Nucleic acid aptamer specifically combined with alpha-synuclein aggregate and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer specifically combined with alpha-synuclein aggregate and application thereof, and belongs to the technical field of molecular biological medicine. The nucleic acid aptamer C125 of the alpha-synuclein aggregate is obtained by screening through a FluMag-SELEX screening strategy for the first time, and the nucleotide sequence of the nucleic acid aptamer C125 is as shown in SEQ ID NO. 1. Through verification, the combination of the nucleic acid aptamer C125 and the alpha-synuclein aggregate has good affinity and specificity, and the alpha-synuclein aggregate (ab218817) and the alpha-synuclein monomer (ab51189) can be specifically distinguished in vitro; therefore, the nucleic acid aptamer C125 can be used for auxiliary diagnosis and targeted therapy of neurodegenerative diseases closely related to abnormal aggregation of alpha-synuclein, such as Parkinson's disease, dementia with Lewy bodies and multisystem atrophy, or for basic research and the like related to occurrence, development and progress of the diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biomedicine, and in particular relates to a nucleic acid aptamer specifically binding to alpha-synuclein aggregates and an application thereof. Background Art

[0002] Parkinson's disease, Lewy body dementia and multiple system atrophy are three neurodegenerative diseases closely related to abnormal aggregation of α-synuclein. These diseases are particularly common in the elderly and have a serious impact on the quality of life and social function of patients. Parkinson's disease is mainly manifested by symptoms such as resting tremor, bradykinesia, muscle rigidity and postural balance disorders. Lewy body dementia is a disease that affects cognitive function, and patients experience symptoms such as cognitive impairment, fluctuating cognitive impairment, visual hallucinations and Parkinson's syndrome. Multiple system atrophy is a rare neurodegenerative disease that widely affects the central nervous system, causing symptoms such as movement disorders, autonomic dysfunction and cerebellar ataxia. Although the clinical manifestations and pathological characteristics of these three diseases are different, they are all closely related to abnormal aggregation of α-synuclein.

[0003] α-Synuclein is a 14kDa soluble protein widely distributed in the hippocampus, neocortex, thalamus and other regions. It is essential for maintaining neuronal membrane homeostasis, regulating the storage and release of neurotransmitters, promoting cell autophagy and maintaining mitochondrial function. Under normal physiological conditions, α-synuclein binds to the cell membrane and exerts physiological functions such as regulating the release of neurotransmitter vesicles. However, in the pathological process of PD (Parkinson's disease), α-synuclein undergoes misfolding and transforms into a neurotoxic aggregate form (Alpha-synuclein aggregate). Aggregate α-synuclein can not only accumulate in cells, but also spread between neurons through mechanisms such as membrane penetration, exosome delivery and exocytosis, further inducing aggregation of α-synuclein in healthy neurons. Pathological aggregation of α-synuclein can cause neurotoxicity through a variety of mechanisms, including destroying cell structure, interfering with cell function, inducing inflammatory response, and accelerating the pathological process of PD. Studying α-synuclein aggregates is of great significance for gaining a deeper understanding of the pathogenesis of Parkinson's disease and other neurodegenerative diseases. The detection of α-synuclein aggregates will also provide important support for the early diagnosis and prognosis evaluation of the corresponding diseases.

[0004] In recent years, diagnosis and treatment based on nucleic acid aptamers have received extensive attention. Nucleic acid aptamers are single-stranded DNA or RNA that can specifically recognize targets and are screened from nucleic acid libraries based on the systematic evolution of ligands by exponential enrichment (SELEX). They are generally composed of 15-60 bases and have the advantages of small molecular weight, high specificity, high affinity, wide recognition of targets, batch synthesis, low cost, and strong stability. These oligonucleotide fragments can fold into highly specific structures and bind to target biological molecules such as proteins, similar to the function of antibodies. Compared with antibodies, aptamers usually have stronger specificity and affinity, and can bind to various target substances with high affinity and strong specificity, including drugs, peptides and proteins, ions, toxins, low molecular weight ligands, cells, and whole microorganisms. Secondly, aptamers are easier to obtain than antibodies and can be synthesized by chemical methods, avoiding complex biological production processes and making the drug screening process more controllable. In addition, nucleic acid aptamers are more stable than antibodies and are easy to store. As an emerging recognition ligand with excellent performance, nucleic acid aptamers have been effectively applied in many fields.

