Preparation method of bear gall powder cultivated in vitro

Abstract

The invention aims to provide a preparation method of in-vitro cultured bear gall powder, which comprises the following steps: carrying out primary concentration, alcohol precipitation, macroporous adsorption separation, secondary concentration and freeze-drying purification on conversion liquid which is qualified in reaction to obtain the in-vitro cultured bear gall powder. Wherein the conversion liquid is prepared by mixing a chicken bile refined liquid with four-enzyme co-expression bacterial sludge or immobilized cells thereof, then adding NADP coenzyme, a surfactant and cosubstrates sodium pyruvate and dextrose monohydrate in a fixed proportion, and carrying out catalytic reaction at 25-30 DEG C for 2-24 hours; the obtained in-vitro cultured bear gall powder is subjected to whole-cell catalysis under proper conditions through whole cells expressing four enzymes or an immobilized cell form of the whole cells, the in-vitro cultured bear gall powder with stable TUDCA content is obtained, and no intermediate product T-7-KLCA residues exist.

Description

Technical Field

[0001] The invention relates to the field of bear bile powder preparation, and in particular to a method for preparing bear bile powder cultivated in vitro. Background Art

[0002] Bear bile is the first of the "four treasured animal medicines" in traditional Chinese medicine. It has the effects of clearing away heat, calming the liver, and improving eyesight. It has significant effects in treating liver and gallbladder diseases, central nervous system diseases, and ophthalmic diseases. Natural bear bile is widely used in clinical practice. Currently, there are more than 150 Chinese patent medicines containing bear bile powder that have been officially approved for marketing. Common preparations include Tanreqing injection, bear bile capsules, compound bear bile eye drops, bear bile pills, etc. It has certain anti-inflammatory, antipyretic, sedative, anticonvulsant and antispasmodic effects.

[0003] As the clinical use of bear bile powder increases year by year, the drug source decreases year by year. The scarcity of drug sources has greatly restricted the use and further development of related preparations. In order to protect rare wildlife resources and meet the clinical drug demand for bear bile, it is urgent to find alternative resources. Therefore, it is particularly important to design an in vitro cultured bear bile powder.

[0004] Among them, the chemical compounding method of using poultry bile as the basic raw material and adding a certain amount of tauroursodeoxycholic acid, amino acids, and trace elements that are unique to bear bile is a quick method, but it cannot fundamentally solve the problem of the source of the core active ingredient tauroursodeoxycholic acid (TUDCA). On the contrary, the enzyme reaction conversion method is used to convert the cheap and easily available taurochenodeoxycholic acid (TCDCA) in chicken bile into tauroursodeoxycholic acid (TUDCA), and then the conversion liquid is processed to finally obtain in vitro cultured bear bile powder, which is considered to be the most economical, feasible and environmentally friendly method.

[0005] At present, there are four major difficulties in the in vitro cultivation of bear bile powder bioconversion technology: ① The concentration of TCDCA substrate is relatively low (<50g / L); ② It is necessary to add too much and expensive coenzyme NAD or NADP; ③ The reaction intermediate product taurine 7-ketolithocholic acid (T-7-KLCA) has a lot of residues; ④ The ratio of TUDCA / TCDCA is unstable.

[0006] In summary, it is particularly important to propose a method for preparing in vitro cultured bear bile powder that can solve at least one of the above problems. Summary of the invention

[0007] The purpose of the present invention is to provide a method for preparing in vitro cultured bear bile powder, using cheap and readily available concentrated chicken bile as a raw material, by expressing whole cells or immobilized cell forms of four enzymes, and performing whole cell catalysis under suitable conditions to obtain in vitro cultured bear bile powder with a stable TUDCA content, and no intermediate product T-7-KLCA remains. In order to achieve the above purpose, the present invention provides the following technical solutions:

[0008] A method for preparing in vitro cultured bear bile powder comprises the following steps:

[0009] 6) Preparation of reaction substrate: chicken bile purified concentrate, detection of TCDCA content therein, TCDCA content is 20-30%;

[0010] 7) Construction of four enzyme co-expression strains: 7α-HSDH, 7β-HSDH, lactate dehydrogenase (LDH) and glucose dehydrogenase (GDH) were constructed on the same co-expression vector according to a certain gene order, and the co-expression vector was transformed into an Escherichia coli host (BL21).

[0011] 8) Preparation of immobilized cells: Weigh the Escherichia coli bacteria expressing four enzymes, 7α-HSDH, 7β-HSDH, LDH and GDH, add 5-10 times the mass of pH 7.0-8.0 buffer and stir well, then add diatomaceous earth, polyethyleneimine (PEI) and glutaraldehyde in sequence for cross-linking and fixation, filter to obtain the prepared immobilized cells, and store at -20°C for future use.

[0012] 9) Catalysis: Mix the chicken bile extract with the four-enzyme co-expressing bacterial sludge or its immobilized cells, add a small amount of NADP coenzyme, a surfactant, and a fixed ratio of co-substrates sodium pyruvate and glucose monohydrate, and catalyze the reaction at 25-30°C for 2-24 hours until no intermediate product T-7-KLCA remains.

[0013] 10) Preparation of bear bile powder: The qualified conversion liquid is subjected to a first concentration, alcohol precipitation, macroporous adsorption separation, second concentration, and freeze-drying purification process to obtain primary in vitro cultured bear bile powder, and bilirubin is added to the required content of 0.4% to become a high-quality in vitro cultured bear bile powder.

[0014] The step 1) of preparing the reaction substrate specifically comprises: selecting chicken bile, breaking the bile and obtaining bile to obtain chicken bile; concentrating the chicken bile to 50% of the original volume to obtain concentrated chicken bile at a concentration temperature of 70° C.; performing alcohol extraction on the concentrated chicken bile, cooling the concentrated chicken bile to 30° C., adding 3 times the volume of 95% ethanol to the concentrated chicken bile, and then stirring for 200 minutes; maintaining the temperature of the concentrated chicken bile at 4° C. after stirring, centrifuging at a speed of 3500 rpm for 25 minutes, each time for 5 minutes, and centrifuging for 5 times; taking the supernatant after centrifugation, and performing secondary concentration on the supernatant for 40 minutes at a concentration temperature of 45° C. to obtain a refined chicken bile solution, and the TCDCA content detected by HPLC is 20-30%.

