Rice LOCOs02g57520 gene and application thereof in regulation and control of male sterility of rice

Abstract

The invention discloses a rice LOCOs02g57520 gene and an application of the rice LOCOs02g57520 gene in regulation and control of male sterility of rice. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1. According to the invention, after the LOCOs02g57520 gene is edited by adopting a CRISPR / Cas9 gene editing technology, the expressed rice plant is male sterility, and the expression property is stable and reliable. Therefore, the gene has a crucial regulation function in pollen and can provide a gene resource for cultivation of a rice male sterile line.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a rice LOC_Os02g57520 gene and an application thereof in regulating rice male sterility. Background Art

[0002] Rice is the main food crop in my country, and my country's research on hybrid rice has always been in the leading position internationally. Three-line hybrid breeding of rice using hybrid vigor is an important way to increase rice yield. Three-line hybrid breeding includes restorer lines, maintainer lines and sterile lines, among which sterile lines are male sterile rice. The exploration and utilization of male sterile germplasm resources are crucial for hybrid breeding. Therefore, the research on rice male sterile genes is conducive to the expansion of sterile line germplasm resources.

[0003] Genes that affect rice male sterility can be divided into two categories according to the period of their action. One category is genes related to meiosis, anther tapetum degradation and pollen wall formation during pollen development, and the other category is genes related to pollen grain hydration germination and pollen tube elongation. The LOC_Os02g57520 gene encodes an AT-hook DNA binding protein, namely PERSISTENT TAPETAL CELL2, with the gene symbol PTC2. As a transcription factor, PTC2 plays an important role in regulating the programmed cell death of tapetum cells and the establishment of pollen wall development patterns. The ptc2 mutant exhibits delayed tapetum cell degradation, abnormal pollen outer wall development, no outer wall inner layer, and columnar layer collapse, which ultimately leads to complete male sterility. Summary of the invention

[0004] The present invention provides a rice LOC_Os02g57520 gene and an application thereof in regulating rice male sterility, and a method for obtaining a male sterile line by site-directed mutation of the LOC_Os02g57520 gene using genome editing technology, thereby shortening the breeding cycle and providing a new rice male sterile line.

[0005] The present invention is achieved through the following technical solutions:

[0006] The nucleotide sequence of the LOC_Os02g57520 gene that regulates rice male sterility is shown in SEQ ID NO.1.

[0007] The expression vector or cloning vector of the present invention comprises the nucleotide sequence of SEQ ID NO.1.

[0008] An engineered bacterium containing gene LOC_Os02g57520, or containing the expression vector or cloning vector described in the present invention.

[0009] The application of LOC_Os02g57520 gene in rice genetic engineering breeding, specifically: the application of LOC_Os02g57520 gene in regulating rice male sterility.

[0010] The method for preparing male sterile rice using the LOC_Os02g57520 gene is mainly achieved by site-specific editing of the LOC_Os02g57520 coding gene using the CRISPR-Cas9 gene editing system. The specific operation method includes the following steps:

[0011] (1) using the CRISPR / Cas9 system, selecting target sites according to the LOC_Os02g57520 gene; the target sites are Target1 and Target2;

[0012] The DNA sequence of Target1 is: GACGAGAACAACGAATCCGGCGG;

[0013] The DNA sequence of Target1 is: CGAGAACTGCGCGATGGCGTCGG;

[0014] (2) constructing a CRISPR / Cas9 recombinant vector containing the target site sequence fragment; first using BsaI to digest the original vector WMC025 to obtain a linearized vector; then using primers LOC_Os02g57520-CZF and LOC_Os02g57520-CZR to perform PCR amplification on the T vector WMZ006 to obtain a purified PCR product; then recombining the obtained linearized vector backbone and the purified PCR product to obtain a complete target CRISPR / Cas9 recombinant vector;

[0015] The DNA sequence of the primer LOC_Os02g57520-CZF is:

[0016] CGCGCTGTCGCTTGTGTGACGAGAACAACGAATCCGGGTTTTAGAGCTAGAAAT; the DNA sequence of the primer LOC_Os02g57520-CZR is:

[0017] CTATTTCTAGCTCTAAAACACGCCATCGCGCAGTTCTCCGCCACGGATCATCTGCA;

[0018] (3) using Agrobacterium-mediated technology to introduce the obtained CRISPR / Cas9 recombinant vector into rice callus to obtain transgenic seedlings;

[0019] (4) Screening positive plants among transgenic seedlings; extracting DNA from young leaves of plants, amplifying by PCR using primers HYG-4F and HYG-4R, and performing electrophoresis detection; plants with electrophoresis bands are positive plants;

[0020] The sequence of HYG-4F is: CGACAGCGTCTCCGACCTGAT;

[0021] The HYG-4R sequence is: ATGTTGGCGACCTCGTATTGG;

[0022] (5) The DNA of the transgenic positive plants is identified, and the DNA of the young leaves of the positive plants is extracted. The editing sites are amplified by PCR to obtain amplified products; the amplified products are sequenced, and homozygous mutants with loss-of-function mutations at any target site are selected as mutant plants.

[0023] The primers used for PCR amplification in step (5) are LOC_Os02g57520-A1-F2, LOC_Os02g57520-A1-R2; LOC_Os02g57520-A2-F2; LOC_Os02g57520-A2-R2;

[0024] The LOC_Os02g57520-A1-F2 sequence is: TGCATGCAGCAATCTCCTTT;

[0025] The sequence of LOC_Os02g57520-A1-R2 is: GAGGGAGAGGATCTCGAAGC;

[0026] The LOC_Os02g57520-A2-F2 sequence is: CCGAAGCCGCCCATCTTC;

[0027] The sequence of LOC_Os02g57520-A2-R2 is: GAGGAAGGTGCCGGTGAG.

[0028] Compared with the prior art, the advantages and beneficial effects of the present invention are:

[0029] 1. The present invention provides a method for obtaining a male sterile line by site-directed mutation of the rice LOC_Os02g57520 gene using CRISPR / Cas9 gene editing technology, and provides positive plant sequence detection and identification primers LOC_Os02g57520-A1-F2, LOC_Os02g57520-A1-R2; LOC_Os02g57520-A2-F2; LOC_Os02g57520-A2-R2. The feasibility and accuracy of the method of the present invention are mutually confirmed by electrophoresis detection and sequence detection and identification. The method is not only simple to operate and efficient, but also highly accurate, stable and reliable in results, and significantly shortens the breeding cycle.

[0030] 3. The male sterile rice selected by the present invention does not contain pollen grains, which has obvious effects and can effectively reduce the workload of emasculation during breeding. The present invention can provide a new gene resource for the cultivation of rice male sterile lines, and also supplement the male sterility regulation mechanism, which is of great significance to the development of rice hybrid breeding technology, showing unique innovation and significant application advantages.

[0031] 4. The present invention is environmentally friendly and biosafe. Compared with traditional chemical or physical mutagenesis methods, the present invention does not introduce exogenous genes, avoids potential ecological risks, and is more in line with the requirements of sustainable development of modern agriculture.

[0032] 5. The present invention is controllable and specific. The technology can precisely modify specific gene loci without affecting the normal expression of other genes, thereby achieving fine regulation of rice male sterility traits. This high degree of gene editing accuracy not only improves breeding efficiency, but also reduces unnecessary genetic variation, providing strong technical support for the cultivation of high-yield, high-quality, and stress-resistant new rice varieties, demonstrating the innovation and practicality of the present invention in the field of crop genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the structure diagram of the LOC_Os02g57520 gene and the target point mutation status of gene knockout positive plants.

[0034] Figure 2 This is the physical map of the gene editing vector and the schematic diagram of the recombination.

[0035] Figure 3 This is the electrophoresis gel image of the target gene clone, where 1-2: gene LOC_Os02g57520 target site amplification WMZ006 product 586bp; M: DNA marker (2000). Figure 4 This is the physical map of the gene editing vector and the schematic diagram of the recombination.