[0005] FluMag-SELEX technology is an improved SELEX method that uses magnetic beads as solid supports to simplify the screening process of aptamers. First, the magnetic beads are coupled to the target substance, and then the random single-stranded nucleic acid sequence library is mixed with the magnetic bead-target substance complex, and the nucleic acid sequence bound to the target substance is separated by magnetic separation. After multiple rounds of screening and amplification, aptamers with high affinity to the target substance are finally obtained. Magnetic bead SELEX technology has many advantages, such as easy operation, high throughput, good repeatability, etc., and can be carried out in the laboratory, which can greatly improve the screening success rate of nucleic acid aptamers. In addition, magnetic beads as solid supports make the separation and purification of aptamers more convenient, and also reduce cross contamination in experiments.

[0006] Although nucleic acid aptamers for α-synuclein oligomers have been screened out, their specificity for α-synuclein aggregates is not ideal in practical applications, and it is difficult to specifically distinguish α-synuclein aggregates from α-synuclein monomers. Therefore, it is necessary to combine relevant technologies to further screen out highly specific nucleic acid aptamers for α-synuclein aggregates. Summary of the invention

[0007] The purpose of the present invention is to solve the problems existing in the prior art and provide a nucleic acid aptamer that can specifically bind to α-synuclein aggregates. The synthesis of the corresponding nucleic acid aptamer is of great significance for the auxiliary diagnosis, targeted treatment and basic research of neurodegenerative diseases such as Parkinson's disease, Lewy body dementia and multiple system atrophy.

[0008] The technical scheme of the present invention is: a nucleic acid aptamer that specifically binds to α-synuclein aggregates, including a nucleic acid aptamer C125, wherein the nucleotide sequence of C125 is shown in SEQ ID NO.1 (5'-ATCCAGAGTGACGCAGCACGAGACCCTTCTTTTCCTTTTGCTTCTTTTC CCTCCTCCCTGGACACGGTGGCTTAGT-3').

[0009] Furthermore, any of the following sequences is included:

[0010] 1) A nucleotide sequence with a homology of more than 80% with the nucleic acid aptamer C125 and capable of specifically binding to α-synuclein aggregates;

[0011] 2) a nucleotide sequence that hybridizes with the nucleotide sequence of the nucleic acid aptamer C125 and can specifically bind to α-synuclein aggregates;

[0012] 3) RNA sequence reverse transcribed from the nucleotide sequence of nucleic acid aptamer C125.

[0013] Furthermore, the nucleic acid aptamer that specifically binds to α-synuclein aggregates also includes a nucleotide sequence obtained by modifying the nucleotide sequence of the nucleic acid aptamer C125 by phosphate backbone, truncation, extension, inversion or chemical modification of the base; or a nucleotide sequence obtained by labeling the 5' end or 3' end of the nucleic acid aptamer C125 with a marker.

[0014] Preferably, the marker is a biotin marker, a digoxigenin marker, a fluorescent marker, a nanoluminescent material marker or an enzyme marker.

[0015] The nucleic acid aptamer specifically binding to α-synuclein aggregates can be used in the preparation of diagnostic reagents, test strips or biosensors for Parkinson's disease, Lewy body dementia and multiple system atrophy.

[0016] The nucleic acid aptamer specifically binding to α-synuclein aggregates can be used in the preparation of drugs for treating Parkinson's disease, Lewy body dementia and multiple system atrophy.

[0017] The nucleic acid aptamer that specifically binds to α-synuclein aggregates can be used in the preparation of drugs for diagnosing Parkinson's disease, Lewy body dementia and multiple system atrophy.

[0018] The present application also provides a diagnostic reagent, test paper or biosensor for Parkinson's disease, Lewy body dementia and multiple system atrophy. The active ingredients of the diagnostic reagent, test paper or the components of the biosensor include the above-mentioned nucleic acid aptamer that specifically binds to α-synuclein aggregates.