[0015] In the step 2), the four enzymes 7α-HSDH, 7β-HSDH, LDH and GDH are used, wherein 7α-hydroxysteroid dehydrogenase (7α-HSDH) is derived from Escherichia coli, lactate dehydrogenase (LDH) is derived from Lactobacillus, 7β-hydroxysteroid dehydrogenase (7β-HSDH) is derived from Ruminococcus gnavus, and glucose dehydrogenase (GDH) is derived from Bacillus subtilis.

[0016] In the step 2), the gene sequence is 7α-HSDH, 7β-HSDH, LDH and GDH in series, and the corresponding genes are expressed in sequence according to the central dogma of genetics until all four genes are expressed. The preferred sequence is GDH, 7β-HSDH, LDH and 7α-HSDH.

[0017] The co-expression vector in step 2) includes one of pRSFDuet-1, pETDuet-1, pACYCDuet-1, and pCOLADuet-1, preferably pRSFDuet-1.

[0018] The promoter for gene expression regulation in step 2) is a strong T7 promoter, and the number of promoters is 2, 3, or 4, and the preferred number is 3.

[0019] The buffer in step 3) is phosphate buffer, Tris-HCl buffer, glycine-sodium hydroxide, or boric acid-sodium hydroxide buffer.

[0020] In the step 3), the amount of diatomaceous earth used is 0.05-0.5 times the amount of bacterial mud used, preferably 0.1-3 times.

[0021] In the step 3), the molecular weight of PEI is 1 kd-100 kd, and the final concentration of PEI is 0.05-1%, preferably 5-50 kd, and the final concentration is 0.1-0.3%.

[0022] The final concentration of glutaraldehyde in step 3) is 0.1-1%, preferably 0.25-0.5%.

[0023] In the step 4), the TCDCA concentration of the reaction system is 50-100 g / L, the amount of bacterial sludge is 30-50 g / L or the amount of immobilized cells is 50-100 g / L.

[0024] In the step 4), the amount of coenzyme NADP used is 0.02-0.2% of the mass of TCDCA.

[0025] In the step 4), the surfactant is one of Triton X-100, Tween and Span, and the added amount is 0.1%-0.5% of the total reaction system.

[0026] In the step 4), the amount of sodium pyruvate as the cosubstrate is 0.65-0.75 times the molar amount of TCDCA, and the amount of glucose monohydrate is 1.0-2.0 times that of TCDCA.

[0027] In the step 4), the immobilized cells are recycled 5-10 times.

[0028] In the step 5), the concentration is performed once by controlling the vacuum degree to 0.05-0.10 MPa, heating to 60-70° C. and concentrating under reduced pressure to 1 / 4 of the initial volume.

[0029] In step 5), the alcohol precipitation is performed by adding 2.5-3.0 times the mass of anhydrous ethanol or 95% ethanol to the primary concentrated liquid system, heating to 60-70° C. and stirring for more than 2 hours, and then centrifuging at 10000-140000 rpm to collect the filtrate, and the filter cake is the waste impurities.

[0030] In the step 5), the macroporous adsorption separation is to concentrate the supernatant filtrate after alcohol precipitation and centrifugation to a solid content of 65-75%, dilute it with twice the amount of purified water, and then pass it through the activated macroporous adsorption resin, control the feed rate to be less than 1.5BV / h, first use 1BV of purified water to elute impurities, then use 2-3BV of low-concentration 40-60% ethanol to elute impurities, and finally use about 3BV of anhydrous ethanol to elute the product, and detect the target product in real time.

[0031] In the step 5), the vacuum degree of the secondary concentration is controlled at 0.05-0.10 MPa, the temperature is raised to 40-60° C., and the concentrated solution is concentrated under reduced pressure until no ethanol is present in the concentrated solution.

[0032] In the step 5), freeze drying is to transfer the secondary concentrated liquid to a freeze dryer, set the low temperature to ≤-40°C, pre-freeze for more than 6 hours, and then continue to reduce the pressure and dry for 10-15 hours to obtain the primary product of in vitro cultured bear bile powder, and add 0.4% bilirubin to obtain the fine product of in vitro cultured bear bile powder.

[0033] In the step 5), the ratio of TUDCA:TCDCA is in the range of 1.3-1.6, wherein the TUDCA content is greater than 30%, T-7-KLCA is not detected, and the color is golden, which meets the quality standard of bear bile powder TUDCA content greater than 23% in the eleventh volume of the drug standard (new drug standard), and meets the current requirements for golden bile powder.

[0034] The technical method of the present invention can strictly control the ratio of TUDCA:TCDCA by controlling the dosage of the co-substrates sodium pyruvate and glucose monohydrate, thereby obtaining a finished bear bile powder with a stable TUDCA content. Since the co-substrate glucose monohydrate is in excess, the intermediate product T-7-KLCA can be guaranteed to have no residue; at the same time, by utilizing the in-situ regeneration of the coenzyme, there is no need to add the coenzyme NAD, and only a very small amount of NADP needs to be added to obtain in vitro cultured bear bile powder that meets the requirements. In addition, the prepared immobilized whole cells can be recycled for multiple times, and only new immobilized cells need to be added later to ensure that the reaction is qualified. Moreover, compared with the enzyme liquid reaction, chicken bile does not need to be prepared into chicken bile powder first, and the whole cells or immobilized cells can tolerate the refined chicken bile solution containing complex components, and after the whole cell catalysis or immobilized cell catalysis reaction is completed, the cells can be separated by suction filtration, which is easier to separate the products.