[0036] Figure 5 It is the electrophoresis diagram of colony PCR, where 1-24: single colony was selected to verify the recombinant plasmid 1092bp of LOC_Os02g57520 gene; M: DNA marker (2000).

[0037] Figure 6 This is a diagram of callus induction culture.

[0038] Figure 7 This is a diagram of rooting culture.

[0039] Figure 8 Electrophoresis diagram of positive plant detection, where 1-24: positively detected seedlings; positive: positive control obtained by amplifying the plasmid.

[0040] Fig. 9 This is the peak diagram of the sequencing of the editing target.

[0041] Fig.10 This is a comparison of anther morphology between the editing group and the control group, with the control group on the left and the editing group on the right.

[0042] Fig.11 This is a comparison of rice ear morphology between the editing group and the control group. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below by way of examples. These examples are only used to illustrate the present invention and do not limit the protection scope of the present invention.

[0044] Example

[0045] 1 Materials and methods

[0046] 1.1 Test materials

[0047] Rice varieties, strains, vector systems, enzymes, and reagents tested.

[0048] Escherichia coli DH5α competent cells and Agrobacterium tumefaciens EHA105 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.;

[0049] BSaⅠ enzyme and other enzymes and various test kits were purchased from Nanjing Novozyme Biotechnology Co., Ltd. (China);

[0050] Vector WMC025, T vector WMZ006, and transformation receptor Zhonghua 11-wimi-japonica rice were provided by Weimi Biotechnology (Hainan) Co., Ltd., and other materials were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. and other companies.

[0051] 1.2 Gene sequence acquisition

[0052] Gene cloning primers

[0053] In the present invention, the primers QC1-F, QC4-R, HYG-F1, and HYG-R1 are provided by Weimi Biotechnology (Hainan) Co., Ltd. and are the fixed detection primers for the vector WMC025.

[0054] Table 1 List of PCR amplification primers

[0055]

[0056] 1.3 Target selection and sgRNA design analysis

[0057] Gene target primers

[0058] Target design principles: 1) The knockout site is in the coding (CDS) region and preferably at the front end of the protein or in an important functional domain region; 2) Try to cover a higher proportion of transcripts; 3) There is no off-target or the off-target is located in the intergenic region; 4) Preferentially select targets with higher editing efficiency; 5) The sequence has a relatively balanced GC content and is not prone to forming secondary structures.

[0059] Based on the above principles, the CRISPR-P website ( http: / / crispr.hzau.edu.cn / CRISPR2 / ) was used for design, and targets with high target scores, low off-target rates, and appropriate positions were selected. For the LOC_Os02g57520 gene, two targets, GACGAGAACAACGAATCCGGCGG and CGAGAACTGCGCGATGGCGTCGG, were selected. Their positions are靠前 (at 109-131bp and 296-318bp of this gene respectively), with low repeatability and off-target rates (the highest off-target rates of the targets are 0.267 and 0.213 respectively) on the genome of Zhonghua 11-wimi-japonica rice, and moderate GC content, which are suitable as gene knockout targets. The specific target positions and partial mutations are as shown in Figure 1 shown.

[0060] Sequence NO.1 of LOC_Os02g57520:

[0061]

[0062] 1.4 CRISPR / Cas9 vector construction

[0063] (1) Vector construction primers

[0064] WMC025 contains the lethal gene CCDB, and adding CCDB to the vector can avoid insufficient enzyme digestion that leads to a large amount of uncut plasmid being transferred into E. coli. A linearized vector can be obtained after digestion with BSaⅠ enzyme.

[0065] Table 2 Vector backbone enzyme digestion system

[0066]

[0067] After enzyme digestion at 37°C according to the system in Table 2, the stock solution was directly recovered using the DC 301 PCR gel recovery kit, and finally 40 μl EB elution solution was added to obtain the linearized vector, such as Figure 2 shown.