[0019] The present application also provides a drug for treating Parkinson's disease, Lewy body dementia and multiple system atrophy, wherein the active ingredient of the drug includes the above-mentioned nucleic acid aptamer that specifically binds to α-synuclein aggregates, and the inhibitory properties of the corresponding nucleic acid aptamer itself can also be directly used as a drug enhancer to curb the deterioration of neurodegenerative diseases.

[0020] The present application also provides a drug for diagnosing Parkinson's disease, Lewy body dementia and multiple system atrophy, wherein the active ingredient of the drug includes the above-mentioned nucleic acid aptamer that specifically binds to α-synuclein aggregates.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] 1. This application uses α-synuclein aggregates (ab218817) as the positive screening target and α-synuclein monomers (ab51189) as the counter screening target. Based on the FluMag-SELEX technology, the nucleic acid aptamer C125 for α-synuclein aggregates was screened for the first time. It has been verified that the binding dissociation constant K of C125 for ab218817 and ab51189 is D The values ​​were 4.3±0.76nM and 51±10nM, respectively, with a difference of about 12 times, which proved that the nucleic acid aptamer C125 can specifically distinguish ab218817 and ab51189 in vitro and has strong specific binding ability to ab218817;

[0023] 2. K of aptamer C125 interacting with ab218817 and ab51189 D The values ​​were 4.3±0.76nM and 51±10nM, respectively. C125 showed a strong affinity for the target ab218817. Therefore, the nucleic acid aptamer C125 can be used as a detection reagent for α-synuclein aggregates in the blood of patients with neurodegenerative diseases, as well as for auxiliary detection and targeted treatment of neurodegenerative diseases. It can also be used for basic research related to the occurrence, development, and progression of neurodegenerative diseases.

[0024] 3. The nucleic acid aptamer C125 disclosed in the present application can simply, rapidly and sensitively identify and bind to α-synuclein aggregates. It is suitable for the auxiliary diagnosis of neurodegenerative diseases such as Parkinson's disease, Lewy body dementia and multiple system atrophy, or can be directly used as a drug for auxiliary treatment of patients with related diseases, and has broad clinical application prospects and basic application value;

[0025] 4. The nucleic acid aptamer specifically binding to α-synuclein aggregates disclosed in the present application can be synthesized by chemical methods, with good reproducibility between production batches, low cost and easy storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Gel electrophoresis for aptamer screening and binding ratio monitoring;

[0027] Figure 2 The figure is a monitoring diagram of the binding ratio of nucleic acid aptamer screening, where the binding ratio represents the ratio of the molar number of nucleic acid aptamers bound to ab218817 to the molar number of input library (a); the enrichment ratio is the ratio of the positive screening binding ratio to the reverse screening binding ratio (b);

[0028] Figure 3 Cluster analysis results for rounds 8 and 13 of screening sequencing;

[0029] Figure 4A is a schematic diagram of the secondary structure of the candidate nucleic acid aptamer C1;

[0030] Figure 4B is a schematic diagram of the secondary structure of the candidate nucleic acid aptamer C5;

[0031] Figure 4C Schematic diagram of the secondary structure of candidate nucleic acid aptamer C99;

[0032] Figure 4D is a schematic diagram of the secondary structure of the candidate nucleic acid aptamer C125;

[0033] Figure 5 The affinity curves of candidate nucleic acid aptamers C1, C5, C125 and reported sequence TSO508 binding to ab218817 and ab51189 were determined by microscale thermophoresis (MST); wherein, panels a and b are affinity curves of TSO508 binding to ab218817 and ab51189; panels c and d are affinity curves of C1 binding to ab218817 and ab51189; panels e and f are affinity curves of C5 binding to ab218817 and ab51189; panels g and h are affinity curves of C125 binding to ab218817 and ab51189;

[0034] Figure 6 Panels a and b in the middle are schematic diagrams of the secondary structures of the C125 trimmed sequence and the mutant sequences C125-40 and C125M, respectively;

