Screening method of rape germplasm capable of efficiently utilizing nitrogen and application of screening method

Abstract

The invention provides a screening method for oilseed rape germplasm capable of efficiently utilizing nitrogen and application of the screening method, and belongs to the technical field of biologication.The screening method comprises the steps that firstly, three genes with the expression quantity obviously induced by nitrogen and having extremely obvious positive correlation with biomass increment are found through transcriptome and population verification, and the genes are determined to be specific nitrogen response genes, namely marker genes; the method comprises the following steps: detecting marker gene expression and overground part biomass increment to quickly screen rape germplasm capable of efficiently utilizing nitrogen, performing nitrogen treatment by using a Hoagland nutrient solution with high nitrogen content and relatively low nitrogen content, and detecting the expression quantity of marker genes in a high-nitrogen group and a low-nitrogen group and the dry weight of the overground part; when the homogenized expression quantity of the three efficient nitrogen genes in the leaves is increased by more than 4 times (high nitrogen / low nitrogen), and the biomass of the overground part is 100% higher than that of the contrast, the rape belongs to the rape with efficient nitrogen utilization; the detection method is combined with molecular detection, is high in accuracy and specificity, and can be used for rapidly screening nitrogen and efficiently utilizing rape resources.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically refers to a screening method for rapeseed germplasm with high nitrogen utilization efficiency and application thereof. Background Art

[0002] Nitrogen is the mineral element with the largest demand from plants and one of the most important factors in increasing crop yields. The large-scale application of nitrogen fertilizer not only increases agricultural production costs, but more importantly leads to a series of environmental disasters including climate change (ammonia release), soil acidification and water eutrophication. Therefore, improving the nitrogen fertilizer utilization efficiency of crops has always been an important topic in crop genetic improvement research.

[0003] Breeding varieties with efficient nitrogen utilization is the most economical and effective way to improve the nitrogen fertilizer utilization rate of crops. Studies have shown that there are large genetic differences in nitrogen absorption and utilization efficiency of the same crop. Rapeseed is one of the most important oil crops in the world and also a crop with a large amount of nitrogen fertilizer application. However, there are large differences in nitrogen absorption efficiency between different varieties. Therefore, clarifying the genetic differences in nitrogen utilization efficiency of different germplasm materials and developing molecular markers for efficient nitrogen utilization are the basis for analyzing the molecular mechanism of nitrogen utilization in rapeseed and creating materials for efficient nitrogen utilization. It is of great significance to improve the nitrogen efficiency of rapeseed and improve the economic and ecological benefits of rapeseed production. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a method for screening rapeseed germplasm with high nitrogen utilization efficiency and its application, in order to improve the screening efficiency and shorten the breeding cycle.

[0005] To achieve the above objectives, this scheme first provides a method for screening rapeseed germplasm with high nitrogen utilization efficiency, comprising the following steps:

[0006] S1. Plant the test seeds of the tested variety in a matrix pot, place the matrix pot in a tray, add Hoagland nutrient solution to the tray, divide the pot into two culture groups, a full nitrogen Hoagland nutrient solution and a low nitrogen Hoagland nutrient solution, and culture them in a greenhouse for four weeks. In the second week, the expression levels of nitrogen efficient utilization marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS in the leaves of the full nitrogen culture group and the low nitrogen culture group are detected by real-time fluorescence quantitative PCR technology. In the fourth week, the nitrogen application increment of the aboveground biomass is determined;

[0007] The sequence of BnaA01G0394400ZS is shown in SEQ ID NO.1;

[0008] The sequence of BnaA09G0693100ZS is shown in SEQ ID NO.2;

[0009] The sequence of BnaC08G0274600ZS is shown in SEQ ID NO.3;

[0010] S2. Screening of rapeseed germplasm with high nitrogen utilization efficiency: Based on the gene expression and nitrogen increment of aboveground biomass, a comprehensive evaluation is conducted using the weighted scoring method or cluster analysis method. Varieties that meet the following two conditions are considered rapeseed germplasm with high nitrogen utilization efficiency:

[0011] (1)Eave.=(1.2×EBnaA01+1.4×EBnaA09+EBnaC08) / 3, Eave.≥4;

[0012] Wherein, EBnaA01 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA01G0394400ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0013] EBnaA09 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA09G0693100ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0014] EBnaC08 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaC08G0274600ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0015] Eave. is the weighted average expression of the three genes;

[0016] (2) The nitrogen increment of aboveground biomass>100%, wherein the nitrogen increment=(biomass of full nitrogen culture group-biomass of low nitrogen culture group) / biomass of low nitrogen culture group.

