Double-expression protein particle

Abstract

According to the double-expression protein particle provided by the invention, a target fragment of the double-expression protein particle comprises TNFSF14 and / or anti-CD3 svFc, and the target fragment of the double-expression protein particle comprises TNFSF14 and / or anti-CD3 svFc; the nucleotide sequence of the TNFSF14 is as shown in SEQ ID NO: 2; the nucleotide sequence of the anti-CD3 svFc is as shown in SEQ ID NO: 3; and / or a nucleotide sequence which has the homology of 90%-100% with the nucleotide sequence of the target fragment and is used for coding protein with the same function. By constructing a multi-target fragment with a specific sequence, a fusion peptide and a specific fusion mode, double-expression protein plasmids are formed, infiltration and penetration of T cells to a tumor microenvironment can be increased, and the T cells are combined with enhancement of the activity of the T cells, so that the anti-tumor capability of the T cells is enhanced.

Description

Technical Field

[0001] The present invention relates to a protein particle, in particular to a double-expression protein particle. Background Art

[0002] Tumor immunotherapy is a new generation of tumor treatment methods that has developed rapidly following traditional treatment methods such as surgery, radiotherapy, and chemotherapy, and has great prospects for clinical application. Gene therapy, as an important breakthrough in tumor immunotherapy research, achieves highly targeted treatment of tumors through the targeted expression of effector proteins. Endogenous and adoptive T cell therapy, as the top priority of tumor immunotherapy, has made significant progress in the treatment of hematological tumors, but it is still difficult to treat solid tumors, such as poor T cell infiltration and penetration ability, and weak binding ability of T cells to tumor cells. In response to the above challenges, tumor gene therapy may become one of the effective treatment strategies.

[0003] At present, plasmid vectors are commonly used in biology for gene cloning and expression, and can also be used as transgenic tools to introduce specific genes into host cells. In the human body, plasmid vector-mediated gene manipulation is often used to study gene function, protein expression, gene therapy, etc. Some plasmids using tumor-specific promoters have been designed to increase the infiltration or activity of T cells, but they mostly rely on the expression of a single chemokine or immune checkpoint inhibitory protein. For example, currently, methods such as injection of chemokines (CCL-5, CXCL-9) and monoclonal antibodies (aPD-L1, aCTLA.4) are widely used to enhance the infiltration ability and therapeutic effect of T cells. However, the recruitment effect of a single chemokine on T cells is unsatisfactory, and it is difficult for monoclonal antibodies to maintain the activity of T cells for a long time. At the same time, there is a serious off-target problem, which limits its wide application to a certain extent.

[0004] Generally, the target fragment in the plasmid can encode a specific protein or an element that regulates gene expression, such as a promoter, enhancer, etc. Whether the target fragment can achieve its effect in the human body depends on the synergistic effect of multiple factors, including: 1) Gene function: whether the target fragment encodes a functional protein or performs other important biological functions; 2) Expression level: whether the gene can efficiently express the corresponding protein in the host cell; 3) Expression stability: whether the expressed protein is stable and localized in the cell; 4) Transduction efficiency: the transduction efficiency of the plasmid vector, that is, whether the target fragment can be effectively integrated into the genome of the host cell, or whether the expressed protein can enter other parts of the cell; 5) Immunogenicity: whether the expressed protein will be recognized as a foreign protein by the host's immune system, thereby stimulating an immune response, etc. Therefore, whether the target fragment can achieve its effect in the human body requires scientific design and testing, and the selection of an appropriate target fragment is of utmost importance. For multiple target fragments, strict screening and testing are required to confirm whether different target fragments can successfully achieve their effects in the human body to ensure the safety and effectiveness of the research.

[0005] At present, not only have the defects of T cell therapy in the treatment of solid tumors not been overcome, but the difficulties in the application of plasmid vectors have not been successfully overcome. It is difficult to fundamentally improve the recruitment and infiltration of T cells, and it is also difficult to maintain T cell activity for a long time. Summary of the invention

[0006] In order to overcome the defects of the prior art, the present invention provides a dual expression protein plasmid, which is formed by constructing multi-purpose fragments of specific sequences, fusion peptides and specific fusion methods, and can increase the infiltration and penetration of T cells into the tumor microenvironment, and is combined with enhancing the activity of T cells to enhance the anti-tumor ability of T cells.

[0007] The present invention provides a dual expression protein plasmid, wherein the target fragments of the dual expression protein plasmid include TNFSF14 and anti-CD3 svFc; the nucleotide sequence of TNFSF14 is shown in SEQ ID NO: 2; the nucleotide sequence of anti-CD3 svFc is shown in SEQ ID NO: 3; and / or, a nucleotide sequence encoding a protein with the same function and having a homology of 90% to 100% with the nucleotide sequence of the target fragment.