[0035] Fig. 7A The BLI curve of C125 and the signal response curve of steady-state analysis were measured by biolayer interferometry (BLI); panels a and b are the BLI curve and signal response curve of C125 combined with ab218817, respectively; panels c and d are the BLI curve and signal response curve of C125 combined with ab51189, respectively;

[0036] Figure 7BThe BLI curve of C125-40 and the signal response curve of steady-state analysis were measured by biolayer interferometry (BLI); panels a and b are the BLI curve and signal response curve of C125-40 combined with ab218817, respectively; panels c and d are the BLI curve and signal response curve of C125-40 combined with ab51189, respectively;

[0037] Figure 7C The BLI curve of C125-M and the signal response curve of steady-state analysis were measured using biolayer interferometry (BLI); panels a and b are the BLI curve and signal response curve of C125-M combined with ab218817, respectively; panels c and d are the BLI curve and signal response curve of C125-M combined with ab51189, respectively. DETAILED DESCRIPTION

[0038] The technical solution of the present invention is further described below in conjunction with the accompanying drawings, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention should be included in the protection scope of the present invention.

[0039] Example 1: Screening and preparation of nucleic acid aptamers that specifically bind to α-synuclein aggregates

[0040] (1) Construction of an initial single-stranded nucleic acid library (SEQ ID NO.2):

[0041] 5'-ATCCAGAGTGACGCAGCA-(40N)-TGGACACGGTGGCTTAGT-3', where N represents any base among A, T, C, and G.

[0042] Forward primer: Forward primer, FP (SEQ ID NO. 3, 5'-ATCCAGAGTGACGCAGCA-3');

[0043] Reverse primer: Reverse primer, RP (SEQ ID NO. 4, 5'-ACTAAGCCACCGTGTCCA-3');

[0044] Biotin-labeled reverse primer: Bio-RP: 5′-Biotin-ACTAAGCCACCGTGTCCA-3′;

[0045] The above sequences were purchased from Shanghai Sangon Biotechnology Co., Ltd.

[0046] (2) Preparation of experimental solutions

[0047] 5× coupling buffer (5×MES Buffer): weigh 1.9523g of 4-morpholineethanesulfonic acid, add 2mL of 1% Triton X-100 solution, add DEPC water (ultrapure water treated with diethyl pyrocarbonate and sterilized by high temperature and high pressure) to 30mL, adjust pH to 6, and finally add DEPC water to make up to 40mL. 1×MES Buffer is diluted from 5×MES Buffer.

[0048] Preparation of positive and negative screening target solution: add 200 μL 1×MES Buffer to 100 μg ab218817 lyophilized powder to prepare a 0.5 μg / μL solution, store at -20°C for future use; bovine serum albumin (BSA) solution (0.5 μg / μL) is prepared before use.

[0049] 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) solutions (both at a concentration of 50 mg / mL) were prepared using 1×MES Buffer and were prepared before use.

[0050] Quenching buffer (TBS): Weigh NaCl and KCl to prepare 650mM and 13.5mM DEPC aqueous solutions respectively. Add 1mL 1M Tris-HCl solution, 8mL 650mM NaCl solution, 8mL 13.5mM KCl solution and 0.4mL 1% Triton X-100 solution in a 50mL centrifuge tube, adjust pH to 8, and add DEPC water to make up to 40mL.

[0051] 5×Binding Buffer: weigh NaCl, MgCl 2 , KCl was prepared into 1M, 0.1M, and 0.5M solutions with DEPC water, and 10mL 1M Tris-HCl, 20mL 1M NaCl, and 2mL 0.1MMgCl were added to a 50mL centrifuge tube in sequence. 2 , 2mL 0.5M KCl, adjust pH to 8, add DEPC water to make up to 40mL. 1×Binding Buffer is diluted from 5×Binding Buffer.

[0052] 5×MST Buffer: weigh NaCl, MgCl 2 , KCl was prepared into 1M, 0.1M, and 0.5M solutions with DEPC water, and 10mL 1M Tris-HCl, 20mL 1M NaCl, and 2mL 0.1M MgCl were added to a 50mL centrifuge tube in sequence. 2, 2 mL 0.5 M KCl and 2 mL 5% Tween-20, adjust pH to 8, add DEPC water to make up to 40 mL. 1×MST Buffer is obtained by diluting 5×MST Buffer.

