers to determine the effective sex hormone induction concentration for the reversal model, and use marker gene quantification and flow cytometry to determine the construction of the reversal model.

[0012] Preferably, the marker genes in step S2 are FOXL2, SOX9, AMH, DMRT1, CYP19A1 and WNT4.

[0013] Furthermore, the nucleotide sequences of the RT-PCR primers of the marker gene in step S2 are shown in SEQ ID NO.3-14.

[0014] Preferably, the sex hormones in step S3 are estrogen and fadroxil.

[0015] Furthermore, the concentration of the estrogen is 50nM-100nM, the concentration of fadroxil is 50nM, and the solvent is DMSO.

[0016] Furthermore, the concentration of the DMSO is greater than 0 and less than or equal to 10 nM.

[0017] Preferably, the criteria for successful construction of the reversal model are: the expression of male sex-related genes in the corresponding female gonadal cells detected by qRT-PCR is significantly increased, i.e., p<0.05; the expression of female sex-related genes in male gonadal cells is significantly increased, i.e., p<0.05, which proves the successful construction of the sex reversal model of male and female gonadal cells induced by sex hormones at the mRNA level; and flow cytometry analysis found that after sex hormone stimulation, the proportion of cells expressing the male sex-related gene SOX9 in female gonadal cells was significantly increased, i.e., p<0.05, and the expression level of SOX9 was at least doubled compared with the original; the proportion of cells expressing the female sex-related gene FOXL2 in male gonadal cells was significantly increased, i.e., p<0.05, and the expression level of FOXL2 was at least doubled compared with the original, which indirectly proves the successful construction of the sex reversal model of male and female gonadal cells induced by sex hormones at the protein level.

[0018] Beneficial effects: 1) Deepening of scientific research: The present invention systematically analyzes the expression patterns of genes related to sex determination and differentiation by accurately separating and identifying male and female glandular cells, and using advanced molecular biology techniques such as RT-qPCR, indirect immunofluorescence, and flow cytometry, providing a reliable platform and model for in-depth research on the mechanism of animal sex determination and the sex differentiation regulatory network. This greatly promotes scientific research in the fields of reproductive biology, developmental biology, and genetics, and helps to reveal the molecular mechanism of sex differentiation;

[0019] 2) Innovation in sex reversal technology: This invention innovatively uses sex hormones (FAD and estrogen E2) to construct a sex reversal model of chicken gonadal somatic cells, and through time gradient stimulation experiments, it describes in detail the dynamic changes of gene expression during the sex reversal process. This method not only enriches the research methods of sex reversal, but also provides new ideas and means for the fields of abnormal sex development and sex-controlled breeding;

[0020] 3) Practical application in agricultural production: In animal husbandry, sex control is one of the important ways to improve production efficiency and reduce breeding costs. The sex reversal model established by the present invention provides a theoretical basis and experimental basis for the development of new sex control drugs or technologies. In the future, it is expected to be applied to the early identification and regulation of sex of poultry and other economic animals, thereby achieving precise management and efficient production in the breeding industry;

[0021] 4) Potential value in medical health: In addition, the research results of this invention may also provide new insights into the diagnosis and treatment of diseases with abnormal sex development (such as gonadal dysgenesis, sex reversal syndrome, etc.). By gaining a deeper understanding of the molecular mechanisms of sex differentiation, it is possible to provide more targeted strategies for gene therapy or drug intervention for these diseases, thereby improving the quality of life of patients;

[0022] 5) Promote multidisciplinary cross-integration: The implementation process of the present invention involves the knowledge and technology of multiple disciplines such as molecular biology, cell biology, biochemistry, genetics, etc., which promotes the cross-integration and collaborative innovation among these disciplines, is conducive to cultivating compound scientific research talents, and promotes the overall development of the field of life sciences;

[0023] Therefore, the present invention is not only of great significance in theoretical research, but also has broad application prospects and social and economic benefits, and plays a positive role in promoting scientific and technological progress and industrial development in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 A methodological technology roadmap for constructing a gonadal somatic cell sex reversal model;

[0025] Figure 2 For sex identification, morphological observation and culture of male and female glandular cells;

[0026] Figure 3 To characterize the male and female gonadal cells;

[0027] Figure 4 Determined by the sex hormone treatment concentration with the lowest DMSO content;