[0008] Tumor necrosis factor superfamily member 14 (TNFSF14) can bind to LTβR on the surface of stromal cells in the tumor microenvironment, induce stromal cells to secrete a variety of chemokines and adhesion factors, recruit T cells to infiltrate the tumor microenvironment, and degrade collagen in the tumor microenvironment, thereby increasing the penetration depth of T cells. On the other hand, anti-CD3 svFc has high affinity and specificity, can tightly bind to the CD3 antigen on the surface of T cells, can directly activate T cells, participate in the transmission of signals into cells, promote the differentiation and activation of T cells, and secrete cytotoxic cytokines. If anti-CD3 svFc is expressed on the surface of tumor cell membranes at the same time, it can significantly increase the interaction between T cells and tumor cells, increase the action time of T cells and tumor cells, and thus play a long-term anti-tumor ability. Therefore, combining TNFSF14 and anti-CD3 svFc as the target fragment can exert the synergistic anti-tumor effect of the double expression plasmid.

[0009] Preferably, the present invention provides a dual expression protein plasmid, wherein the target fragment of the dual expression protein plasmid further comprises a promoter; preferably a TERT promoter, the nucleotide sequence of which is as shown in SEQ ID NO: 1, and / or a nucleotide sequence encoding a protein of the same function having a homology of 90% to 100% with the nucleotide sequence of the target fragment.

[0010] The inventors' research shows that the TERT gene exists in most cells with telomeres, but its expression is inhibited in somatic cells. In tumor cells, abnormal activation of the TERT promoter will cause upregulation of TERT gene expression and increased telomerase activity. Therefore, the TERT promoter can be used as a tumor-specific promoter. After in-depth exploration and research by the inventors, the dual-expression protein plasmid provided, if its target fragment simultaneously includes a TERT promoter, TNFSF14 and / or anti-CD3 svFc of a specific amino acid sequence, and can give full play to the synergistic effect of the three target fragments, fundamentally solves the problems of poor T cell infiltration ability, low penetration ability, low T cell activity and weak T cell binding ability with tumor cells.

[0011] Preferably, the dual expression protein plasmid provided by the present invention further comprises an Igk leader peptide, a B7 transmembrane peptide and / or a P2A cleavage peptide; the nucleotide sequence of the Igk leader peptide is shown in SEQ ID NO: 4; the nucleotide sequence of the B7 transmembrane peptide is shown in SEQ ID NO: 5; the nucleotide sequence of the P2A cleavage peptide is shown in SEQ ID NO: 7; and / or a nucleotide sequence encoding a peptide with the same functional identity having a nucleotide sequence homology of 90% to 100% with the above-mentioned peptides.

[0012] After combining multiple target fragments into plasmids, their functional effects can be realized in the human body. The specific functions of these fragments and their positions in the plasmid are very important. The design of fusion peptides must ensure that they correctly fold, locate, fold, secrete or process the target protein. A well-designed guide peptide can ensure that the precursor protein is correctly transported to the endoplasmic reticulum, and a properly designed transmembrane peptide can ensure that the protein is correctly riveted to the cytoplasmic membrane; an effective cleavage peptide can ensure that the target protein can be enzymatically removed at the correct position, thereby obtaining the correct mature protein. If improperly designed, these fusion peptides may cause protein folding errors, incorrect protein transport, or undesirable cleavage at the wrong position, thereby affecting the final function of the protein. Therefore, their selectivity and functional design are important links for the success of the plasmid expression system. After in-depth exploration and research by the inventors, Igk guide peptides, B7 transmembrane peptides and / or P2A cleavage peptides with specific amino acid sequences are provided, which can ensure that the functions of the target fragments in the dual expression protein plasmid provided by the present invention are fully realized in the human body, which is conducive to achieving the purpose of the present invention.