[0053] 5×Mg-free 2+ Buffer: Add 4 mL 1M NaCl and 2 mL 1M Tris-HCl to a 50 mL centrifuge tube, and add DEPC water to 40 mL. 2+ Made of 5× Mg-free 2+ Diluted.

[0054] Preparation of single-stranded library and primer solution: Centrifuge the library and primer freeze-dried powder at 5000 rpm for 1 min, add the corresponding amount of DEPC water according to the labeled volume to prepare a 100 μM solution.

[0055] (3) Conjugation of α-synuclein aggregates (ab218817) and α-synuclein monomers (ab51189)

[0056] Take 100μL carboxyl magnetic beads in an EP tube, centrifuge, and remove the supernatant by magnetic separation. Add 200μL 1×Binding Buffer to the EP tube, wash the magnetic beads, centrifuge, remove the supernatant by magnetic separation, and repeat the washing twice. After washing, add 60μL of 1×MES Buffer to the EP tube, and then add 20μL of freshly prepared EDC and NHS solutions respectively, and activate for 15min. After activation, centrifuge, remove the supernatant by magnetic separation, add 100μL of prepared ab218817 or ab51189 solution (50μg protein) to the EP tube, incubate at room temperature for 4h, and fix the protein to the surface of the carboxyl magnetic beads. After fixation, discard the supernatant by magnetic separation, add 200μL TBS to block for 0.5h, and then store the magnetic beads at 4℃ for use.

[0057] (4) Reverse screening

[0058] Take 10μL of 100μM nucleic acid aptamer library and mix it in 90μL 1×Binding Buffer, heat it at 95℃ for 5min, and then quickly cool it in an ice water bath for 10min to keep the library in a single-stranded structure. Take 40μL of the prepared magnetic bead-coupled ab51189 solution (10μg ab51189) in an EP tube, centrifuge, magnetically separate and discard the supernatant, wash twice with 100μL 1×Binding Buffer, add the annealed library (2μL needs to be sampled for running) and mix it with the magnetic beads modified with the target protein, and incubate it at room temperature for 1h. After the incubation, magnetically separate and recover the supernatant in the EP tube, which is used as the initial library for positive screening.

[0059] (5) Positive screening

[0060] Take 40 μL of magnetic bead-coupled ab218817 solution (10 μg ab218817) in an EP tube, centrifuge, magnetically separate and discard the supernatant, then use 100 μL 1× Wash twice with Binding Buffer, add the library after counter screening (2 μL sample is needed for gel running), and incubate at room temperature for 2 hours. After incubation, magnetic separation is performed and the supernatant is discarded (2 μL sample is needed for gel running), and 100 μL 1× The DNA was washed with Binding Buffer to remove non-specifically bound single-stranded libraries, and finally resuspended in 50 μL of DEPC water for later use.

[0061] (6) Optimization of PCR amplification conditions

[0062] A negative control (-) group (2.5 μL 10 μM FP; 2.5 μL 10 μM RP; 2.5 μL blank magnetic beads; 12.5 μL 2×Taq Pro HS Master Mix; 5 μL ddw (double distilled water)) and a sample (S) group (2.5 μL 4 μM FP; 2.5 μL 4 μM RP; 2.5 μL washed magnetic beads-protein-ssDNA complex; 12.5 μL 2×Taq Pro HS Master Mix; 5 μL ddw) were set up. According to the conditions of 95°C pre-denaturation for 30 s, 95°C denaturation for 30 s, 53°C annealing for 30 s, and 72°C extension for 45 s, 9, 11, 13, and 15 rounds of amplification were performed respectively. The samples in each round were subjected to 2% agarose gel electrophoresis, and the brightness of the bands was observed to determine the optimal number of amplification rounds.

