Biobased composition, cosmetic composition comprising same and use thereof

Abstract

The present invention relates to a bio-based composition comprising: at least two, preferably three, naturally degradable materials; wherein a first naturally degradable material of the at least two naturally degradable materials has a contact angle of greater than or equal to 45 degrees, and a second naturally degradable material of the at least two naturally degradable materials has a duration from a start contact angle to an end contact angle of greater than 25 seconds. The bio-based composition of the present invention has good biodegradability and skin compatibility. When the composition is applied to a cosmetic composition, the durability of cosmetics can be enhanced, and the moisturizing and repairing performance of the cosmetics can be improved. In addition, the invention also relates to a cosmetic composition containing the keratinous material, application of the keratinous material and a method for making up or caring for the keratinous material.

Description

Technical Field

[0001] The present invention relates to the field of cosmetics, in particular to a bio-based composition, a cosmetic composition comprising the bio-based composition, use of the bio-based composition and a method for making up or caring for keratinous materials. Background Art

[0002] In the cosmetics industry, film formers are an important raw material that can produce a continuous film on the skin surface, thereby playing a role in protection, moisturizing, isolating, and enhancing the durability of makeup. Traditional film formers mainly include chemically synthesized film formers. Although they have good film-forming properties, they make the skin feel tight after use and cannot provide moisturizing and repairing effects. Moreover, with the improvement of environmental awareness and the requirements for the safety of cosmetics, such film formers are increasingly unable to meet the needs of consumers. As for the subsequent development of natural plant extracts as substitutes for film formers, although they have improved in biodegradability and skin compatibility, they still have problems with poor film-forming properties or high costs.

[0003] Therefore, it is still necessary to improve the film-forming agent in order to develop a film-forming agent with excellent film-forming properties, skin compatibility and biodegradability. Summary of the invention

[0004] To this end, the present application provides a specific bio-based composition, which is composited with a variety of natural degradable materials and has good biodegradability and skin compatibility, thereby effectively avoiding the shortcomings of chemically synthesized film-forming agents while also having excellent film-forming properties, thereby enhancing the durability of cosmetics containing it and improving the moisturizing and repairing properties of cosmetics.

[0005] In a first aspect, the present invention provides a bio-based composition comprising: at least two, preferably three naturally degradable materials; wherein the first naturally degradable material among the at least two naturally degradable materials has a contact angle greater than or equal to 45°, and the time taken for the second naturally degradable material among the at least two naturally degradable materials to change from an initial contact angle to a final contact angle is greater than 25 seconds.

[0006] In some embodiments, the bio-based composition is a bio-based film former composition.

[0007] The bio-based composition of the present application includes a variety of natural degradable materials with specific contact angles, thereby having excellent anti-sweat and anti-sebum properties.

[0008] In some embodiments, the first naturally degradable material has a contact angle greater than or equal to 45° and less than or equal to 60°, and the time taken for the second naturally degradable material to change from an initial contact angle to a final contact angle is greater than 25 seconds and less than 90 seconds.

[0009] In some embodiments, the first natural degradable material is selected from a light skin beautifying agent or yeast polysaccharide, and the second natural degradable material is selected from sodium carrageenan or budding pullulan polysaccharide, wherein the light skin beautifying agent refers to a mixture in which maltose is greater than 80 wt% and Agave taurine leaf extract is less than 20 wt% relative to the total weight of the mixture.

[0010] In some embodiments, the bio-based composition includes a light skin beautifying agent and sodium carrageenan, and a third naturally degradable material selected from Pullulan, hydrolyzed corn starch, yeast polysaccharide, or sodium hyaluronate.

[0011] In some embodiments, the mass ratio of the first natural degradable material: the second natural degradable material: the third natural degradable material is (1-30): (1-5): (1-50).

[0012] In some embodiments, the third natural degradable material is yeast polysaccharide. In some specific embodiments, the mass ratio of light skin beautifying agent: sodium carrageenan: yeast polysaccharide is 15:2:15.

[0013] In a second aspect, the present invention provides a cosmetic composition comprising: based on the total weight of the cosmetic composition, 1.5 wt % to 6.0 wt % of the bio-based composition of the first aspect of the present application.

[0014] In some embodiments, the cosmetic composition further includes at least one cosmetic active agent, and the at least one cosmetic active agent is selected from moisturizers, fillers, UV absorbers, thickeners, emulsifiers, emollients, surfactants, fragrances, antioxidants, stabilizers, preservatives, pH adjusters, chelating agents, and cooling agents.

[0015] In some embodiments, the cosmetic composition may be in the form of a skin care product, such as a day cream, a night cream, a sunscreen, an after-sun cream, or a facial mask.

[0016] In some embodiments, the cosmetic composition may be in the form of a hair care product, such as shampoo, conditioner, hair styling gel, or hair dye.

[0017] In some embodiments, the cosmetic composition may be in the form of a base makeup product, such as foundation, primer, concealer, eye shadow, mascara, lipstick, lip gloss, lip gloss, eyeliner, and nail polish.

[0018] In a third aspect, the present invention provides use of the bio-based composition described in the first aspect in the preparation of a cosmetic composition.