[0013] Preferably, the dual expression protein plasmid provided by the present invention, wherein the construction method of the dual expression protein plasmid comprises:

[0014] 1) Connect Igk and TNFSF14 by PCR to generate fragment 1;

[0015] 2) connecting the P2A cleavage peptide, the anti-CD3 svFc gene sequence and the B7 transmembrane peptide by PCR to generate fragment 2;

[0016] 3) Fragment 1 and fragment 2 are connected by bridge PCR to obtain the TNFSF14+anti-CD3 svFc gene sequence. Preferably, the dual expression protein plasmid provided by the present invention, wherein the basic construction method of the dual expression protein plasmid also includes:

[0017] 1) The 5' end of the TERT promoter was loaded with the homology arm of the pcDNA3.1(+) vector, and the 3' end was loaded with the homology arm of TNFSF 14. After amplification and recovery, fragment 3 was obtained. The size of fragment 3 was 323 bp;

[0018] 2) The 3' end of the TNFSF14+anti-CD3 svFc gene sequence was loaded with the homology arm of the pcDNATM3.1(+) vector, and fragment 4 was obtained after amplification and recovery. The size of fragment 4 was 2548 bp;

[0019] 3) Using fragments 3 and 4 as templates, Tower Bridge PCR was performed to obtain the TERT promoter + TNFSF 14 + anti-CD3svFc gene sequence with a size of 2851 bp;

[0020] 4) The pcDNA3.1(+) vector was double-digested with MluI and NheI, and ligated with the TERT promoter + TNFSF 14 + anti-CD3svFc gene sequence to obtain recombinant plasmid 1.

[0021] Different plasmid construction methods will have an important impact on the function of the plasmid. For example, the construction method will affect the selection and modification of the vector plasmid. For example, the selected plasmid vector needs to have a suitable size, appropriate restriction endonuclease sites, and marker genes (such as resistance genes, fluorescent genes, etc.). The accuracy of the relevant selection directly affects the insertion position and integration efficiency of the gene in the plasmid. The construction method will also affect the production of the final gene expression product, including expression efficiency, stability, safety, etc. For example, it will affect the insertion efficiency. If the construction method is inappropriate, such as poor selection of restriction sites or low connection efficiency, it may affect the correct insertion of the target fragment, resulting in loss or change of gene function; affect stability. If the operation during the construction process, such as improper control of temperature and time, may affect the stability of the plasmid, resulting in mutations in its replication or expression in the host cell; affect safety. If the construction method is inappropriate, it may increase the risk of recombination and affect the safety of the experiment or product.

[0022] Through multiple experiments and repeated verifications, the inventors provided a method for constructing a dual-expression protein particle, including suitable fragment size, appropriate restriction endonuclease cleavage sites, etc., which further ensured the full realization of the function and effectiveness of the dual-expression protein particle provided by the present invention in the human body, resulting in a major breakthrough.

[0023] Preferably, the dual expression protein plasmid provided by the present invention comprises:

[0024] In the process of generating fragment 3, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 10;

[0025] In the process of generating fragment 4, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 12;

[0026] In the process of generating the TERT promoter+TNFSF14+anti-CD3 svFc gene sequence, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 14;

[0027] The pcDNA3.1(+) vector was double-digested with MluI and NheI and connected with the TERT promoter+TNFSF14+anti-CD3svFc gene sequence by seamless gene cloning technology.

[0028] In the method for constructing a dual-expression protein plasmid provided by the inventors, upstream and downstream primers of specific nucleotide sequences are used, which further ensures that the construction of the dual-expression protein plasmid can proceed smoothly, thereby improving production efficiency and success rate.

[0029] Preferably, the dual expression protein plasmid provided by the present invention, wherein the T2A cleavage peptide and / or eGFP sequence are inserted into the sequence of the recombinant plasmid 1 by homologous recombination to construct the recombinant plasmid 2; the nucleotide sequence of the eGFP sequence is shown in SEQ ID NO: 6; the nucleotide sequence of the T2A cleavage peptide is shown in SEQ ID NO: 8; in the process of constructing the recombinant plasmid 2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 16. In the construction of the recombinant plasmid 2 of the present invention, the marker gene eGFP is added, which provides a fast and direct method to determine which cells can express the exogenous gene, and can be used to determine the expression of the protein plasmid during the transformation process. Through this method, the inventor can screen out cells that have successfully integrated the exogenous gene from a large number of transformants, clarify the correct introduction and expression of the exogenous gene, and provide a basis for subsequent functional verification.

[0030] Preferably, the dual expression protein plasmid provided by the present invention comprises:

[0031] The protein plasmid expresses TNFSF14 and / or anti-CD3 svFc protein in tumor cells;

[0032] and / or, the protein plasmid is tumor-specific;

[0033] And / or, the protein particle increases the recruitment of immune cells and increases the penetration of immune cells in solid tumors, and the immune cells include one or more of CTL, Pan B and / or BMDC;

[0034] And / or, the protein particle has the function of activating CTL cells;

[0035] and / or, the protein particle has the ability to increase the binding of CTLs to tumor cells;

[0036] And / or, the protein particle increases the killing ability of CTL on tumor cells.