[0063] (7) PCR amplification

[0064] Prepare 10μL 10μM FP; 10μL 10μM Bio-RP; 10μL washed magnetic beads-protein-ssDNA complex; 50μL 2×Taq Pro HS Master Mix; 20μL ddw PCR solution system, and amplify according to the optimized conditions. Then use this as a template to prepare 100μL 10μM FP; 100μL 10μM Bio-RP; 500μL 2×Taq Pro HS MasterMix; 200μL ddw PCR solution system, divide it into 10 PCR tubes, and continue amplification for 10 rounds.

[0065] (8) Preparation of ssDNA

[0066] Take 250 μL of sterile water into the chromatography column, add 200 μL of streptavidin agarose microspheres, let stand for 5-10 minutes, and then use 1× Mg-free 2+Buffer was washed 5 times, the amplified double-stranded was added to the chromatography column for separation, the separated liquid was added to the chromatography column again, repeated 4 times, and then washed with 250 μL 1× Mg-free 2+ The supernatant was collected and rinsed with 100 μL NaOH. HCl was added to adjust the pH to neutral, and the supernatant was concentrated to 100 μL by ultrafiltration. The concentration was determined by Nano Drop-100 and stored at -20°C as the library for the next round of screening.

[0067] (9) Gel electrophoresis monitoring and screening process

[0068] Prepare a denaturing gel with a mass volume concentration of 10%, add 2 μL of supernatant before and after screening to 18 μL of denatured DNA Loading Buffer, add 10 μL to the gel loading well, run the gel at 80 V for 30 min, stain and image, perform semi-quantitative analysis on the grayscale values ​​of the bands before and after screening, and calculate the binding ratio by (1-grayscale value after screening / grayscale value before screening)*100%. The electrophoresis results are shown in Figure 1 As shown, as the screening progresses, nucleic acid aptamers binding to ab218817 are gradually enriched.

[0069] (10) High-throughput analysis of enriched libraries

[0070] See also Figure 2 , during the entire screening process, starting from the 6th round, the library was reversely screened, and the counter-screening object was ab51189. The 8th round library showed that the enrichment rate of the library was further improved. In this study, high-throughput sequencing was performed on the 8th and 13th round enriched libraries to determine the candidate nucleic acid aptamer sequences. The results of high-throughput sequencing showed that the total number of sequences in the 8th and 13th round libraries were 125,263 and 155,375, respectively, containing 116,623 and 23,002 unique sequences respectively. The total number of sequences in the two rounds of libraries was similar, but the sequence richness of the 13th round library was greatly reduced, confirming that reverse screening promoted the directional enrichment of the library. The data from high-throughput sequencing showed that the 13th round enriched library was a highly enriched library, and there was no need to continue screening on this library. Therefore, we compared the repeatability of the sequencing results of the 8th and 13th rounds, such as Figure 3 As shown, C99 and C125 with an enrichment factor of about 100, as well as C1 and C5 sequences with a high proportion in the 8th and 13th rounds were selected as candidate sequences, and their secondary structures were simulated, as shown in Figure 4A-4D shown.

[0071] In this example, nucleic acid aptamer sequences were screened by exponential enrichment ligand systemic evolution (SELEX), specifically using ab218817 as a positive screening target and ab51189 as a counter-screening target. After multiple rounds of repeated incubation, elution, and amplification, multiple nucleic acid aptamer sequences were screened. By performing sequence alignment and homology analysis on these nucleic acid aptamer sequences, four candidate nucleic acid aptamer sequences, C99, C125, C1, and C5, were determined and their specificity and affinity were verified.

[0072] The nucleotide sequence of the nucleic acid aptamer C125 is shown in SEQ ID NO. 1: 5'-ATCCAGAGTGACGCAGCACGAGACCCTTCTTTTCCTTTTGCTTCTTTTCC CTCCTCCCTGGACACGGTGGCTTAGT-3'.