[0028] Figure 5 qRT-PCR was used to detect the expression of sex-related genes in male and female gonadal cells after sex hormone treatment;

[0029] Figure 6 To detect the expression of sex-related genes in female glandular cells after FAD treatment by flow cytometry;

[0030] Figure 7 The expression of sex-related genes in male glandular cells was detected by flow cytometry after E2 treatment. DETAILED DESCRIPTION

[0031] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments:

[0032] Example 1

[0033] like Figure 1 As shown, a method for establishing a somatic cell sex reversal model comprises the following steps:

[0034] (1) Cell isolation and culture:

[0035] At E18.5 d, the abdominal cavity of the chicken embryo was opened, and the sex was determined by the morphology of the male and female gonads under a microscope. The male and female gonadal tissues on both sides were clamped and separated with ophthalmic forceps, and the tissues attached during the separation process were removed under a stereomicroscope, and the separated gonads were photographed; the separated tissues were transferred to 1.5 mL EP tubes, and the tissues were first cut as finely as possible with ophthalmic scissors. Collagenase IV was added to each 1.5 mL EP tube, and heated in a 37°C water bath for 15 min, and the centrifuge tube was turned upside down every 5 min; after centrifugation at 1400 rpm for 5 min, 0.25% trypsin was added for digestion for 3 min, and the digestion was terminated with DMEM containing 10% FBS, centrifuged at 1400 rpm for 5 min, and the supernatant was discarded. The cells were resuspended with DMEM containing 10% FBS and plated in 6-well plates. Fresh culture medium was replaced after 6 hours for differential adherence culture, and passage was performed according to the growth rate. The male and female gonadal cells passaged to P3 were collected for sex identification.

[0036] Results: The morphology of the collected chicken embryo gonads was observed under a microscope (e.g. Figure 2 As shown in Figure A), when the chicken embryo develops to E18.5d, the morphological changes of its gonads have been quite significant, and there are obvious gender differences. The testicles of male chickens have basically formed at this time. They are symmetrically arranged on both sides of the spine in the abdominal cavity and below the anterior lobe of the kidney. They are shaped like broad beans and are mostly light yellow. The ovaries of female chickens also develop in the abdominal cavity, but usually only the left ovary develops into a functional female reproductive organ, which appears white and swollen at E18.5d, while the right ovary degenerates after the middle of incubation. Through two enzymatic digestions, male and female glandular cells were successfully obtained, and the cells were purified by differential adhesion. After 1 day of culture, the male and female glandular cells in the 6-well plate were transferred into 60mm small dishes respectively. The morphology of the male and female glandular cells on the second day of separation and culture is as shown in the figure. Figure 2 As shown in C.

[0037] Conclusion: The gonads of E18.5d chicken embryos were successfully isolated, and the gonadal somatic cells were cultured and purified.

[0038] (2) Determination of the sex of male and female gonadal cells by PCR:

[0039] According to the blood / cell / tissue genomic DNA extraction kit (DP304), Max DNA Polymerase polymerase amplified the CHD1 gene located on the sex chromosome (Z / W), and the PCR amplification product was verified by gel electrophoresis. The male (ZZ) PCR amplification product had a band at 580 bp, and the female (ZW) PCR amplification product had bands at 580 bp and 423 bp. The amplification primer sequences are as follows:

[0040] SEQ ID NO.1 (CHD1-Forward): CTGCGAGAACGTGGCAACAGAGT,

[0041] SEQ ID NO.2 (CHD1-Reward): ATTGAAATGATCCAGTGCTTG;

[0042] After sex identification, RNA extraction and agarose gel analysis were performed on the identified tissue samples according to sex.

[0043] Results: The collected male and female gonadal cells were sexed by PCR (e.g. Figure 2 B), the sample is male (ZZ) and the PCR amplification product has a band at 580 bp, that is, there is only one band; the female (ZW) PCR amplification product has bands at both 580 bp and 423 bp, that is, there are two bands.

[0044] Conclusion: The gonadal cells of both sexes, namely male and female gonadal cells, were successfully identified and obtained.