[0037] After repeated verification by the inventors, the dual-expression protein plasmid can simultaneously express TNFSF14 and anti-CD3 svFc proteins in tumor cells, and by adding markers, it was verified that it has tumor specificity, and has the effect of increasing the infiltration and / or penetration of CTL cells into the tumor microenvironment, activating CTL cells, and increasing the ability of CTL to bind to tumor cells and / or its killing ability.

[0038] Preferably, the dual expression protein plasmid provided by the present invention, wherein the protein plasmid has tumor specificity by expressing TNFSF14 and / or anti-CD3 svFc protein in tumor cells, thereby increasing the infiltration and / or penetration of CTL cells into the tumor microenvironment and maintaining the activity of CTL cells; and / or enhancing the anti-tumor activity of CTL cells by activating CTL cells, increasing the ability of CTL to bind to tumor cells and / or increasing the ability of CTL to kill tumor cells.

[0039] Preferably, the dual expression protein particle provided by the present invention is used for tumor immunotherapy.

[0040] Preferably, the dual expression protein particle provided by the present invention is used for immunotherapy of solid tumors, including one or more of breast cancer, colorectal cancer, gastric cancer, lung cancer and / or lymphoma.

[0041] The present invention provides a dual expression protein plasmid, which screens and designs target fragments and fusion peptides with specific nucleotide sequences, such as 1) TERT promoter can realize specific expression of plasmid in tumor cells; 2) TNFSF14 can promote the secretion of multiple chemokines by stromal cells in the tumor site, realize the recruitment of immune cells, and increase the penetration depth of immune cells; 3) anti-CD3 svFc can activate CTL cells and enhance the binding ability of CTL with tumor cells. Through scientific design, the three target fragments are combined with fusion peptides, effectively folded and cut to form protein plasmids, and the synergistic effect of the three target fragments is exerted, which significantly enhances the anti-tumor ability of endogenous CTL or exogenous CAR-T cells, and has outstanding clinical value.

[0042] The dual expression protein particle provided by the present invention is constructed by a method that has been repeatedly tested and verified, including designing the fragment size, selecting restriction endonuclease cleavage sites and marker genes, etc.; and through a carefully designed verification test, it is confirmed that the dual expression protein particle can be effectively expressed in tumor cells, has the effect of increasing the recruitment of immune cells, activating T cells, enhancing the binding ability of T cells to tumor cells, and the killing ability of T cells to tumor cells. It is thus confirmed that the protein particle can increase the infiltration and / or penetration of T cells into the tumor microenvironment, maintain T cell activity, and further enhance the anti-tumor ability of T cells. Therefore, the protein particle can be used for tumors, especially immunotherapy of solid tumors, including breast cancer, colorectal cancer, gastric cancer, lung cancer and / or lymphoma and other tumor types, which has great practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0044] Figure 1 1 is the element structure diagram of recombinant plasmid 1 and recombinant plasmid 2;

[0045] Figure 2 Agarose gel electrophoresis of the double-expression protein plasmid (M: Marker; 1: TERT promoter; 2: TNFSF14+anti-CD3 svFc gene sequence; 3: TERT promoter+TNFSF14+anti-CD3 svFc gene sequence);

[0046] Figure 3 This is the western blot image of B16-F10 cells transfected with recombinant plasmid 1;

[0047] Figure 4 Western blot images of different cells transfected with recombinant plasmid 2;

[0048] Figure 5 Figure 2 shows the number of CTL, PanB and BMDC cells before and after transfection in the Transwell experiment;

[0049] Figure 6 This is the ratio of CD69 positive CTLs before and after transfection;

[0050] Figure 7 The relative binding ability of CTL before and after B16-F10 transfection;

[0051] Figure 8The figure shows the apoptosis ratio before and after B16-F10 transfection;

[0052] Fig. 9 This is the survival curve of B16-F10 tumor-bearing mice (solid line is PBS group; dotted line is dual-expression protein plasmid). DETAILED DESCRIPTION

[0053] In order to further illustrate the present invention, examples are given below. It should be noted that these examples are purely illustrative. The purpose of giving these examples is to fully illustrate the meaning and content of the utility model, but the utility model is not limited to the scope of the examples.

[0054] Example 1

[0055] The present invention provides a dual expression protein plasmid, wherein the target fragments of the dual expression protein plasmid include TNFSF14 and anti-CD3 svFc;

[0056] 1) The nucleotide sequence of TNFSF14 is shown in SEQ ID NO: 2:

[0057] SEQ ID NO: 2

[0058]

[0059] 2) The nucleotide sequence of anti-CD3 svFc is shown in SEQ ID NO: 3:

[0060] SEQ ID NO: 3

[0061]

[0062] And / or, a nucleotide sequence encoding a protein with the same function and having 90% to 100% homology with the nucleotide sequence of the target fragment.