[0073] Specificity and affinity validation:

[0074] 1) Microthermophoresis technique was used to determine the binding ability of candidate nucleic acid aptamers to ab218817 and ab51189

[0075] Dilute ab218817 solution (0.5μg / μL) from about 18.5μM to 1μM, take 16 PCR tubes, number them 1-16, add 4μL 1μM ab218817 solution, 4μL 5×MST Buffer, and 12μL DEPC water to tube 1, add 10μL 1×MST Buffer to PCR tubes 2-16, mix the ab218817 in tube 1, and take 10μL from PCR tubes 2 to 16 for gradient dilution. Prepare 180μL 20nM FAM-C125-1 solution (3.6μL 1μM FAM-C125-1, 36μL 5×MST Buffer, 140.4μL DEPC water), denature at 95℃ for 10min, mix in ice water bath for 5min, add 10μL to PCR tubes numbered 1-16 respectively, incubate at room temperature for 1h, test at detection temperature of 25℃, medium MST energy, and scan three times continuously after the scan is completed. Data analysis was performed using MO.Affinity Analysis software, and dissociation constants were obtained by fitting. The binding capacity of C1, C5, C125, TSO508 and ab218817 was measured on the MST instrument, and the binding capacity of C1, C5, C125, TSO508 and ab51189 was tested in the same way as above. Since the structures of C99 and C125 are similar, only C125 was tested. The sequence TSO508 reported in the literature was used as a control. The test results are shown in the figure. Figure 5 As shown in Table 1:

[0076] Table 1. Equilibrium dissociation constants K of different candidate aptamers D

[0077] <![CDATA[K D ]]> C1 C5 C125 TSO508 ab218817 115.51±10.96pM 62.14±16.07pM 54.78±8.44pM 106.17±20.74pM ab51189 92.23±8.21pM 175.78±10.12pM 235.19pM 118.52±35.74pM

[0078] Combination Figure 5 According to the data in Table 1, TSO508 and C1 sequences have no obvious ability to distinguish ab218817 from ab51189, C5 has a 3-fold difference in the ability to distinguish ab218817 from ab51189, and C125 has a 5-fold difference in the ability to distinguish ab218817 from ab51189. Therefore, C125 is the sequence with the strongest ability to distinguish among the four potential sequences.

[0079] 2) Biolayer interferometry (BLI) was used to determine the binding ability of nucleic acid aptamers to ab218817 and ab51189

[0080] By performing sequence alignment, homology analysis and MST test on the candidate nucleic acid aptamer sequences, C125 was determined to be the optimal sequence. C125 was trimmed and mutated to obtain the truncated aptamers C125-40 (SEQ ID NO.5, 5'-CGAGACCCTTCTTTTCCTTTTGCTTCTTTTCCCTCCTCCC-3') and C125-M (SEQ ID NO.6, 5'-AGCCACCGTGTCCAGCACGAGACCCTTCTTTTCCTTTTGCTTCTTTTCCC TCCTCCCTGGACACGGTGGCTTAGT-3'). The secondary structures of C125-40 and C125-M are as follows: Figure 6 As shown in panels a and b, the biolayer interferometry (BLI) technique was used to determine the differences in the binding abilities of nucleic acid aptamers C125, C125-40, C125-M with ab218817 and ab51189.

[0081] (1) Sensor pre-wetting and pre-treatment of biotin-labeled aptamers, ab218817, and ab51189 The buffer used for BLI testing is the same as that used for MST testing, both of which are 1×MST Buffer. Before testing, the streptavidin (SA) sensor needs to be soaked in 1×MST Buffer for at least 10 min. The aptamers, ab218817, and ab51189 with biotin labeled at the 5' end are diluted to 0.5 μM using MST Buffer and placed in the environment of 1×MST Buffer. The diluted aptamers are denatured at 95°C for 10 min, mixed in ice water for 5 min, and placed at room temperature for 5 min before use.

[0082] (2) Immobilization of biotin-labeled aptamers

[0083] According to the corresponding positions of the sensors, 200 μL of 1×MST Buffer and pre-treated biotin-labeled aptamer solution were added to a new 96-well black plate, and solidified according to the following procedures: Baseline 1 (120 s); Loading (300 s); Baseline 2 (100 s).