[0035] Compared with the prior art, the present invention has at least one of the following technical advantages:

[0036] (1) Concentrated chicken bile is directly used as the catalytic raw material without the need to prepare chicken bile powder.

[0037] (2) The concentration of the reaction substrate TCDCA is 50-100 g / L, reaching the level of large-scale industrial production.

[0038] (3) Only one thousandth of the mass of TCDCA needs to be added as coenzyme NADP.

[0039] (4) No intermediate product T-7-KLCA remains.

[0040] (5) Only one engineered bacterium needs to be fermented.

[0041] (6) Immobilized cells can be reused multiple times.

[0042] (7) After the immobilized cell reaction is completed, it is easier to separate and purify.

[0043] (8) The final TUDCA:TCDCA ratio of bear bile powder is stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a bar graph of 7α-HSDH enzyme activity detection after four enzymes were co-expressed;

[0045] Figure 2 This is a bar graph of 7β-HSDH enzyme activity detection after four enzymes were co-expressed;

[0046] Figure 3 Histogram of LDH enzyme activity detection after co-expression of four enzymes;

[0047] Figure 4 GDH enzyme activity detection bar graph after four enzymes co-expression;

[0048] Figure 5 The SDS-PAGE gel images show the protein expression of four enzyme co-expression strains at different induction times. DETAILED DESCRIPTION

[0049] The present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0050] Example 1: Construction and expression verification of the optimal four-enzyme co-expression strain

[0051] Patent CN202111304130.0 discloses a method for preparing ursodeoxycholic acid. The co-expression vector constructed by this technology contains four independent T7 promoters. In actual operation, it was found that the enzyme activities of 7β and GDH were low, so we optimized the expression of the system. The detailed construction process is as follows:

[0052] 1. Construction of four promoter pRSF-gdh-b-ldh-a vectors

[0053] 1) Overlap PCR to obtain the four enzyme gene fragments: by designing complementary primers downstream of 7β and upstream of LDH, and removing the XhoI restriction site downstream of the 7β gene, the four genes were connected in series; the first round of PCR obtained the GDH-7β gene fragment and the LDH-7α gene fragment respectively: the upstream primer F1 (5'-cgggatccATGCCAGCTCCCTAT-3') for amplifying the GDH-7β gene fragment, the underlined restriction site BamHI, the downstream primer F2 (5'-tcgcgggatcTTAGTTGTTGCTATAGAAGCTACC-3'), and the italics are complementary bases; the upstream primer F3 (5'-CAACAACTAAgatcccgcgaaattaatacg-3') for amplifying the LDH-7α gene fragment, the italics are complementary bases, and the downstream primer is 7α_R. Set up a PCR reaction system of 50 μl: 1 μl each of F1, F2 or F3, 7α_R, 25 μl of 2xDNA polymerase mix, 0.5 μl each of pRSF-GDH-7β or pRSF-LDH-7α plasmid template, and add double distilled water to 50 μl. The PCR program is: 98℃ denaturation for 10s, 55-67℃ (0.4℃) variable temperature annealing for 5s, 72℃ extension for 60s, and 30 cycles. Use 1% agarose gel electrophoresis to cut the gel and recover the target PCR product. The second round of PCR uses the GDH-7β gene fragment and the LDH-7α gene fragment as templates to amplify the GDH-7β-LDH-7α full-length gene fragment: 1 μl each of F1, 7α_R, 25 μl of 2xDNA polymerase mix, 1 μl each of -GDH-7β- or -LDH-7α plasmid template, and add double distilled water to 50 μl. Denature at 98℃ for 10s, anneal at 55-67℃ (0.4℃) for 5s, extend at 72℃ for 60s, and repeat for 30 cycles. Use 1% agarose gel electrophoresis to cut the gel and recover the target PCR product. (Note: The above F3 primer is designed upstream of the T7 promoter of the LDH gene)

[0054] 2) Construction of vector pRSF-gdh-b-ldh-a recombinant vector: pRSFDuet-1 and GDH-7β-LDH-7α fragments were treated with BamHI and XhoI double enzyme 20μl system: 5μl of pRSFDuet-1 and GDH-7β-LDH-7α fragments, 2μl of 10x buffer, 0.5μl of BamHI and XhoI, 12μl of double distilled water. Digestion was performed in a 37℃ water bath for 1h, inactivated at 80℃ for 15min, and then 2μl of 10x loading buffer was added. The digestion products were recovered by 1% agarose gel electrophoresis. The purified plasmid large fragment and GDH-7β-LDH-7α fragment were ligated: 3μl of GDH-7β-LDH-7α fragment and plasmid fragment, 1μl of 10x T4 buffer, 0.5μl of T4 ligase, and 3.5μl of double distilled water. Ligation was performed at 22℃ for 1h. 3 μl of the ligation product was used to transform Top10 competent cells, and the cells were revived for 1 hour and coated with LB solid plates containing 50 μg / ml kanamycin, and cultured at 37°C overnight. Colony PCR verification of transformants was performed using F1 and 7α_R, and the verified transformants were transferred to LB liquid medium (Kan = 50 μg / ml), cultured at 37°C overnight, and the plasmid pRSF-gdh-b-ldh-a was extracted for use.

[0055] 2. Construction of three promoter pRSF-gdh-b-la vectors

[0056] 1) Overlap PCR with pRSF-gdh-b-ldh-a as template: pRSF-gdh-b-ldh-a plasmid template was diluted 10 times and 0.5μl was taken, 10μM primers LA-1 (AAGGAGATATACATATGTTCAACAGCGACAAC) / LA-2 (ATGTATATCTCCTTTTAACCAACTTTCACCGG) were added, 25μl of high-fidelity DNA polymerase mix, 20.5μl of double distilled water, and the total reaction system was 50μl. The PCR program was as follows: 95℃ pre-denaturation for 2min, 94℃ denaturation for 20s, 55℃ annealing for 10s, 68℃ extension for 2.5min, 2-4 steps for 18 cycles, and 68℃ extension for 5min. The PCR product was verified by 1% agarose gel electrophoresis.