[0068] LOC_Os02g57520-CZF and LOC_Os02g57520-CZR were used as primers to amplify T vector WMZ006 to obtain the target gene. The amplification system is shown in Table 3.

[0069] Table 3 PCR amplification system

[0070]

[0071]

[0072] The PCR amplification was performed with this system, with a pre-denaturation at 95°C for 3 minutes; then a denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for a total of 30 cycles, and a final extension at 72°C for 5 minutes, and finally slowly cooled to 16°C to obtain the target fragment. After the reaction was completed, 5 μl of the PCR product was taken for agarose gel electrophoresis, and a band of 586 bp was obtained, such as Figure 3 Then, the stock solution was directly recovered using the DC 301 PCR gel recovery kit to obtain the purified PCR product.

[0073] The linearized vector backbone obtained above and the purified PCR product were recombined. The recombinant system is shown in Table 4. The recombinant process is as follows: Figure 4 shown.

[0074] Table 4 Vector recombination system

[0075]

[0076] The above system was placed at 50°C for 15 minutes; then cooled to 4°C for several minutes to form two tandem promoter-target-grna expression cassettes, thereby obtaining a complete target vector, which was then transformed with DH5α E. coli competent cells and cultured at 37°C until the next day. The next day, the obtained E. coli bacterial plate was tested for bacteria, and QC1-F / QC4-R was used as primers, and the selected 24 monoclonal clones were used as templates to amplify 20 μl of the system. The 1092 bp band was obtained as the correct plaque. The colony PCR electrophoresis diagram is shown in the figure below. Figure 5 As shown, the successful construction of the target site can be confirmed by Sanger sequencing of the plaque.

[0077] Figure 5 Zhong 1-24: LOC_Os02g57520 gene single colony selection verification recombinant plasmid 1092bp; M: DNA marker (2000), by Figure 5 It can be seen that the bands numbered 1-24 are relatively bright and clear, indicating the accuracy of the detection.

[0078] The correct plaques were propagated, and after the plasmid was extracted using a plasmid extraction kit, Agrobacterium was transformed using EHA05 competent cells and cultured at 28°C for 2 days.

[0079] 1.5 Genetic transformation

[0080] (1) Agrobacterium infection

[0081] Prepare the infection solution, use a pipette to absorb the infection solution to wash off the Agrobacterium on the plate, and obtain the Agrobacterium suspension for co-cultivation and transformation of rice.

[0082] Select a sufficient amount of callus tissue (in good condition, bright yellow in color, round and hard in texture, and preferably with a particle diameter of about 3mm), place it in a 100ml sterile conical flask, add an appropriate amount of Agrobacterium suspension (make sure there is enough bacterial liquid in contact with the material), and place it at room temperature for infection for 20 minutes, shaking it from time to time. Pour out the bacterial liquid, place the callus tissue on a sterile filter paper to absorb the excess bacterial liquid, and then transfer it to a solid co-culture medium covered with a layer of sterile filter paper, and culture it in the dark at 26℃ for 3 days. Figure 6 shown.

[0083] (2) Screening

[0084] After 3 days of co-culture, the callus tissue needs to be cleaned. Use a 1ml blue pipette tip to sow the callus on the co-culture medium into a sterilized triangular flask, add sterile water to rinse both sides, and rinse once with sterile water containing 500ul / L carbenicillin for the third time. After the excess water is sucked off by the pipette, the callus is transferred to sterile filter paper and the water on the callus is blown dry by the wind of the clean bench. The blowing time is controlled at about 30 minutes. After the callus is blown dry, it is transferred to the screening medium for screening culture. The culture conditions are 28-30 degrees and dark culture. The screening time is 3-4 weeks.

[0085] (3) Differentiation

[0086] After one month of screening, bright yellow positive callus can be seen growing. At this time, the positive callus can be picked and placed on the differentiation medium for differentiation and regeneration. 16 positive callus are placed on each differentiation dish and placed in a 28-30 degree greenhouse for light culture. Green spots will emerge from the callus in about 10 days, and seedlings will differentiate after about 10 days.