[0084] (3) Test of the binding ability of nucleic acid aptamers with ab218817 and ab51189

[0085] The pretreated ab218817 and ab51189 were prepared into a 200nM solution containing 1×MST Buffer, and then serially diluted with 1×MST Buffer in the range of 200-3.25nM. Then, 200μL of 1×MST Buffer and the diluted ab218817 and ab51189 solutions of various concentrations were added to a new 96-well black plate according to the corresponding positions of the sensors. The following program was set: Baseline 1 (120s); Baseline 2 (100s); Association (120s); Dissociation (120s) for ab218817 and ab51189 at various concentrations, and the temperature was 25°C. The test results were analyzed using ForteBio Data analysis 11.0 software, and the results are shown in Figure 2. Figure 7A-7C As shown in Table 2.

[0086] Table 2. Equilibrium dissociation constants K of C125 and its truncated aptamers C125-40 and C125-M D

[0087] <![CDATA[K D ]]> C125 C125-40 C125-M ab218817 4.3±0.76nM 27±6.3nM 12±3.7nM ab51189 51±10nM 5.9±0.76nM 59±21nM

[0088] Combination Figure 7A-7C According to the data results in Table 2, the binding dissociation constants KD values ​​of C125 for ab218817 and ab51189 are 4.3±0.76nM and 51±10nM, respectively, which can significantly distinguish the two proteins; in comparison, the binding equilibrium constants of C125-40 and C125-M with ab218817 and ab51189 are less different.

[0089] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to α-synuclein aggregates, characterized in that: It includes nucleic acid aptamer C125, and the nucleotide sequence of C125 is shown as SEQ ID NO.

1.

2. The nucleic acid aptamer that specifically binds to α-synuclein aggregates according to claim 1, characterized in that: Also includes any of the following sequences: 1) A nucleotide sequence with a homology of more than 80% with the nucleic acid aptamer C125 and capable of specifically binding to α-synuclein aggregates; 2) a nucleotide sequence that hybridizes with the nucleotide sequence of the nucleic acid aptamer C125 and can specifically bind to α-synuclein aggregates; 3) RNA sequence reverse transcribed from the nucleotide sequence of nucleic acid aptamer C125.

3. The nucleic acid aptamer that specifically binds to α-synuclein aggregates according to claim 1, characterized in that: The nucleotide sequence includes a nucleotide sequence obtained by modifying the nucleotide sequence of the nucleic acid aptamer C125 by phosphate backbone, truncation, extension, transversion or chemical modification of the base; or a nucleotide sequence obtained by labeling the 5' end or 3' end of the nucleic acid aptamer C125 with a marker.

4. The nucleic acid aptamer that specifically binds to α-synuclein aggregates according to claim 3, characterized in that: The marker refers to a biotin marker, a digoxigenin marker, a fluorescent marker, a nanoluminescent material marker or an enzyme marker.

5. Use of the nucleic acid aptamer specifically binding to α-synuclein aggregates according to any one of claims 1 to 4 in the preparation of diagnostic reagents, test strips or biosensors for Parkinson's disease, Lewy body dementia and multiple system atrophy.

6. Use of the nucleic acid aptamer specifically binding to α-synuclein aggregates according to any one of claims 1 to 4 in the preparation of a drug for treating Parkinson's disease, Lewy body dementia and multiple system atrophy.

7. Use of the nucleic acid aptamer specifically binding to α-synuclein aggregates according to any one of claims 1 to 4 in the preparation of drugs for diagnosing Parkinson's disease, Lewy body dementia and multiple system atrophy.

8. A diagnostic reagent, test strip or biosensor for Parkinson's disease, Lewy body dementia and multiple system atrophy, characterized in that: The active ingredient of a diagnostic reagent, a test paper or a component of a biosensor comprises the nucleic acid aptamer specifically binding to α-synuclein aggregates according to any one of claims 1 to 4.

9. A drug for treating Parkinson's disease, Lewy body dementia and multiple system atrophy, characterized in that: The active ingredient of the drug comprises the nucleic acid aptamer specifically binding to α-synuclein aggregates according to any one of claims 1 to 4.

10. A drug for diagnosing Parkinson's disease, Lewy body dementia and multiple system atrophy, characterized in that: The active ingredient of the drug comprises the nucleic acid aptamer specifically binding to α-synuclein aggregates according to any one of claims 1 to 4.

Images