[0017] Preferably, the variety to be tested in step S1 is selected from Brassica napus.

[0018] Preferably, the substrate in step S1 is quartz sand and vermiculite in a volume ratio of 1:1, the aboveground part includes leaves and stems, and the biomass is measured by dry weight.

[0019] Preferably, in the step S1, the total nitrogen in the full nitrogen Hoagland nutrient solution is applied in the form of potassium nitrate, and the total nitrogen concentration is 10 mM, and the low nitrogen in the low nitrogen Hoagland nutrient solution is applied in the form of potassium nitrate, and the low nitrogen concentration is 1 mM.

[0020] Preferably, the cultivation conditions in the greenhouse in step S1 are 25° C., 20,000 lux light intensity for 18 hours, 6 hours in darkness, and 70% humidity.

[0021] Based on a general inventive concept, this solution also provides an application of a screening method in the rapeseed nitrogen utilization industry.

[0022] The screening method of this program is as follows:

[0023] This scheme provides a method for quickly screening rapeseed germplasm with efficient nitrogen utilization by detecting the expression of specific nitrogen response genes and aboveground biomass. The screening method is to culture the rapeseed to be tested with a 1:1 mixed culture of quartz sand and vermiculite to provide mechanical support and certain water retention and air permeability, and use nitrogen-containing and low-nitrogen Hoagland nutrient solutions for nitrogen treatment, and calculate the biomass, nitrogen transport and utilization gene expression changes and the correlation with biomass.

[0024] Through transcriptome and population verification, we found that the expression levels of three genes increased significantly in all treatment groups, and the expression levels were extremely significantly positively correlated with biomass. When the normalized expression levels of these three nitrogen-efficient genes in the leaves increased by more than 4.00 times (high nitrogen / low nitrogen) and the aboveground biomass was higher than 100% of the control, it was considered as rapeseed with efficient nitrogen utilization.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) Through transcriptome and population verification, this scheme found that the expression levels of three genes in all treatment groups increased significantly, and the expression levels were extremely significantly positively correlated with biomass, confirming that these genes are marker genes for efficient nitrogen utilization.

[0027] (2) This detection method combines molecular detection with biomass detection, has high accuracy and specificity, and can quickly screen rapeseed resources for efficient nitrogen utilization. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 The expression difference of marker genes of each strain in Example 2;

[0030] Figure 2 The expression differences of marker genes in different strains in Example 3 are shown. DETAILED DESCRIPTION

[0031] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0032] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0033] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0034] Example 1

[0035] Screening of marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS

[0036] The transcriptomes of high- and low-nitrogen efficiency strains were measured, and genes that were differentially expressed in both high- and low-nitrogen strains and whose expression changes (Log2FoldChange(HN / LN)) in high-nitrogen efficiency strains were greater than those in low-nitrogen efficiency strains were selected (gene pool A);

[0037] Ten strains of known nitrogen-efficient and nitrogen-inefficient strains were selected to form a mixed pool. BSR-seq was performed on the mixed pool to obtain the significant up-regulated expression of HN / LN (Log 2 FoldChange(HN / LN)≥2) (gene pool B).

[0038] Gene pool A and pool B were intersected to obtain gene pool C. Specific genes were randomly selected from the gene pool as candidate genes. For material lines with known nitrogen utilization efficiency (aerial dry weight increment), qRT-PCR was used to detect the expression of the candidate gene. It was determined that the gene expression increment (Log2FoldChange(HN / LN)) was positively correlated with the aboveground dry matter increment ((HN-LN) / LN), that is, the greater the aboveground increment, the greater the gene expression increment. If this condition is met, the gene is determined to be a nitrogen efficient utilization marker gene.