[0045] (3) Sample RNA extraction

[0046] Sample collection:

[0047] ① Estrogen (E2) and fadroxil (FAD) need to be dissolved in DMSO, and DMSO has a certain stimulating effect on cells. In order to avoid such effects, different gradients of DMSO concentrations (0, 10μM, 1μM, 500nM and 10nM) were set;

[0048] ② Since sex hormones stimulate gonadal cells to undergo sex reversal for different durations, we collected cell samples of female gonadal cells stimulated with 50nM FAD for 0-14 days, and cell samples of male gonadal cells stimulated with 50nM and 100nM E2 for 0-14 days, respectively.

[0049] The collected samples were homogenized and total RNA was isolated using TRIzol Reagent (QIAGEN, Beijing, China, DP424). The specific steps are as follows:

[0050] ① Extraction of total RNA: TRNzol chloroform extraction method was used to extract total RNA. The specific steps are as follows:

[0051] a. Sample processing: Wash the adherent cells with PBS three times, collect the cells into a 1.5mL RNase-free centrifuge tube, add 1mL TRNzol reagent; take 50-100mg tissue (the whole individual is taken for gonadal tissues such as ovaries and testes) into a 1.5mL RNase-free centrifuge tube, add 1mL TRNzol reagent, and crush and homogenize with a high-speed tissue crusher; let the sample stand at room temperature (15-30℃) for 5min, or store it at -80℃ for a long time;

[0052] b. Add 0.2 mL of chloroform to a 1.5 mL RNase-free centrifuge tube, cover the tube, shake vigorously for 15 seconds, and let stand at room temperature (15-30°C) for 3 minutes;

[0053] c. Centrifuge at 12,000 × g for 15 min at 4°C. The sample will separate into three layers: a pink organic phase, an intermediate layer, and an upper colorless aqueous phase. RNA is mainly concentrated in the upper aqueous phase. Carefully pipette the upper aqueous phase (about 450-500 μL) into a new 1.5 mL RNase-free centrifuge tube.

[0054] d. Add an equal volume (about 450-500 μL) of isopropanol solution, mix gently, and let stand at room temperature (15-30°C) for 10 min;

[0055] e. Centrifuge at 12,000 × g for 10 min at 4°C and discard the supernatant. Before centrifugation, RNA precipitation is usually invisible. After centrifugation, a gelatinous precipitate will form on the sides and bottom of the tube.

[0056] f. Add 1 mL of 75% ethanol (prepared with RNase-free ddH2O) to the centrifuge tube and shake gently several times to wash the precipitate;

[0057] g. Centrifuge at 7500×g for 5 min at 4°C, aspirate the supernatant with a pipette and discard it, being careful not to aspirate the precipitate;

[0058] h. Open the centrifuge tube lid and place it to dry at room temperature (15-30°C) for 3-5 minutes;

[0059] i. According to the experimental situation, add 20-50μL RNase-Free ddH2O, blow gently with a pipette tip to fully dissolve the RNA, measure the concentration, and store in a -80℃ refrigerator.

[0060] ② RNA reverse transcription to obtain cDNA: Reverse transcription is performed using sample RNA as a template. The specific steps are as follows:

[0061] a. Thaw the sample RNA on ice, thaw 5×FastKing-RT SuperMix and RNase free ddH2O at room temperature, and quickly place on ice after thawing (Note: all samples should be added on ice, and each solution should be vortexed and mixed before use, and centrifuged briefly before use). The reverse transcription reaction system and reaction conditions are as follows:

[0062] Table 1 Reverse transcription reaction system

[0063]

[0064] Table 2 Reverse transcription reaction conditions

[0065]

[0066] (4) Real-time quantitative polymerase chain reaction (qRT-PCR)

[0067] qRT-PCR was used to detect the expression of sex-related genes FOXL2, SOX9, AMH, WNT4, DMRT1 and CYP19A1 in normal male and female gonadal cells, male and female gonadal cells stimulated by different concentrations of DMSO, and male and female gonadal cells stimulated by sex hormones. The gene quantitative primer sequences are as follows:

[0068] Table 3 Quantitative primer sequences

[0069]

[0070] qRT-PCR using ChamQ TM SYBR qPCR Master Mix (SYBR Green) color fluorescence quantitative premix reagent (Novozyme, Q311), the method is as follows:

[0071] Melt 2×ChamQ SYBR qPCR Master Mix, sample cDNA template, quantitative primers and RNase-Free ddH2O in ice, mix all reagents thoroughly, and prepare qRT-PCR reaction solution on ice. The reaction system is 20 μL. See Table 4 below for details:

[0072] Table 4 qRT-PCR reaction system

[0073]

[0074] β-Actin was used as the internal reference gene, and three replicates were set for each well. The mRNA levels of related genes were detected using the CFX-Connect Real-Time PCR Detection System (BIO-RAD, 7500fast). The reaction procedure is shown in Table 5 below:

[0075] Table 5 qRT-PCR program

[0076]

[0077] Finally, use 2 in Microsoft Excel software -ΔΔCt The experimental data were analyzed by relative quantitative method. The relative quantitative analysis of genes was performed, and each test was repeated 3 times. SPSS software was used to perform statistical analysis on the differences between the groups. Student t test (*p<0.05, significant difference; **p<0.01, extremely significant difference) was used, and GraphPad Prism9.5.1 software was used for drawing.

[0078] Results: By detecting the expression of sex-related genes in male and female gonadal cells, such as Figure 3 As shown in A: FOXL2 and CYP19A1 are highly expressed in female gonadal cells, while SOX9 and DMRT1 are highly expressed in male gonadal cells; the expression of sex-related genes (FOXL2, SOX9, AMH, WNT4, DMRT1 and CYP19A1) in male and female gonadal cells was compared when stimulated with different concentrations of DMSO. Among them, 10nM DMSO had little effect on the expression of sex-related genes in gonadal cells ( Figure 4 ); The female gonadal cells were stimulated with 50 nM FAD to detect the induction of sex reversal in female gonadal cells at different times. Compared with the control group, the expression levels of male-related genes SOX9 and AMH in female gonadal cells were significantly increased after 3 days of FAD stimulation, which were 25.54 times (p<0.001) and 2.02 times (p<0.05) of the control group, respectively. The expression levels of male-related genes DMRT1, SOX9 and AMH in female gonadal cells were significantly increased after 13 days of FAD stimulation, which were 19.98 times (p<0.001), 12.89 times (p<0.001) and 18.64 times (p<0.001) of the control group, respectively. ( Figure 5 A); Comparison of the induction of sex reversal in male gonadal cells stimulated by 50 nM E2 for different durations. Compared with the control group, the expression levels of female-related genes CYP19A1, FOXL2 and WNT4 were significantly increased in male gonadal cells after 50 nM E2 stimulation for 3 and 13 days. After 3 days of stimulation, the expression levels of CYP19A1, FOXL2 and WNT4 were 36.28 times (p<0.001), 59.59 times (p<0.001) and 8.52 times (p<0.001) of those in the control group, respectively. After 13 days of stimulation, the expression levels of CYP19A1, FOXL2 and WNT4 were 14.79 times (p<0.001), 8.45 times (p<0.001) and 13.79 times (p<0.001) of those in the control group, respectively. ( Figure 5B); Comparison of the induction of sex reversal in male gonadal cells stimulated by 100 nM E2 for different durations showed that compared with the control group, the expression of female-related genes in male gonadal cells was significantly increased after 100 nM E2 stimulation for 4 and 13 days. After 4 days of stimulation, the expression of CYP19A1, FOXL2 and WNT4 was 6.68 times (p<0.001), 3.32 times (p<0.001) and 3.00 times (p<0.001) of that in the control group, respectively. After 13 days of stimulation, the expression of CYP19A1, FOXL2 and WNT4 was 2.89 times (p<0.001), 45.20 times (p<0.001) and 14.03 times (p<0.001) of that in the control group, respectively. ( Figure 5 C).

[0079] Conclusion: Male-female related genes are highly expressed in male and female gonadal cells, respectively, that is, the expression of sex-related genes in male and female gonadal cells also conforms to the law; 50nM FAD stimulation for 3d and 13d can induce female gonadal cell reversal; 50nM E2 stimulation for 3d and 13d, 100nM E2 stimulation for 4d and 13d can induce male gonadal cell reversal.

[0080] (5) Western Blot analysis

[0081] ① Female and male glandular cell samples and processing:

[0082] a. Use a pipette to remove the culture medium from the cells cultured in a 60 mm dish, add PBS, lay the dish flat and gently shake to wash the cells, then discard the wash solution;

[0083] b. Add 1 mL of 0.25% trypsin and terminate the digestion with complete medium. Collect the cell pellet after centrifugation at 1400 rpm.