[0057] 2) DpnI digestion of PCR product: Take 21.5 μl of PCR product, add 2.5 μl 10x buffer and 1 μl DpnI (10 U / μl), and digest in a 37°C metal bath for 1 h to completely cleave the template plasmid.

[0058] 3) Transformation of competent cells: Add 50 μl Top10 competent cells to 2 μl Dpn I digestion product, mix gently, place on ice for 30 min, heat shock at 42°C for 90 s, place on ice for 2 min, add 700 μl LB medium without antibiotics, incubate at 37°C, 180 rpm for 1 h, take 100 μl of bacterial solution to plate, and incubate at 37°C for 16-20 h.

[0059] 4) Screening of positive strains: Pick 3 single clones from the plate, inoculate into 2ml / 12ml disposable test tubes, and culture at 37℃ overnight; extract plasmids using Tiangen kit, elute with 80μl sterile water in a 55℃ metal bath, and send the plasmids to BGI for sequencing.

[0060] 3. Expression verification of three promoters pRSF-gdh-b-la

[0061] 1) Transformation into expression strain BL21(DE3): Add 50μl BL21(DE3) competent cells to 1μl plasmid, mix gently and place on ice. After 30min of rest, heat shock at 42℃ for 90s. Place on ice for 2min, add 700μl LB medium without antibiotics, incubate at 37℃, 180rpm for 1h, take 100μl bacterial solution and plate, and culture at 37℃ for 16-20h.

[0062] 2) Shake flask culture and induced expression: 1:100 transfer 50ml / 250ml LB liquid medium, OD600 = about 0.6, add inducer to 0.5mM, induce at 25℃ for 16h, measure OD600 after induction (dilute 5 times for detection), take 2ml of bacterial solution and centrifuge at 12000rpm for 2min, collect bacteria, and store at -20℃.

[0063] 3) Enzyme activity detection: add about 180μl PBS to resuspend, then add about 20μl 2% lysozyme, lyse at 35℃ for 1h, centrifuge at 12000rpm for 5min, and measure the enzyme activity of the supernatant. The enzyme activity detection method is as follows: in a 3ml cuvette, add 1.948ml of 10mM CDCA / 7KLCA (pH8.0, containing 100mM PBS) or sodium pyruvate / glucose incubated at 35℃, and then add 50μl of 5mg / ml coenzyme NAD(P) or NAD(P)H, mix well, add 2μl prepared enzyme solution, mix well with a 1000ml pipette, and read the change in absorbance for 2min. Enzyme activity (U / mL) = △OD / min*total volume*dilution factor / (6.22*1.0*enzyme solution volume). The enzyme activity data of the four enzymes induced by different strains are shown in the figure. Figure 1 As shown, strain f is the optimal strain BL21 (DE3) / pRSF-gdh-b-la constructed, which contains 3 promoters.

[0064] 4) 12% SDS-PAGE to detect protein expression: The preparation of separation gel and stacking gel refers to the "Molecular Cloning Experiment Guide", set the stacking gel electrophoresis voltage to 80V, the electrophoresis time to 20min, the separation gel to 120V, the electrophoresis time to 1-1.5h, Coomassie Brilliant Blue R-250 staining for about 2h, and decolorization with decolorizing solution for 2-4h. The protein expression of the four enzymes after BL21(DE3) / pRSF-gdh-b-la induction expression is as follows Figure 2 shown.

[0065] Example 2: High-density fermentation of four-enzyme co-expressing strain

[0066] 1. 5L fermentation tank fermentation process

[0067] 1) Activation of bacterial strains: streak LB solid culture medium (Kan = 50 μg / ml) on a plate stored at -80°C and culture at 37°C overnight for 16-24 hours.

[0068] 2) Primary seed liquid culture: Pick a single colony and inoculate it into 100 ml TB medium (Kan = 50 μg / ml, 500 ml conical flask), culture overnight at 37° C., 200 rpm for 15-20 h, OD600 = 4.0-6.0.

[0069] 3) Secondary seed solution culture: Transfer the primary seed solution to 120 ml TB medium (Kan = 50 μg / ml, 500 ml conical flask) at a ratio of 1:50, and culture at 37° C., 250 rpm for 2-4 h, OD600 = 1.5-3.0.

[0070] 4) TB medium formula: 12 g / L tryptone, 24 g / L yeast extract, 16.4 g / L K2HPO42.32 g / LKH2PO4, 5 g / L glycerol.

[0071] 5) Fermentation in a 5L fermenter: Transfer the secondary seed solution to a 3L fermentation medium (Kan=50μg / ml) at an inoculum volume of 4%, with an initial temperature of 37°C and an initial pH of 7.0. Initial speed 150rpm, initial ventilation 1.5L / min. Maintain cultivation until the dissolved oxygen is less than 30%, increase the speed or ventilation, maintain cultivation until the dissolved oxygen is less than 30%, and adjust the speed or ventilation again. In this way, the speed and ventilation are alternately adjusted to control the dissolved oxygen and culture for 5-8h until the dissolved oxygen is finally stable. Finally, maintain the speed at 700-750rpm and the ventilation at 6-8L / min to maintain cultivation. Wait for the dissolved oxygen to rise again to 60%-70%. Start feeding, and control the dissolved oxygen in the range of 20%-40% by the feeding rate (approximately 25s-30s for one second of feeding). This state is maintained until the OD600 value reaches about 40, then the temperature is lowered to 30°C, and 0.1g / L IPTG is added for induction. At this time, the dissolved oxygen is controlled within the range of 30%-40% by controlling the feeding rate. In the later stage, the pH of the fermentation liquid is automatically controlled at 7.0 by adding ammonia water. The enzyme activity is tested every 2 hours, and the fermentation liquid is removed from the tank when the enzyme activity reaches its peak.