[0039] Based on the above screening method, this scheme obtained three marker genes: BnaA01G0394400ZS, BnaA09G0693100ZS, and BnaC08G0274600ZS;

[0040] The sequence of BnaA01G0394400ZS is shown in SEQ ID NO. 1;

[0041] ATGGAAAATTCTGCAAAGACCCAAATTAAATACGTGAAAGCCGAGGATTTTTTCACTTCCGGATTAAGCATCGCGGGAAACACCATAAACCGTGTCGGCTCCAACGTTACCAACGTCAACGTCAACGTCGACAAGATCCCTGGACTCAACACTCTCGGAGTTTCTCTTGTCCGTATTGACTTTGCCCCAGGGGGTCAAAAGAGGAATGATACATTTTCAAGTGAACGTTGGGAGGACGAACGCGGTTGCGTTTGCTGGTCTAGGAAGCCAGAACCCCGGTACAATCACAATCGCGGAAGCTGTTTTTGGTTCGAAGCCTTTGATCATGCCGGAGATTTTAGCGTTTCAGCTGGATGTCAACATGGTTAG(SEQID NO.1);

[0042] The sequence of BnaA09G0693100ZS is shown in SEQ ID NO.2:

[0043]

[0044] The sequence of BnaC08G0274600ZS is shown in SEQ ID NO.3 as follows:

[0045] ATGACACAGTCTTCTCTATTAGGAGAACTTGAGGTTGAAGTCGAGATCAAATCTCCCGCGGAGAAGTTCTACCACATGTACGCCGGAAGACCGCATCATGTGGCCAAATCCACTCCACGCAATGTGCAGGCATGTGATCTGCACGACGGAGAATGGGGCGAAGTTGGCAGTATTATATTTTGGAACTACGTTCATGGTATTTATGCTAGAATATTGTATACTATAGTTGGGAATACATGCATAATACTAACGAGGAATTTACCTATTGAATAAAACTCTTGGATCAGACACATAACTTTCTCGTCATTCAAAAAAATACATGCATAATATTGGTGTAATAAGATACAATATTTTGATCGGTAAACGGTTCGTTTTGGGTGTAGATGGACAAGCCAGAGTGGCGAAAGAGAGGATCGAAGTGGTGGAACCTGAGAAGAAAATTGTGAAGTTTAGGGTTTTAGAGGGAGATCTGATGGAAGAGTTCAAGAGCTTTGTGATTACGATTCAGGTAACCCCCAAGCAAGGAGGAAATGGAAGTATTGTGAAGTGGCACTTCGAGTATGAGAAGATTGATGAGAACATTTCTCACCCTGAGACTTTGCTCCCTTTCTTTGCTGATATGATCAAAGAGATCGACGAACACCTCTTGTCCGAGGAATAG(SEQ ID NO.3);

[0046] Example 2

[0047] Feasibility verification of population verification marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS and establishment of screening methods

[0048] S1. Take 10 bagged self-pollinated rapeseed seeds of different varieties (planted in the experimental field of Hunan Institute of Crop Science), disinfect their surfaces with 75% ethanol for 2 minutes, and soak them in clean water for 24 hours. Disinfect their surfaces with 5% ethanol for 2 minutes, and soak them in clean water for 24 hours.

[0049] S2. Plant the treated seeds in square pots (10 cm × 10 cm) mixed with quartz sand and vermiculite (1:1, V / V), with 2 seeds planted in each square pot, and 3 square pots for each material and treatment group. After the seeds in the square pots germinate, thin out the seedlings and retain the single plants with uniform growth.