[0087] (4) Rooting

[0088] When the differentiated seedlings grow to about 2-3cm and have obvious roots, they can be transferred to the rooting medium to grow. The rooting medium should be poured into a relatively high bottle or tube, such as Figure 7 As shown, the seedlings will have enough space to grow taller after rooting. The rooting culture conditions are 28-30 degrees and sterile light culture.

[0089] 1.6 Editing plant identification

[0090] About 1 cm of young leaves were cut from the selected seedlings, and DNA was extracted using the CTAB method. The DNA samples were amplified using HYG-4F / HYG-4R. The electrophoresis band of 639 bp obtained by electrophoresis at a power of 180 V was a positive seedling, and the product amplified using the plasmid as a template was the positive control.

[0091] Table 5 Positive detection amplification system

[0092]

[0093] The PCR amplification was performed with this system, with a pre-denaturation at 95°C for 3 minutes; then a cycle of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C, for a total of 30 cycles, with a final extension at 72°C for 5 minutes, and finally slowly cooling to 16°C to obtain the target fragment. The electrophoresis results are as follows Figure 8 shown.

[0094] Figure 8 In the electrophoresis diagram of positive plant detection, 1-24 are all positive test seedlings, and positive is the positive control obtained by amplifying the plasmid, which is used as the criterion for judging whether the plasmid has been transferred into the plant. Figure 8 It can be seen that the seedlings No. 1-24 used for detection all showed positive results, indicating that the method of the present invention is accurate in detection and has stable results.

[0095] Then, the DNA extracted from the CTAB was used as a template, LOC_Os02g57520-A1-F2 / LOC_Os02g57520-A1-R2 and LOC_Os02g57520-A2-F2 / LOC_Os02g57520-A2-R2 were used as primers, and the 20 μl system was amplified according to the TD5 program. The amplified product was sent to a sequencing company for sequencing to obtain the sequencing peak map of the editing target site to determine the editing status of the plant gene target site. Fig. 9 shown.

[0096] Table 6 TD5 amplification program

[0097]

[0098] According to the results of Sanger sequencing, editing occurred at the SG1 / SG2 site, proving that the target site was effective. A single peak indicates that the gene mutated to a homozygous mutation at the target site (i.e., the same mutation occurred at the same site on both chromosomes), and a double peak indicates that the gene mutated to a heterozygous mutation at the site (i.e., different mutations occurred at the same site on both chromosomes or only one chromosome mutated at the site).

[0099] Fig. 9 Only the sequenced part is shown. A total of 11 plants were tested, among which in plant A, Fig. 9 -A, a 176 bp homozygous deletion occurred between SG1 and SG2, and the offspring were stable homozygous for the fragment deletion; in plant B, as shown in Fig. 9 -B1, Fig. 9 -B2 shows that a 73bp homozygous fragment was deleted in SG1 and a single base T thymine was inserted in SG2, and the offspring were also stable homozygous.

[0100] 1.7 Comparison between edited plants and normal plants

[0101] (1) Comparison of rice anther morphology

[0102] The positive rice plants obtained in 1.6 (edited group) and the rice plants not edited (control group) were cultivated under the same conditions, and the pollen conditions of the two groups of plants were observed when they bloomed. Fig.10 .

[0103] from Fig.10It can be seen that the anthers of the control group on the left are very full and light yellow. The one on the right is the edited plant obtained by the method of the present invention, whose anthers and pollen are abnormally developed, appearing white and shriveled. After testing, it was found that there was no pollen inside, and a male sterile plant was obtained, indicating that the LOC_Os02g57520 gene has the function and role of regulating rice male sterility.

[0104] (2) Comparison of rice ear morphology

[0105] The positive rice plants obtained in 1.6 (edited group) and the rice plants not treated with editing (control group) were cultivated under the same conditions, and the rice ears of the two groups of rice plants were observed when they were ripe. Fig.11 .