[0072] 6) Feed medium: 600 g / L glycerol, 30 g / L yeast powder, 30 g / L peptone.

[0073] 7) Enzyme activity monitoring: 50 ml of fermentation broth was collected every 2 h during the induction period from 2 to 20 h, and the cells were collected by centrifugation at 8000 rpm for 10 min. 150 ml of PBS buffer (100 mM, pH 8.0) was added to resuspend the cells, and ultrasonically disrupted at 80% power for 10 min. The supernatant was centrifuged at 10000 rpm to detect enzyme activity.

[0074] 2. Fermentation production in 200L fermentation tank

[0075] 1) Activation of bacterial strains: streak LB solid culture medium (Kan = 30 μg / ml) on a plate stored at -80°C and culture at 37°C overnight for 16-24 hours.

[0076] 2) Primary seed liquid culture: Pick a single colony and inoculate it into 2 bottles of 200 ml / 1L TB medium (Kan=30 μg / ml, 1000 ml conical flask), culture overnight at 37°C, 200 rpm for 15-20 h, OD600=4.0-6.0.

[0077] 3) Secondary seed solution culture: The primary seed solution was transferred to a 30 L seed tank containing 12 L TB medium (Kan = 30 μg / ml), and cultured at 37° C. and 250 rpm for about 6 h until OD600 = 4.0-8.0.

[0078] 4) TB medium formula: 12 g / L tryptone, 24 g / L yeast extract, 16.4 g / L K2HPO42.32 g / LKH2PO4, 5 g / L glycerol.

[0079] 5) Fermentation in a 200L fermenter: Transfer the secondary seed liquid to a 200L fermenter with a liquid volume of 120L (the culture medium in the fermenter is sterilized in a real tank, the sterilization temperature is 121°C, and the sterilization time is 30min) according to an inoculation volume of 4% for cultivation (Kan = 30μg / ml). Initial temperature 37°C, initial pH 7.0. Initial speed 120rpm, initial ventilation 10L / min. Maintain cultivation until the dissolved oxygen is less than 30%, increase the speed or ventilation, maintain cultivation until the dissolved oxygen is less than 30%, and adjust the speed or ventilation again. In this way, the speed and ventilation are alternately adjusted to control the dissolved oxygen and culture for 5-8h until the dissolved oxygen is finally stable. Finally, maintain the speed at 350-400rpm and the ventilation at 30-40L / min to maintain cultivation. Wait until the dissolved oxygen rises again to 60%-70%. Start feeding, and control the dissolved oxygen in the range of 20%-40% by feeding rate. This state is maintained until the OD600 value reaches about 40, then the temperature is lowered to 30°C, and 0.1g / L IPTG is added for induction. At this time, the dissolved oxygen is controlled in the range of 30%-40% by controlling the feeding rate. In the later stage, the pH of the fermentation liquid is automatically controlled at 7.0 by adding ammonia water. The enzyme activity is tested every 2 hours, and the concentrated liquid bacteria are stored in PBS buffer at -20°C for future use.

[0080] 6) Feed medium: 600 g / L glycerol, 30 g / L yeast powder, 30 g / L peptone.

[0081] 7) Enzyme activity monitoring: 50 ml of fermentation broth was collected every 2 h during the induction period from 2 to 20 h, and the cells were collected by centrifugation at 8000 rpm for 10 min. 150 ml of PBS buffer (100 mM, pH 8.0) was added to resuspend the cells, and ultrasonically disrupted at 80% power for 10 min. The supernatant was centrifuged at 10000 rpm to detect enzyme activity.

[0082] Example 3 Preparation of Chicken Bile

[0083] Purchase chicken bile from the market, thaw it, break the bile, filter it to get the filtrate, concentrate the filtrate, add ethanol and stir it, centrifuge it to remove the precipitate, and get the supernatant. Concentrate the supernatant until it has no alcohol taste, which is the chicken bile required for the experiment.

[0084] In this embodiment, 25 kg of thawed chicken gall is taken, cut with a meat grinder, filtered with an 80-mesh stainless steel filter to obtain a filtrate, the filtrate is distilled at 60°C under reduced pressure for about 3-6 hours, water is removed to 1 / 2 of the original volume, 3 times the volume of 95% ethanol is added, mixed, stirred at 20-35°C for 3 hours, centrifuged at 3800 rpm for 5 minutes to remove the precipitate, and the protein and fat in the bile are separated. The supernatant is dehydrated at 40-45°C to a paste to obtain chicken bile. Using HPLC-DAD, referring to the detection method of "Determination of the Content of Multiple Conjugated Bile Acids in Bear Bile Powder by One Test and Multiple Evaluation Method" by Li Xiaoqiong et al., and according to the "Chinese Pharmacopoeia (2015)" (GBT16631-2008 General Rules for High Performance Liquid Chromatography), the TCDCA content in chicken bile is 22.5%.

[0085] Example 4: Whole-cell catalysis of a four-enzyme co-expressing strain

[0086] The process of converting chicken bile into bear bile powder is as follows: chicken bile is taken to make its TCDCA substrate concentration 50-125g / L, 30-100g / L of frozen or freshly prepared four-enzyme co-expression bacteria is added, 0.04-0.06 times the weight of chicken bile is added with sodium pyruvate, 0.1-0.15 times the weight of chicken bile is added with glucose, 75mM phosphate buffer (pH8.0, 75mM) is added to the required volume, the temperature is controlled at 20-30°C, the rotation speed is 300-500rpm / min, the reaction is carried out for 3-24h, and the reaction liquid is obtained after the conversion is completed. 0-0.05g / L of NADP coenzyme or 0-1ml / L of surfactant is added to the system, or 4M NaOH is used to monitor the pH to 6.5-8.5 throughout the reaction process. Any of the above methods or combined use can accelerate the reaction and shorten the time required for the reaction. A transformation solution with TUDCA:TCDCA=1.3-1.6 and no residual T-7-KLCA was obtained.