[0050] S3. Seedling cultivation: Place the planted square pots in a tray, with the tray (15 cm) higher than the square pots. Add Hoagland nutrient solution to the tray. The nitrogen concentration in the nutrient solution of the full nitrogen (HN) treatment group is 10 mM, and the nitrogen concentration in the nutrient solution of the low nitrogen (LN) treatment group is 1 mM. Fill the nutrient solution to about 5 cm. A total of 15 square pots (3×5) can be placed in the tray. The square pots cover the liquid surface to reduce evaporation.

[0051] S4. Cultivate in greenhouse conditions at 25°C, 18h / 6h light / dark, 70% humidity, and 20,000 lux light intensity. Change the culture medium once a week. When changing the culture medium, pour out the original culture medium. Wash the tray with tap water, rinse it with ultrapure water, and then add the newly prepared Hoagland nutrient solution.

[0052] S5. Gene expression detection: In the second week of cultivation, rapeseed leaf samples were collected. A cork puncher was used to punch leaf discs with a diameter of 5 mm at four locations (upper left, lower left, upper right and lower right) of the second leaf. The discs were immediately placed in liquid nitrogen, RNA was extracted, and reverse transcribed into cDNA. The expression levels of specific nitrogen response genes BnaA01G0394400ZS (BnaA01), BnaA09G0693100ZS (BnaA09) and BnaC08G0274600ZS (BnaC08) were detected by real-time fluorescence quantitative PCR technology, with BnaC02G0037200ZS as an internal reference. The gene expression levels of the HN treatment group and the LN treatment group were compared, and the Eave. value was calculated:

[0053] Eave.=(1.2×EBnaA01+1.4×EBnaA09+EBnaC08) / 3;

[0054] Wherein, EBnaA01 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA01G0394400ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0055] EBnaA09 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA09G0693100ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0056] EBnaC08 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaC08G0274600ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0057] Eave. is the weighted average expression of the three genes;

[0058] S6. Determination of nitrogen increment: Harvest rapeseed plants at the fourth week of cultivation. Cut them at the rhizome nodes and keep the aboveground part. Put the aboveground part into a 10mL centrifuge tube. Use wire to burn 2-3 holes in the cap of the centrifuge tube to allow water vapor to escape. Then place the sample in a centrifuge tube rack and dry it in an oven for 72 hours. The measured weight is the dry weight. The formula for nitrogen increment is: Nitrogen increment = (HN biomass - LN biomass) / LN biomass.

[0059] In this example, 10 strains were tested, and the gene expression levels of BnaA01G0394400ZS (BnaA01), BnaA09G0693100ZS (BnaA09) and BnaC08G0274600ZS (BnaC08) were tested. Figure 1 The dry matter determination results are shown in Table 1:

[0060] Table 1 Aboveground dry weight of different strains under different nitrogen treatments

[0061]

[0062]

[0063] analyze Figure 1 Compared with the results in Table 1, it was found that there was a good linear relationship between the nitrogen increment index and the molecular index, which complemented each other. BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS were determined as nitrogen efficient utilization screening marker genes with high accuracy and convenience, and the screening method for nitrogen efficient utilization rapeseed germplasm was set as follows:

[0064] When the following conditions A and B are met at the same time, it is considered as rapeseed germplasm with efficient nitrogen utilization:

[0065] A: In the second week, the Log2FC ((HN expression level) / (LN expression level)) of the marker genes BnaA01G0394400ZS (BnaA01), BnaA09G0693100ZS (BnaA09) and BnaC08G0274600ZS (BnaC08) were measured, and the following conditions were met:

[0066] Eave.≥4

[0067] Eave.=(1.2×EBnaA01+1.4×EBnaA09+EBnaC08) / 3, where EBnaA01=Log2FoldChange

[0068] (HN / LN), i.e., the logarithm of the expression level of BnaA01G0394400ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0069] EBnaA09 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA09G0693100ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0070] EBnaC08 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaC08G0274600ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2;

[0071] Eave. is the weighted average expression of the three genes

[0072] B: In the fourth week, the aboveground biomass was measured, and the nitrogen increment was greater than 100%. The nitrogen increment formula was: nitrogen increment = (HN biomass - LN biomass) / LN biomass.