[0063] At the same time, the target fragment of the dual-expression protein plasmid also includes a promoter, which in one embodiment is a TERT promoter.

[0064] 3) The nucleotide sequence of the TERT promoter is shown in SEQ ID NO: 1:

[0065] SEQ ID NO: 1:

[0066]

[0067] And / or, a nucleotide sequence encoding a protein with the same function and having a homology of 90% to 100% with the nucleotide sequence of the target fragment.

[0068] In another embodiment, the dual expression protein plasmid further comprises an Igk leader peptide, a B7 transmembrane peptide, and / or a P2A cleavage peptide;

[0069] 4) The nucleotide sequence of the Igk leader peptide is shown in SEQ ID NO: 4:

[0070] SEQ ID NO: 4

[0071]

[0072] 5) The nucleotide sequence of the B7 transmembrane peptide is shown in SEQ ID NO: 5:

[0073] SEQ ID NO: 5

[0074]

[0075] 6) The nucleotide sequence of the P2A cleavage peptide is shown in SEQ ID NO: 7:

[0076] SEQ ID NO: 7

[0077]

[0078] And / or, a nucleotide sequence encoding a peptide with the same function that has 90% to 100% homology with the nucleotide sequence of the above-mentioned peptide.

[0079] Example 2

[0080] The construction method of dual expression protein plasmid includes:

[0081] Igk and TNFSF14 were connected by PCR to generate fragment 1; P2A cleavage peptide, anti-CD3 svFc gene sequence and B7 transmembrane peptide were connected by PCR to generate fragment 2; fragment 1 and fragment 2 were connected by bridging PCR to obtain TNFSF 14+anti-CD3 svFc gene sequence.

[0082] In another embodiment, the method for constructing a dual expression protein plasmid further comprises:

[0083] 1) The 5' end of the TERT promoter was loaded with the homology arm of the pcDNA3.1(+) vector, and the 3' end was loaded with the homology arm of TNFSF14. After amplification and recovery, fragment 3 was obtained. The size of fragment 3 was 323 bp.

[0084] The nucleotide sequence of the upstream primer may be as shown in SEQ ID NO: 9:

[0085] SEQ ID NO: 9

[0086]

[0087] The nucleotide sequence of the downstream primer may be as shown in SEQ ID NO: 10:

[0088] SEQ ID NO: 10

[0089]

[0090] 2) The 3' end of the TNFSF 14+anti-CD3 svFc gene sequence was loaded with the homology arm of the pcDNATM3.1(+) vector, and fragment 4 was obtained after amplification and recovery. The size of fragment 4 was 2548 bp.

[0091] The nucleotide sequence of the upstream primer may be as shown in SEQ ID NO: 11:

[0092] SEQ ID NO: 11

[0093]

[0094] The nucleotide sequence of the downstream primer may be as shown in SEQ ID NO: 12:

[0095] SEQ ID NO: 12

[0096]

[0097] 3) Using fragments 3 and 4 as templates, Tower Bridge PCR was performed to obtain the TERT promoter + TNFSF 14 + anti-CD3svFc gene sequence with a size of 2851 bp;

[0098] The nucleotide sequence of the upstream primer may be as shown in SEQ ID NO: 13:

[0099] SEQ ID NO: 13

[0100]

[0101] The nucleotide sequence of the downstream primer may be as shown in SEQ ID NO: 14:

[0102] SEQ ID NO: 14

[0103]

[0104] 4) The pcDNA3.1(+) vector is double-digested with MluI and NheI, and connected with the TERT promoter+TNFSF14+anti-CD3svFc gene sequence, for example, by gene seamless cloning technology, to obtain recombinant plasmid 1.

[0105] Example 3

[0106] In the sequence of the recombinant plasmid 1 constructed in Example 2, the T2A cleavage peptide and the eGFP sequence were inserted by homologous recombination to construct the recombinant plasmid 2.