[0087] The reaction solution after the conversion is centrifuged or filtered to remove the precipitate, the supernatant is concentrated under reduced pressure, ethanol is added to the concentrated solution system, centrifuged again, the filtrate is passed through a macroporous adsorption resin, impurities are eluted with 0-60% ethanol in turn, and finally the product is eluted with anhydrous ethanol. The product is concentrated under reduced pressure and freeze-dried to obtain a preliminary product of in vitro cultured bear bile powder, and 0.4% bilirubin is added to obtain a fine product of in vitro cultured bear bile powder.

[0088] In this embodiment, the specific operation is as follows: 200g chicken bile is added to phosphate buffer (pH8.0, 75mM), pH is adjusted to 8 with 4M NaOH, 50g bacterial cells are added, 8g sodium pyruvate, 24g glucose, 75mM phosphate buffer (pH8.0, 75mM) is added to 1L, the temperature is controlled at 28°C, the speed is 500rpm / min, the reaction pH is monitored at 7.0, the reaction is carried out for 24h, samples are taken during the reaction, diluted 300 times with methanol, and HPLC is used for detection. The reaction is terminated when no T-7K residue is detected. After the reaction, the reaction solution was centrifuged at 6000rpm, the supernatant was concentrated, 2.5 times the mass of anhydrous ethanol was added to the concentrated solution system, heated to 65°C and stirred for more than 2h, and then the filtrate was collected by centrifugation at 10000rpm, the filtrate was passed through a macroporous adsorption resin, the feed rate was controlled at 1.5BV / h, the impurities were first eluted with 1BV purified water, and then with 3BV low-concentration 50% ethanol, and finally the product was eluted with about 3BV of anhydrous ethanol. The product was concentrated and the vacuum degree was controlled at 0.10Mpa, the temperature was raised to 40°C, and the concentrated solution was concentrated under reduced pressure until there was no ethanol in the concentrated solution. The secondary concentrated feed liquid was transferred to a freeze dryer, the low temperature was set to ≤-40°C, pre-frozen for 6h, and continued to be dried under reduced pressure for 15h to obtain the initial product of in vitro cultured bear bile powder, and 0.4% bilirubin was added to obtain the fine product of in vitro cultured bear bile powder. Using HPLC-DAD, referring to the detection method of "One Test and Multiple Evaluation Method for Determination of the Content of Various Conjugated Bile Acids in Bear Bile Powder" by Li Xiaoqiong et al., and in accordance with the "Chinese Pharmacopoeia (2015)" (GBT16631-2008 General Rules for High Performance Liquid Chromatography), the detection was carried out. The TUDCA content in the in vitro cultured bear bile powder in this example was 32.77%, the TCDCA content was 24.07%, and T-7-KLCA was not detected.

[0089] The reaction solutions of Examples 5 to 8 and the preparation process of in vitro cultured bear bile powder are the same as those of Example 4, except for the selection of specific parameters, as shown in Table 1.

[0090] In Example 5, 0.04 g / L of coenzyme NADP was added, which greatly accelerated the reaction. The system setting of Example 6 is based on Example 5, and 1% volume of 4M NaOH is added at the beginning of the reaction, and the pH is not monitored throughout the process. Example 7 adds 0.02 g / L of coenzyme NADP on the basis of Example 4, without the need to add alkali and monitor pH. Example 8 adds 1 / 1000 of Triton100 on the basis of Example 7. Example 9 is the substrate concentration ramping experiment of Example 5. Example 10 does not add coenzyme NADP, but only adds 1 / 1000 of Triton100. At the same time, it is necessary to monitor the pH value in real time and adjust the pH value to 7.0 (at least maintain it between 6.5-8.5). Example 11 is a dosage ramp of the substrate concentration of Example 10, and it is necessary to monitor the pH in real time.

[0091] Table 1: Parameter selection list of Examples 4-11 and Comparative Examples 1-3

[0092]

[0093] The reaction system settings of Comparative Examples 1 to Comparative Examples 4 and the preparation process of in vitro cultured bear bile powder are the same as those of Example 4, except for the selection of specific parameters, as shown in Table 1. Comparative Example 1 is a substrate concentration ramping experiment of Example 4. In Comparative Example 2, the reaction system set up with reference to Chinese Patent CN102994604A. The enzyme solutions used are NADP-dependent 7α-hydroxysteroid dehydrogenase and NADPH-dependent and 7β-hydroxysteroid dehydrogenase, respectively. The specific process is: 125g of bacterial cells are diluted 5 times by ultrasonic crushing to obtain enzyme solution, and the enzyme activity detection method is the same as that of Example 2, so that the enzyme activity of the reaction system is 30U / ml and 50U / ml respectively. Because there are no LDH and GDH coenzymes, there is no need to add cosubstrate, but the amount of NADP is increased to 0.7g / L. Comparative Example 3 sets up the system with reference to Chinese Patent CN111407780A. The difference from Comparative Example 2 is that two bacterial cells are put into the preparation of enzyme solution in Comparative Example 3, and they are added to a final concentration of 2.5g / L. Since the coenzyme regeneration enzyme GDH was not used in Comparative Examples 2 and 3, no gluconic acid byproduct was produced, so there was almost no change in pH value throughout the process and no real-time monitoring was required.

[0094] The in vitro cultured bear bile powder prepared in Examples 1 to 11 and Comparative Examples 1 to 3 was tested by HPLC, and the results are shown in Table 2. It can be seen from the experimental results that, except for Comparative Examples 1 and 3, the content ratios of TUDCA and TCDCA in the in vitro cultured bear bile powder prepared in Examples 1 to 11 and Comparative Example 2 are in line with the content ratio range of natural bear bile powder (TUDCA: TCDCA = 1.0-1.5), and the content of TUDCA meets the requirements of the Chinese Pharmacopoeia (2015) for bear bile powder. No intermediate product T-7-KLCA was detected in Examples 4 to 11, and there were residual intermediate products in Comparative Examples 1 to 3, with the ratios of 13.40%, 2.69%, and 2.55%, respectively. It is shown that the whole cell catalytic process of the four-enzyme co-expression strain of the present invention has high bioconversion efficiency, and the quality of the final product obtained is guaranteed. Comparative Example 1 is the dose ramp of Example 4. Since NADP coenzyme and Triton 100 were not used, a large amount of T-7-KLCA remained in the reaction intermediate, resulting in an unsatisfactory TUDCA / TCDCA ratio.