[0073] Example 3

[0074] The method provided in Example 2 was used to measure the nitrogen utilization efficiency of Brassica napus, a known nitrogen efficient utilization line YL112, and a known nitrogen inefficient utilization line YL371. The expression level of the marker gene was measured in the second week using the method provided in Example 2. The results are as follows: Figure 2 As shown, the dry matter mass was measured in the fourth week, and the results are shown in the following Table 2:

[0075] Table 2 Aboveground dry weight of YL112 and YL371 under different nitrogen treatments

[0076] HN dry weight (g) LN dry weight (g) Nitrogen increment YL112(High efficiency) 1.042909761 0.430718954 1.421323119 YL371(low efficiency) 0.661197053 0.452036199 0.462708196

[0077] Analysis of the above results shows that the screening method designed in this scheme can well screen out nitrogen-efficient materials, and there are significant differences in expression and biomass data, and the screening method is effective.

[0078] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A method for screening rapeseed germplasm with high nitrogen utilization efficiency, characterized in that: The following steps are involved: S1. Plant the test seeds of the tested variety in a matrix pot, place the matrix pot in a tray, add Hoagland nutrient solution to the tray, divide the pot into two culture groups, a full nitrogen Hoagland nutrient solution and a low nitrogen Hoagland nutrient solution, and culture them in a greenhouse for four weeks. In the second week, the expression levels of nitrogen efficient utilization marker genes BnaA01G0394400ZS, BnaA09G0693100ZS and BnaC08G0274600ZS in the leaves of the full nitrogen culture group and the low nitrogen culture group are detected by real-time fluorescence quantitative PCR technology. In the fourth week, the nitrogen application increment of the aboveground biomass is determined; The sequence of BnaA01G0394400ZS is shown in SEQ ID NO.1; The sequence of BnaA09G0693100ZS is shown in SEQ ID NO.2; The sequence of BnaC08G0274600ZS is shown in SEQ ID NO.3; S2. Screening of rapeseed germplasms with high nitrogen utilization efficiency: Based on the gene expression and nitrogen increment of aboveground biomass, a comprehensive evaluation was conducted using the weighted scoring method or cluster analysis method. The varieties that met the following two conditions were considered rapeseed germplasms with high nitrogen utilization efficiency: (1) Eave. = (1.2 × EBnaA01 + 1.4 × EBnaA09 + EBnaC08) / 3, Eave. ≥ 4; Wherein, EBnaA01 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA01G0394400ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2; EBnaA09 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaA09G0693100ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2; EBnaC08 = Log2FoldChange (HN / LN), i.e., the logarithm of the expression level of BnaC08G0274600ZS gene in the full nitrogen culture group (HN) / the expression level in the low nitrogen culture group (LN) with base 2; Eave. is the weighted average expression of the three genes; (2) The nitrogen increment of aboveground biomass>100%, wherein the nitrogen increment=(biomass of full nitrogen culture group-biomass of low nitrogen culture group) / biomass of low nitrogen culture group.

2. The screening method according to claim 1, characterized in that In the step S1, the variety to be tested is selected from Brassica napus.

3. The screening method according to claim 1, characterized in that The substrate in step S1 is quartz sand and vermiculite in a volume ratio of 1:1, the aboveground part includes leaves and stems, and the biomass is measured by dry weight.

4. The screening method according to claim 1, characterized in that In the step S1, the total nitrogen in the full nitrogen Hoagland nutrient solution is applied in the form of potassium nitrate, and the total nitrogen concentration is 10 mM. The low nitrogen in the low nitrogen Hoagland nutrient solution is applied in the form of potassium nitrate, and the low nitrogen concentration is 1 mM.

5. The screening method according to claim 1, characterized in that The conditions for culturing in the greenhouse in step S1 are 25° C., 18 hours of light intensity of 20,000 lux, 6 hours of darkness, and 70% humidity.

6. Application of the screening method according to any one of claims 1 to 5 in rapeseed nitrogen utilization industry.

Images