[0084] c. Add 10 μL PMSF (100 mM) to 1 mL of lysis buffer, mix well, place on ice, and let stand for 30 min (PMSF should be shaken until no crystals are present before mixing with the lysis buffer);

[0085] d. Centrifuge the lysed product at 12000 rpm for 20 min at 4°C and collect the supernatant;

[0086] e. Use the BCA kit to determine the protein concentration, adjust the concentration of male and female glandular cells to be consistent, add an appropriate amount of concentrated SDS-PAGE protein loading buffer to the collected protein samples, and place the mixed samples in a metal bath at 100°C and heat for 10 minutes.

[0087] ②Electrophoresis:

[0088] After the sample has cooled to room temperature, load the protein sample directly into the SDS-PAGE gel loading hole. Use low voltage 80V constant voltage electrophoresis for the upper gel and high voltage 120V constant voltage electrophoresis for the lower gel. Based on the electrophoresis of the pre-stained protein molecular weight standard, it is expected that the electrophoresis can be stopped after the target protein has been properly separated.

[0089] ③Transfer:

[0090] a. Before transfer, the PVDF membrane should be soaked in methanol solution for 5-10 seconds until it is wet, and then balanced in the balance solution;

[0091] b. Soak the transfer clips, six transfer filter papers, a dropper, and a PVDF membrane in the transfer buffer, then take out the SDS-PAGE gel, gently scrape off the concentrated gel, and make a notch in one corner of the gel as a mark to distinguish the loading order. Soak the gel in the transfer buffer for about 5 minutes to balance the ionic strength;

[0092] c. Open the clamp and lay the bottom black electrode (cathode) flat, put three transfer filter papers, and roll them back and forth with a glass rod several times to remove the bubbles inside. Take out the gel immersed in the transfer solution and lay it flat on the filter paper to remove all bubbles. Place the PVDF membrane on the polyacrylamide gel, roll it back and forth with a glass rod several times to remove all bubbles. Cover the membrane with three filter papers soaked in transfer buffer, and also make sure that no bubbles are left. Cover the anode plate (white), clamp it tightly, and ensure that there is a certain pressure on the gel;

[0093] d. Place the clips into the transfer tank, with the black side of the clips facing the black side of the tank, and the white side of the clips facing the red side of the tank. Place the transfer tank in ice water during transfer. Generally, use a constant voltage of 120V for 60 minutes.

[0094] ④Immunological testing:

[0095] a. Take the membrane, shake it face up in 1×TBST solution for five minutes, wash it once, move it to a bottle containing blocking solution (TBST buffer containing 10% skim milk powder), and shake it on a decolorizing shaker at room temperature for 1 hour;

[0096] b. Wash the membrane three times with TBST, 5 min each time;

[0097] c. The membrane was incubated with primary antibodies at 4°C overnight (FOXL2 antibody (262C1a), sc-81275, Santa cruz, USA; SOX9 Recombinant Rabbit Monoclonal Antibody [SN74-09], ET1611-56, Huaan Biotechnology, China; GAPDH (D4C6R) Mouse mAb, 97166, CST, USA);

[0098] d. Wash twice with 15 mL TBST with gentle shaking, 3 min each time;

[0099] e. The membrane was incubated with the corresponding HRP secondary antibody (horseradish peroxidase-labeled goat anti-mouse IgG (H+L), A0216, Beyotime, China; horseradish peroxidase-labeled goat anti-rabbit IgG (H+L), A0208, Beyotime, China) at room temperature with shaking for 1 h;

[0100] f. Wash the membrane three times with 15 mL TBST, 5 min each time;

[0101] g. Add developer to the membrane, wrap it in plastic film, put it into the imager, adjust the appropriate exposure time, and take pictures.

[0102] Results: Through Western blot experiments, we successfully verified that FOXL2 had a clear band at 50 kDa in male and female gonadal cells and was highly expressed in female gonadal cells, and SOX9 had a clear band at 56 kDa and was highly expressed in male gonadal cells ( Figure 3 B).

[0103] Conclusion: FOXL2 and SOX9 are expressed in both male and female gonadal cells, but the expression amounts are different. FOXL2 is highly expressed in female gonadal cells, while SOX9 is highly expressed in male gonadal cells. This once again verifies that the expression of sex-related genes in male and female gonadal cells conforms to the law, and also illustrates the availability of FOXL2 and SOX9 antibodies.