[0095] Table 2: HPLC test results

[0096]

[0097] Example 12: Immobilized whole-cell catalysis of four-enzyme co-expressing strain

[0098] 1. Preparation of immobilized cells

[0099] Take 100g of bacterial sludge expressing 7α-HSDH, 7β-HSDH, LDH and GDH by high-density fermentation, add 1L phosphate buffer (pH8.0, 75mM), stir well at 300-500rpm for 0.5-1h; then add 10g diatomaceous earth and continue stirring for 0.5-1h; then add 10ml diluted PEI (pH7.0, 10%) mother solution, cross-link for 0.5-1.5h; finally add 10ml 25% glutaraldehyde, cross-link for 0.5-1h. After the cross-linking is completed, the immobilized cells are separated from the solid by vacuum filtration, and the filter cake cells are washed 3 times with phosphate buffer (pH8.0, 75mM). The final immobilized cells have a wet weight of about 150g, are dark red in color, and are stored at -20°C for standby use.

[0100] Immobilized whole cell enzyme activity assay

[0101] Different from the enzyme activity detection method of enzyme solution, the immobilized cell detection method is as follows: 9.5ml of phosphate buffer (pH8.0, 75mM), add 0.5ml of substrate (10mM CDCA or 7K-LCA, 100mM sodium pyruvate or glucose), then add 100μl of coenzyme NAD(P) or NAD(P)H (5mg / ml), and finally add 20mg of immobilized whole cells (no addition for blank control), the positive control is 20mg of bacterial mud, incubate on a shaker at 37℃ for 10min, and measure with a UV spectrophotometer.

[0102] 3. Immobilized whole-cell catalysis

[0103] According to the optimized whole-cell catalytic conditions in Examples 4-11, the production cost, production efficiency, impurity situation and actual operability were comprehensively compared, and the immobilized whole-cell catalytic conditions were as follows: chicken bile paste concentration 320 g / L (TCDCA final concentration 72 g / L), sodium pyruvate 11.1 g / L, glucose monohydrate concentration 37 g / L, NADP concentration 72 mg / L, Triton 100 concentration 1 ml / L, immobilized cells 100 g / L, phosphate buffer (pH 8.0, 75 mM) was supplemented to the required volume of the system, the reactor stirring speed was set to 300-500 rpm, and the reaction pH was controlled to 6.5-7.5 with 4 M NaOH.

[0104] The small-scale immobilized whole-cell catalysis is specifically implemented as follows: take 320g of chicken gall paste, 11.1g of sodium pyruvate, 37g of monohydrate glucose, add part of the phosphate buffer (pH8.0, 75mM), stir evenly at 300rpm, then add Triton 1001ml and 72mgNADP, and finally add 100g of newly prepared immobilized cells or 100g of used immobilized cells (Note: 20g of newly prepared immobilized cells are required to be added to the used immobilized cells), and add the remaining phosphate buffer (pH8.0, 75mM) to 1L. Set the stirring speed to 500rpm, monitor the pH at the same time, and adjust the initial reaction pH to 6.80 with 4M NaOH alkali solution. Monitor the pH of the reaction solution every 0.5h, and adjust the pH to 6.80±0.2 with 4M NaOH until the pH is almost unchanged, indicating that the reaction is over. HPLC detects the content of each component in the reaction solution, and terminates the reaction when the test results show that there is no T-7KLCA residue.

[0105] After the reaction is completed (5-6h), the reaction solution is vacuum filtered, and the immobilized cells are washed twice with phosphate buffer (pH8.0, 75mM), and the immobilized cells are collected and put into the next batch of catalysis. Since some cells will be broken during the reaction, resulting in partial enzyme activity loss, the immobilized cells are reduced. In order to maintain sufficient enzyme activity for the reaction, 20% of newly prepared immobilized cells need to be added for each batch of immobilized cells to re-react. The test results of 8 batches of immobilized cells are shown in Table 3.

[0106] Table 3: Results of multiple HPLC tests using immobilized cells

[0107]

[0108] The immobilized cells are recycled at least 4 times to ensure that there is no intermediate product T-7-KLCA residue in the in vitro cultured bear bile powder. From the fifth use, T-7-KLCA begins to remain, but TUDCA / TCDCA is still within the ratio range of natural bear bile powder. Although the four enzymes that catalyze the reaction are in the E. coli cells, the various components in the reaction system still have an effect on their enzyme activity, especially 7β with poor stability. Therefore, as the number of uses of the immobilized cells increases, the enzyme activity of 7β is gradually lost, which is not enough to completely convert the second step reaction, and the intermediate product T-7-KLCA begins to be produced. The process of preparing in vitro cultured bear bile powder by post-treatment of the reaction solution is the same as that of Examples 4-11 above. From our implementation results, the recycling of immobilized cells is feasible, and at least 3-4 uses can obtain ideal in vitro cultured bear bile powder without T-7-KLCA residue.