[0107] 1) The nucleotide sequence of the eGFP sequence is shown in SEQ ID NO: 6:

[0108] SEQ ID NO: 6

[0109]

[0110] 2) The nucleotide sequence of the T2A cleavage peptide is shown in SEQ ID NO: 8:

[0111] SEQ ID NO: 8

[0112]

[0113] 3) During the construction of recombinant plasmid 2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 15:

[0114] SEQ ID NO: 15

[0115]

[0116] 4) The nucleotide sequence of the downstream primer is shown in SEQ ID NO: 16:

[0117] SEQ ID NO: 16

[0118]

[0119] Example 4

[0120] The protein particles provided by the present invention express TNFSF 14 and / or anti-CD3 svFc protein in tumor cells;

[0121] and / or, the protein plasmid is tumor-specific;

[0122] And / or, the protein particle increases the recruitment of immune cells and increases the penetration of immune cells in solid tumors, and the immune cells include one or more of CTL, Pan B and / or BMDC;

[0123] And / or, the protein particle has the function of activating CTL cells;

[0124] and / or, the protein particle has the ability to increase the binding of CTLs to tumor cells;

[0125] And / or, the protein particle increases the killing ability of CTL on tumor cells.

[0126] In another embodiment, the protein particle increases the infiltration and / or penetration of CTL cells into the tumor microenvironment and maintains the activity of CTL cells by expressing TNFSF14 and / or anti-CD3svFc proteins in tumor cells and having tumor specificity; and / or enhances the anti-tumor activity of CTL cells by activating CTL cells, increasing the ability of CTL to bind to tumor cells and / or increasing the ability of CTL to kill tumor cells.

[0127] In another embodiment, the protein particle is used for immunotherapy of tumors. The protein particle is used for immunotherapy of solid tumors, including one or more of breast cancer, colorectal cancer, gastric cancer, lung cancer and / or lymphoma.

[0128] Example 5

[0129] 1) sequentially connecting Igk and TNFSF14 by PCR; sequentially connecting P2A cleavage peptide, anti-CD3 svFc gene sequence and B7 transmembrane peptide by PCR; sequentially connecting Igk, TNFSF14, P2A cleavage peptide, anti-CD3 svFc gene sequence and B7 transmembrane peptide by bridging PCR (named as TNFSF14+anti-CD3svFc gene sequence);

[0130] 2) The 5' end of the TERT promoter carries the homology arm of the pcDNATM3.1(+) vector, and the 3' end carries the homology arm of TNFSF14. The upstream primer is (SEQ ID NO: 9): GCGATGTACGGGCCAGATATACGCGTGATTCGCGGGCACAGACGCC; the downstream primer is (SEQ ID NO: 10) AGGAGTGTGTCTGTCTCCATCGCGGGGTGGCCGGGGCCA; the PCR product is recovered by agarose electrophoresis gel, and the fragment size should be 323bp;

[0131] 3) The 3' end of the TNFSF 14+anti-CD3 svFc gene sequence was loaded with the homology arm of the pcDNATM3.1(+) vector, and the upstream primer was (SEQ ID NO: 11): ATGGAGACAGACACACTCCTGC; the downstream primer was (SEQ ID NO: 12) AAGCTTAAGTTAAACGCTAGCTCAATGATGATGATGATGATGGACCATG; the PCR product was recovered by agarose electrophoresis gel, and the PCR product fragment size should be 2548 bp;

[0132] 4) using the products obtained in 2) and 3) as templates, performing bridge PCR, wherein the upstream primer is (SEQ ID NO: 13): GCGATGTACGGGCCAGATATACG; the downstream primer is (SEQ ID NO: 14) AAGCTTAAGTTAAACGCTAGCTCAATG; the PCR product is recovered by agarose electrophoresis gel, and the PCR product fragment size should be 2851 bp (TERT promoter + TNFSF14 + anti-CD3 svFc gene sequence);

[0133] 5) The pcDNA3.1(+) vector was double-digested with MluI and NheI, and connected with the product obtained in 4) by seamless gene cloning technology to obtain recombinant plasmid 1, such as Figure 1 As shown;

[0134] 6) Insert T2A+eGFP sequence into recombinant plasmid 1 by homologous recombination to construct recombinant plasmid 2 (such as Figure 1 The upstream primer is (SEQ ID NO: 15): TCATCATGGAAGCGGAGAGGGCAGA; the downstream primer is (SEQ ID NO: 16): TGTACAAGTGAGCTAGCGTTTAAACTTAAGCTT.

[0135] Agarose gel electrophoresis of the PCR product of the recombinant plasmid after construction, such as Figure 2 shown.

[0136] Example 6

[0137] 1) Verify that the recombinant plasmid can express two proteins in tumor cells: transfect the recombinant plasmid 1 into B16-F10 tumor cells, and verify the expression of TNFSF14 and anti-CD3 svFc by western blot. Figure 3 As shown, compared with the untransfected group, the transfected group showed obvious TNFSF14 and anti-CD3 svFc bands, proving that the recombinant plasmid successfully expressed the two proteins in tumor cells.