[0104] (6) Immunofluorescence analysis

[0105] ① Cell preparation

[0106] For male and female glandular cells, when subculturing, the cells were seeded into a 24-well plate with a pre-treated coverslip, and when the cells were close to growing into a monolayer, the coverslip was removed and washed twice with PBS;

[0107] ②Fixed

[0108] Fix the cells with 4% paraformaldehyde at room temperature for 10 minutes. After fixation, wash the cells with PBS three times, 5 minutes each time.

[0109] ③ Transparency

[0110] The cells were permeabilized with 0.1% Triton X-100 for 5 min at room temperature and washed three times with PBS for 5 min each time after permeabilization;

[0111] ④ Closed

[0112] The cells were blocked with PBS containing 0.1% BSA at room temperature for 2 h;

[0113] ⑤ Primary antibody incubation

[0114] Incubate overnight at 4°C (the FOXL2 and SOX9 antibodies are the same as those in the above Western blot), rinse three times with PBS, 5 min each time;

[0115] ⑥ Secondary antibody incubation

[0116] Indirect immunofluorescence used fluorescent secondary antibodies (Alexa Fluor 488-labeled goat anti-mouse IgG (H+L), A0428, Beyotime, China; Alexa Fluor 488-labeled goat anti-rabbit IgG (H+L), A0423, Beyotime, China), incubated at room temperature in the dark for 1 h, and rinsed with PBS three times, 5 min each time;

[0117] ⑦DAPI staining

[0118] A small amount of DAPI staining solution (C1005, Biyuntian, China) was added to cover the sample, and the sample was placed at room temperature for 5 min. The DAPI staining solution was removed by aspiration, and the sample was washed three times with PBS, each time for 5 min;

[0119] ⑧Seal and test

[0120] One drop of anti-fluorescence quenching sealing solution (P0126-5ml, Biyuntian, China) was added, the slides were sealed, and the sections were examined under a fluorescence microscope.

[0121] Results: FOXL2 and SOX9 were labeled with Alexa Fluor 488 and displayed green fluorescence ( Figure 3 C). DAPI is used to stain the cell nucleus, which is blue fluorescence ( Figure 3 C). FOXL2 is highly expressed in female gonadal cells, with a higher expression level in the cytoplasm and a small amount in the nucleus. SOX9 is highly expressed in male gonadal cells, with a higher expression level in the cytoplasm and a small amount in the nucleus.

[0122] Conclusion: FOXL2 is highly expressed in female gonadal cells, while SOX9 is highly expressed in male gonadal cells, which once again verifies that the expression of sex-related genes in male and female gonadal cells follows a regular pattern.

[0123] (7) Flow cytometry (FCM)

[0124] ① Cell preparation

[0125] For male and female glandular cells, when subculturing, the cells were seeded into a 24-well plate with a pre-treated coverslip, and when the cells were close to growing into a monolayer, the coverslip was removed and washed twice with PBS;

[0126] ②Fixed

[0127] Fix the cells with 4% paraformaldehyde at room temperature for 5 minutes. After fixation, wash the cells with PBS three times, each time for 5 minutes.

[0128] ③ Transparency

[0129] The cells were permeabilized with 0.1% Triton-x100 for 5 min at room temperature and washed three times with PBS for 5 min each time;

[0130] ④ Closed

[0131] The cells were blocked with PBS containing 0.1% BSA at 37°C for 1 h;

[0132] ⑤ Primary antibody incubation

[0133] Incubate at 37°C for 2 h (the FOXL2 and SOX9 antibodies are the same as those in the above Western blot), wash with PBS three times, 5 min each time;

[0134] ⑥ Secondary antibody incubation

[0135] Fluorescent secondary antibodies (Alexa Fluor 488-labeled goat anti-mouse IgG (H+L), A0428, Beyotime, China; Alexa Fluor 488-labeled goat anti-rabbit IgG (H+L), A0423, Beyotime, China) were used for this flow cytometry, and the samples were incubated at room temperature in the dark for 1 h, and then rinsed with PBS three times, 5 min each time;

[0136] ⑦On-machine testing

[0137] Add appropriate amount of PBS to resuspend the cells, analyze the cells using FACS LSRFortessa flow cytometer, and analyze the flow data using FlowJo software. Each test was repeated 3 times, and Student t test was used (*p<0.05, significant difference; **p<0.01, extremely significant difference), and GraphPad Prism9.5.1 software was used for plotting.