[0109] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the present invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A method for preparing bear bile powder cultivated in vitro, characterized in that: The preparation method comprises the following steps: 1) Preparation of reaction substrate: prepare chicken bile purified concentrate and detect the content of TCDCA therein, which is 20-30%; 2) Construction of four enzyme co-expression strains: 7α-HSDH, 7β-HSDH, lactate dehydrogenase (LDH) and glucose dehydrogenase (GDH) were constructed on the same co-expression vector according to a certain gene order, and the co-expression vector was transformed into an Escherichia coli host (BL21); 3) Preparation of immobilized cells: Weigh the E. coli engineering bacteria expressing four enzymes, 7α-HSDH, 7β-HSDH, LDH and GDH, add 5-10 times the mass of pH 7.0-8.0 buffer and stir well, then add diatomaceous earth, polyethyleneimine (PEI) and glutaraldehyde respectively for cross-linking and fixation, filter to obtain the prepared immobilized cells, and store at -20°C for future use; 4) Catalysis: Mix the chicken bile extract with the four-enzyme co-expressing bacterial sludge or its immobilized cells, then add NADP coenzyme, surfactant, and a fixed ratio of co-substrates sodium pyruvate and glucose monohydrate, and catalyze the reaction at 25-30°C for 2-24h; 5) Preparation of bear bile powder: The qualified conversion liquid is subjected to a first concentration, alcohol precipitation, macroporous adsorption separation, second concentration, and freeze-drying purification process to obtain primary in vitro cultured bear bile powder, to which bilirubin is added to reach the required content of 0.4%, thus becoming a high-quality in vitro cultured bear bile powder.

2. The method for preparing in vitro cultured bear bile powder according to claim 1, characterized in that: The step 1) of preparing the reaction substrate specifically comprises: selecting chicken bile, breaking the bile and obtaining bile to obtain chicken bile; concentrating the chicken bile to 50% of the original volume to obtain concentrated chicken bile, and the concentration temperature is 70° C.; performing alcohol extraction on the concentrated chicken bile, cooling the concentrated chicken bile to 30° C., adding 3 times the volume of 95% ethanol to the concentrated chicken bile, and then stirring for 200 minutes; maintaining the temperature of the concentrated chicken bile at 4° C. after stirring, centrifuging at a speed of 3500 rpm for 25 minutes, each centrifuging for 5 minutes, and centrifuging for 5 times; After centrifugation, the supernatant was taken and concentrated twice, with a concentration time of 40 minutes and a concentration temperature of 45° C. to obtain a chicken bile purified liquid, and the TCDCA content was 20-30% as detected by HPLC.

3. The method for preparing in vitro cultured bear bile powder according to claim 1, characterized in that: In the step 2), the four enzymes 7α-HSDH, 7β-HSDH, LDH and GDH are obtained, wherein 7α-hydroxysteroid dehydrogenase (7α-HSDH) is derived from Escherichia coli, lactate dehydrogenase (LDH) is derived from Lactobacillus, 7β-hydroxysteroid dehydrogenase (7β-HSDH) is derived from Ruminococcus gnavus, and glucose dehydrogenase (GDH) is derived from Bacillus subtilis; In the step 2), the gene sequence is 7α-HSDH, 7β-HSDH, LDH and GDH in series, and the corresponding genes are expressed in sequence according to the central dogma of genetics until all four genes are expressed. The preferred sequence is GDH, 7β-HSDH, LDH and 7α-HSDH.

4. The method for preparing in vitro cultured bear bile powder according to claim 3, characterized in that: The co-expression vector in step 2) includes one of pRSFDuet-1, pETDuet-1, pACYCDuet-1, and pCOLADuet-1.

5. The method for preparing in vitro cultured bear bile powder according to claim 1, characterized in that: The promoter for gene expression regulation in step 2) is a T7 strong promoter, and the number of promoters is 2, 3, or 4.

6. The method for preparing in vitro cultured bear bile powder according to claim 1, characterized in that: The buffer in step 3) is phosphate buffer, Tris-HCl buffer, glycine-sodium hydroxide, or boric acid-sodium hydroxide buffer.

7. The method for preparing in vitro cultured bear bile powder according to claim 1, characterized in that: In the step 4), the TCDCA concentration of the reaction system is 50-100 g / L, the amount of bacterial sludge is 30-50 g / L or the amount of immobilized cells is 50-100 g / L, the amount of coenzyme NADP is 0.02-0.2% of the mass of TCDCA, the surfactant is one of Triton X-100, Tween, and Span, and the added amount is 0.1%-0.5% of the total reaction system, the amount of cosubstrate sodium pyruvate is 0.65-0.75 times the molar amount of TCDCA, and the amount of glucose monohydrate is 1.0-2.0 times the molar amount of TCDCA. In the step 4), the immobilized cells are recycled 5-10 times.

8. The method for preparing in vitro cultured bear bile powder according to claim 1, characterized in that: In the step 5), the primary concentration is to control the vacuum degree to 0.05-0.10Mpa, heat to 60-70°C, and concentrate under reduced pressure to 1 / 4 of the initial volume before the end. The alcohol precipitation is to add 2.5-3.0 times the mass of anhydrous ethanol or 95% ethanol to the primary concentrated liquid system, heat to 60-70°C and stir for more than 2h, then collect the filtrate through centrifugation at 10000-140000rpm, and the filter cake is the waste impurity. The macroporous adsorption separation is to concentrate the supernatant filtrate after alcohol precipitation to a solid content of 65-75%, add one time of purified water to dilute it, and then pass it through the activated macroporous adsorption resin, control the feed rate to be less than 1.5BV / h, first use 1BV of purified water to elute impurities, then use 2-3BV of low concentration 40-60% ethanol to elute impurities, and finally use about 3BV of anhydrous ethanol to elute the product, and detect the target product in real time. In the step 5), the vacuum degree of the secondary concentration is controlled at 0.05-0.10 MPa, the temperature is raised to 40-60° C., and the concentrated solution is concentrated under reduced pressure until no ethanol is present in the concentrated solution.

9. The method for preparing in vitro cultured bear bile powder according to claim 8, characterized in that: In the step 5), freeze drying is to transfer the secondary concentrated liquid to a freeze dryer, set the low temperature to ≤-40°C, pre-freeze for more than 6 hours, and then continue to reduce the pressure and dry for 10-15 hours to obtain the primary product of in vitro cultured bear bile powder, and add 0.4% bilirubin to obtain the fine product of in vitro cultured bear bile powder.

Images