[0138] 2) Verify that the recombinant plasmid is tumor-specific: The recombinant plasmid 2 was transfected into non-tumor cells, such as lung fibroblasts (MLF), renal proximal tubular epithelial cells (PTEC), cytotoxic T lymphocytes (CTL), pan B cells (Pan B), bone marrow-derived dendritic cells (BMDC), and melanoma cells (B16-F10), and the expression of eGFP was verified by western blot. Figure 4As shown, after transfection of recombinant plasmid 2 in normal cells such as MLF, PTEC, CTL, PanB and BMDC, no eGFP band appeared; however, after transfection of recombinant plasmid 2 in B16-F10 tumor cells, obvious eGFP bands were observed, proving that the recombinant plasmid constructed by the present invention has tumor expression specificity.

[0139] 3) Verify that the recombinant plasmid can increase the tumor infiltration effect of immune cells: B16-F10 cells that are not transfected or transfected with recombinant plasmid 1 are co-incubated with fibroblasts. B16-F10 cells transfected with recombinant plasmid 1 can promote fibroblasts to secrete a large number of chemokines, and then verify whether it can increase the recruitment of immune cells such as CTL, Pan B and BMDC through Transwell experiments. Figure 5 As shown, compared with the control group, in the group where B16-F10 cells were transfected with recombinant plasmid 1, the number of three immune cells in the Transwell lower chamber increased significantly, indicating that the transfected B16--F10 cells can secrete TNFSF14, thereby inducing fibroblasts to produce chemokines and enhancing the infiltration effect of immune cells.

[0140] 4) Verify that the recombinant plasmid can activate T cells: After incubating B16-F10 cells that were not transfected or transfected with recombinant plasmid 1 with CTL cells for 24 hours, verify the proportion of CTLs that are positive for CD69 (a marker of T cell activation). Figure 6 As shown, compared with the untransfected group, in the group where B16-F10 cells were transfected with recombinant plasmid 1, the proportion of CD69-positive CTLs was significantly increased, indicating that the transfected B16-F10 cells expressed anti-CD3 svFc and could enhance the activity of CTLs.

[0141] 5) Verify that the recombinant plasmid can increase the binding ability of CTL to tumor cells: B16-F10 cells that were not transfected or transfected with the recombinant plasmid 1 were used to verify the binding ability of CTL to B16-F10 by SrtA-mediated proximity labeling strategy. Figure 7 As shown, compared with the untransfected group, in the group where B16-F10 cells were transfected with recombinant plasmid 1, the relative binding ability of CTL to B16-F10 increased by more than 4 times, indicating that the transfected B16-F10 cells expressed anti-CD3 svFc, which could specifically bind to CD3 on the surface of CTL and enhance the binding ability of CTL to tumor cells.

[0142] 6) Verify that the recombinant plasmid can increase the killing ability of CTL against T cells: After incubating B16-F10 cells that were not transfected or transfected with recombinant plasmid 1 with CTL cells for 24 hours, the killing ability of CTL against B16-F10 cells was analyzed by flow cytometry using PI staining (cell apoptosis marker). Figure 8As shown, compared with the untransfected group, the proportion of B16-F10 cell apoptosis was higher in the group where B16-F10 cells were transfected with recombinant plasmid 1, indicating that CTL had a stronger killing effect on B16-F10 cells transfected with recombinant plasmid 1.

[0143] 7) Verify the anti-tumor effect of recombinant plasmid 1 at the in vivo level: First, subcutaneous inoculation of B16-F10 cells in C57 mice was used to construct a subcutaneous tumor model. Recombinant plasmid 1 (40 μg / time) was injected into the tail vein on days 8, 11, 14, and 17 after inoculation, and then the survival rate of the mice was counted. Fig. 9 As shown, the median survival rate of mice in the non-transfected group was only 24 days, while in the group injected with recombinant plasmid 1, the median survival rate of mice could be delayed to 42 days. The survival rate of mice was significantly prolonged, indicating that the dual-expression protein plasmid provided in the present application has in vivo anti-tumor activity.

[0144] The above are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art who is familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A dual expression protein plasmid, characterized in that: The target fragments of the dual expression protein plasmid include TNFSF14 and anti-CD3 svFc; The nucleotide sequence of TNFSF14 is shown in SEQ ID NO: 2; The nucleotide sequence of the anti-CD3 svFc is shown in SEQ ID NO: 3; And / or, a nucleotide sequence encoding a protein with the same function and having a homology of 90% to 100% with the nucleotide sequence of the target fragment.