[0138] Results: Through quality control, the normal expression of FOXL2 and SOX9 was circled, and the expression changes of FOXL2 and SOX9 in male and female glandular cells before and after stimulation and the corresponding ratios are shown in the figure ( Figure 6 A, 7A). Compared with the control group, the expression of SOX9 in female gonadal cells increased after 3 days of FAD stimulation, but there was no significant difference ( Figure 6B). After 13 days of FAD stimulation, the expression of SOX9 increased significantly (p<0.001), which was 2.14 times that of the control group, indicating that FAD stimulation for 13 days can induce the reversal of female gonadal somatic cells ( Figure 6 C). Compared with the control group, the expression of FOXL2 in male gonadal cells increased significantly after 3 days of 50nM E2 stimulation, which was 1.74 times that of the control group (p<0.01). After 4 days of 100nM E2 stimulation, the expression of FOXL2 increased significantly, which was 2.13 times that of the control group (p<0.001), indicating that 3 days of 50nM E2 stimulation and 4 days of 100nM E2 stimulation can induce male gonadal cell reversal ( Figure 7 B). Compared with the control group, the expression of FOXL2 in male gonadal cells was significantly increased after 13 days of stimulation with 50nM and 100nM E2, which was 2.58 (p<0.01) and 3.74 times (p<0.001) of the control group, respectively. This indicates that E2 stimulation for 13 days can induce the reversal of male gonadal cells ( Figure 7 C).

[0139] Conclusion: Flow cytometry confirmed the results of qRT-PCR, that is, 50nM FAD stimulation for 13 days can induce female gonadal somatic cell reversal, while 50nM E2 stimulation for 3 days and 13 days, and 100nM E2 stimulation for 4 days and 13 days can induce male gonadal somatic cell reversal.

[0140] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for establishing a somatic cell sex reversal model, characterized in that: The following steps are involved: S1. Isolate male and female glandular cells, and perform sex identification and culture; S2. Determine marker genes: Screen the genes with high expression difference between males and females at E18.5 d, design RT-PCR primers, and detect them in isolated gonadal somatic cells; S3. Construct a reversal model: Use sex hormones as inducers to determine the effective sex hormone induction concentration for the reversal model, and use marker gene quantification and flow cytometry to determine the construction of the reversal model.

2. The method for establishing a somatic cell sex reversal model according to claim 1, characterized in that: The marker genes in step S2 are FOXL2, SOX9, AMH, DMRT1, CYP19A1 and WNT4.

3. The method for establishing a somatic cell sex reversal model according to claim 2, characterized in that: The nucleotide sequences of the RT-PCR primers for the marker genes in step S2 are shown in SEQ ID NOs. 3-14.

4. The method for establishing a somatic cell sex reversal model according to claim 1, characterized in that: The sex hormones in step S3 are estrogen and fadroxil.

5. The method for establishing a somatic cell sex reversal model according to claim 4, characterized in that: The concentration of the estrogen is 50 nM-100 nM, the concentration of fadroxil is 50 nM, and the solvent is DMSO.

6. The method for establishing a somatic cell sex reversal model according to claim 5, characterized in that: The concentration of the DMSO is greater than 0 and less than or equal to 10 nM.

7. The method for establishing a somatic cell sex reversal model according to claim 1, characterized in that: The criterion for successful construction of the inversion model is that the expression of male sex-related genes in the corresponding female gonadal cells detected by qRT-PCR is significantly increased, that is, p < 0.05; the expression of female sex-related genes in male gonadal cells was significantly increased, i.e. p < 0.05, which proved that the sex reversal model of male and female gonadal cells induced by sex hormones was successfully constructed at the mRNA level; and flow cytometry analysis found that the proportion of cells expressing the male sex-related gene SOX9 in female gonadal cells increased significantly after sex hormone stimulation, that is, p < 0.05 and the expression of SOX9 increased by at least one-fold; the proportion of cells expressing the female sex-related gene FOXL2 in male gonadal cells increased significantly, that is, p < 0.05 and the expression level of FOXL2 was at least doubled compared with the original level, which indirectly proved the successful construction of the sex reversal model of male and female gonadal cells induced by sex hormones at the protein level.

Images