[0106] Fig.11 The left side is the wild-type control plant, and the right side is the edited plant. Fig.11 It can be seen that there is no obvious difference in the ear shape between the two, but the ears of the edited plants are shriveled, the spikelets cannot bear fruit normally, and are completely sterile.

[0107] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. The LOC_Os02g57520 gene for regulating rice male sterility is characterized by: The nucleotide sequence of the gene LOC_Os02g57520 is shown in SEQ ID NO.

1.

2. An expression vector or cloning vector, characterized in that: It comprises the nucleotide sequence as claimed in claim 1.

3. An engineered bacterium containing the gene LOC_Os02g57520 described in claim 1, or the expression vector or cloning vector described in claim 2.

4. Use of the LOC_Os02g57520 gene according to claim 1 in rice genetic engineering breeding.

5. Use of the LOC_Os02g57520 gene according to claim 1 in regulating rice male sterility.

6. A method for preparing male sterile rice using the LOC_Os02g57520 gene according to claim 1, characterized in that: The LOC_Os02g57520 encoding gene was edited at the site using the CRISPR-Cas9 gene editing system.

7. The method for preparing male sterile rice using LOC_Os02g57520 gene according to claim 6, characterized in that: The following steps are involved: (1) using the CRISPR / Cas9 system, selecting target sites according to the LOC_Os02g57520 gene; the target sites are Target1 and Target2; The DNA sequence of Target1 is: GACGAGAACAACGAATCCGGCGG; The DNA sequence of Target2 is: CGAGAACTGCGCGATGGCGTCGG; (2) constructing a CRISPR / Cas9 recombinant vector containing the target site sequence fragment; first using BsaI to digest the original vector WMC025 to obtain a linearized vector; then using primers LOC_Os02g57520-CZF and LOC_Os02g57520-CZR to perform PCR amplification on the T vector WMZ006 to obtain a purified PCR product; then recombining the obtained linearized vector backbone and the purified PCR product to obtain a complete target CRISPR / Cas9 recombinant vector; The DNA sequence of the primer LOC_Os02g57520-CZF is: CGCGCTGTCGCTTGTGTGACGAGAACAACGAATCCGGGTTTTAGAGCTAGAAAT; the DNA sequence of the primer LOC_Os02g57520-CZR is: CTATTTCTAGCTCTAAAACACGCCATCGCGCAGTTCTCCGCCACGGATCATCTGCA; (3) using Agrobacterium-mediated technology to introduce the obtained CRISPR / Cas9 recombinant vector into rice callus to obtain transgenic seedlings; (4) Screening positive plants among transgenic seedlings; extracting DNA from young leaves of plants, amplifying by PCR using primers HYG-4F and HYG-4R, and performing electrophoresis detection; plants with electrophoresis bands are positive plants; The sequence of HYG-4F is: CGACAGCGTCTCCGACCTGAT; The HYG-4R sequence is: ATGTTGGCGACCTCGTATTGG; (5) DNA of transgenic positive plants is identified, DNA of young leaves of positive plants is extracted, and PCR amplification of the editing site is performed to obtain the amplified product; The amplified products were sequenced, and homozygous mutants with loss-of-function mutations at any target site were selected as mutant plants.

8. The method for preparing male sterile rice using LOC_Os02g57520 gene according to claim 7, characterized in that: The primer used for PCR amplification in step (5) is LOC_Os02g57520-A1-F2, LOC_Os02g57520-A1-R2; LOC_Os02g57520-A2-F2; LOC_Os02g57520-A2-R2; The LOC_Os02g57520-A1-F2 sequence is: TGCATGCAGCAATCTCCTTT; The sequence of LOC_Os02g57520-A1-R2 is: GAGGGAGAGGATCTCGAAGC; The LOC_Os02g57520-A2-F2 sequence is: CCGAAGCCGCCCATCTTC; The sequence of LOC_Os02g57520-A2-R2 is: GAGGAAGGTGCCGGTGAG.

Images