2. The dual expression protein plasmid according to claim 1, characterized in that: The target fragment of the dual expression protein plasmid also includes a promoter; preferably a TERT promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1, and / or a nucleotide sequence encoding a protein with the same function and having a homology of 90% to 100% with the nucleotide sequence of the target fragment.

3. The dual expression protein plasmid according to claim 2, characterized in that: The dual expression protein plasmid also includes an Igk guide peptide, a B7 transmembrane peptide and / or a P2A cleavage peptide; The nucleotide sequence of the Igk leader peptide is shown in SEQ ID NO: 4; The nucleotide sequence of the B7 transmembrane peptide is shown in SEQ ID NO: 5; The nucleotide sequence of the P2A cleavage peptide is shown in SEQ ID NO: 7; And / or, a nucleotide sequence encoding a peptide with the same function and having 90% to 100% homology with the nucleotide sequence of the peptide.

4. The dual expression protein plasmid according to claim 3, characterized in that: The construction method of the dual expression plasmid comprises: 1) connecting the Igk and the TNFSF14 by PCR to generate fragment 1; 2) connecting the P2A cleavage peptide, the anti-CD3 svFc gene sequence and the B7 transmembrane peptide by PCR to generate fragment 2; 3) Fragment 1 and fragment 2 were connected by bridge PCR to obtain the TNFSF14+anti-CD3 svFc gene sequence.

5. The dual expression protein plasmid according to claim 4, characterized in that: The basic construction method of the dual expression plasmid also includes: 1) The 5' end of the TERT promoter carries the homology arm of the pcDNA3.1(+) vector, and the 3' end carries the homology arm of the TNFSF14, and fragment 3 is obtained after amplification and recovery. The size of the fragment 3 is 323 bp; 2) The 3' end of the TNFSF14+anti-CD3 svFc gene sequence was loaded with the homology arm of the pcDNATM3.1(+) vector, and fragment 4 was obtained after amplification and recovery. The size of the fragment 4 was 2548 bp; 3) Using fragments 3 and 4 as templates, Tower Bridge PCR was performed to obtain the TERT promoter + TNFSF14 + anti-CD3svFc gene sequence with a size of 2851 bp; 4) The pcDNA3.1(+) vector was double-digested with MluI and NheI, and connected with the TERT promoter+TNFSF14+anti-CD3svFc gene sequence to obtain recombinant plasmid 1.

6. The dual expression protein plasmid according to claim 5, characterized in that: During the generation of the fragment 3, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 10; In the process of generating the fragment 4, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 12; In the process of generating the TERT promoter+TNFSF14+anti-CD3 svFc gene sequence, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 14; The pcDNA3.1(+) vector is double-digested with MluI and NheI, and connected with the TERT promoter+TNFSF14+anti-CD3svFc gene sequence through seamless gene cloning technology.

7. The dual expression protein plasmid according to claim 5, characterized in that: The T2A cleavage peptide and / or the eGFP sequence are inserted into the sequence of the recombinant plasmid 1 by homologous recombination to construct a recombinant plasmid 2; the nucleotide sequence of the eGFP sequence is shown in SEQ ID NO: 6; the nucleotide sequence of the T2A cleavage peptide is shown in SEQ ID NO: 8; During the construction of the recombinant plasmid 2, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

16.

8. The dual expression protein plasmid according to any one of claims 1 to 7, characterized in that: The protein plasmid expresses TNFSF14 and / or anti-CD3 svFc protein in tumor cells; and / or, the protein plasmid is tumor-specific; And / or, the protein particle increases the recruitment of immune cells and increases the penetration of immune cells in solid tumors, wherein the immune cells include one or more of CTL, Pan B and / or BMDC; And / or, the protein particle has the function of activating CTL cells; and / or, the protein particle has the ability to increase the binding of CTLs to tumor cells; And / or, the protein particle increases the killing ability of CTL on tumor cells.

9. The dual expression protein plasmid according to claim 8, characterized in that: The protein particle expresses TNFSF14 and / or anti-CD3 svFc protein in tumor cells and has tumor specificity, thereby increasing the infiltration and / or penetration of CTL cells into the tumor microenvironment and maintaining the activity of CTL cells; and / or enhancing the anti-tumor activity of CTL cells by activating CTL cells, increasing the ability of CTL to bind to tumor cells and / or increasing the ability of CTL to kill tumor cells.

10. The dual expression protein plasmid according to claim 1, characterized in that: The protein particle is used for immunotherapy of tumors; preferably, the protein particle is used for immunotherapy of solid tumors, including one or more of breast cancer, colorectal cancer, gastric cancer, lung cancer and / or lymphoma.

Images