[0019] In a fourth aspect, the present invention provides a method for making up or caring for a keratinous material, comprising applying a cosmetic composition according to the second aspect to said keratinous material. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The experimental results of chicken embryo chorioallantoic membrane (CAM) are shown, wherein A represents the CAM result of the negative control 0.9% NaCl; B represents the CAM result of the positive control 0.2% sodium hydroxide solution; C represents the CAM result of the positive control 0.3% sodium hydroxide solution; D represents the CAM result of the positive control 0.5% sodium hydroxide solution; and E represents the CAM result of the bio-based composition of the present invention.

[0021] Figure 2 The effects of a blank control (BC) and the bio-based composition of the present invention on the AQP3 gene expression level are shown.

[0022] Figure 3 The effects of a blank control (BC) and the bio-based composition of the present invention on the expression level of the FLG gene are shown. DETAILED DESCRIPTION

[0023] The following specific embodiments are discussed in conjunction with the accompanying drawings to illustrate the exemplary embodiments. The specific embodiments included herein should not be interpreted as limiting the present invention. Further, although specific language may be used to describe the embodiments herein, the features, actions and / or structures, the claims are not limited to the described features, actions and / or structures. It will be appreciated by those skilled in the art that other embodiments including improvements are within the scope of the present invention.

[0024] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the invention belongs.

[0025] Bio-based compositions

[0026] The bio-based composition according to the present invention comprises at least two naturally degradable materials. In some embodiments, the bio-based composition according to the present invention comprises three naturally degradable materials.

[0027] In some embodiments, the bio-based composition according to the present invention is used as a film former composition.

[0028] The term "biobased" refers to organic materials in which the carbon comes from non-fossil biological sources. The term "naturally degradable materials" refers to materials that are extracted from natural plants and are degradable both thermodynamically and kinetically over a period of time.

[0029] It should be understood that although the terms first, second, third, etc. may be used to describe various naturally degradable materials, these naturally degradable materials should not be limited by these terms. These terms are only used to distinguish one naturally degradable material from another naturally degradable material.

[0030] The first natural biodegradable material

[0031] In the present application, the bio-based composition includes a first naturally degradable material having a sebum contact angle greater than or equal to 45°.

[0032] The term "contact angle" is the angle between the solid-liquid interface, the liquid interior and the gas-liquid interface at the junction of solid, liquid and gas. Wherein "sebum contact angle" refers to the contact angle of simulated human sebum on the material to be tested. It can be tested by providing a container, immersing the artificial bionic skin in an aqueous solution of the material to be tested, placing it in a drying oven for 24 hours, so that it forms a uniform film on the surface of the artificial bionic skin, and then dropping simulated artificial sebum on the film, and then measuring the contact angle by a contact angle meter, i.e., "instant contact angle". The higher the contact angle, the better the anti-sebum performance of the material to be tested, and the better the durability of the film.

[0033] In the present application, the first natural degradable material can be selected from yeast polysaccharide, light skin beautifying agent, sodium carrageenan or sodium hyaluronate. Wherein "light skin beautifying agent" refers to a mixture with maltose>80wt% and Agave tatarinowii leaf extract<20wt% relative to the total weight of the mixture, such as Gosulin Agave purchased from Gobo in the Netherlands.

[0034] In the present application, the bio-based composition includes, based on the total weight of the bio-based composition, 1.7 wt % to 93.75 wt % of the first naturally degradable material.

[0035] Second natural biodegradable material

[0036] In the present application, the bio-based composition includes a second natural degradable material, and the duration from the initial contact angle to the final contact angle of the second natural degradable material is greater than 25 seconds and less than 90 seconds. In the present application, the "initial contact angle" refers to the contact angle measured by the contact angle meter after the simulated artificial sweat is just dripped on the film of the substance to be tested, that is, the "instant contact angle"; the "final contact angle" refers to the contact angle measured by the contact angle meter after the initial contact angle is obtained, and when the measured contact angle remains unchanged for 5 seconds, it is recorded as the "final contact angle". Generally, the time to reach the final water contact angle can be the duration from the initial water contact angle to the final water contact angle. The longer the duration, the better the anti-sweat performance.

[0037] In the present application, the second natural degradable material can be selected from Pullulan polysaccharide, light skin beautifying agent, hydrolyzed corn starch or sodium carrageenan.

[0038] In the present application, the bio-based composition includes, based on the total weight of the bio-based composition, 1.2 wt % to 71.43 wt % of the second naturally degradable material.

[0039] Third natural biodegradable material

[0040] The bio-based composition includes a third natural degradable material. The present application has no special requirements for the third natural degradable material, but is preferably selected from natural degradable materials with excellent anti-perspiration and anti-sebum properties. Optionally, the third natural degradable material is selected from budding pullulan polysaccharide, hydrolyzed corn starch, yeast polysaccharide or sodium hyaluronate.

[0041] It should be understood that although some natural degradable materials are used as the first natural degradable material, the second natural degradable material or the third natural degradable material, in the bio-based composition of the present application, the first natural degradable material, the second natural degradable material and the third natural degradable material are different from each other.

[0042] In the present application, the bio-based composition includes, based on the total weight of the bio-based composition, 1.2 wt % to 96.15 wt % of the third naturally degradable material.

[0043] Cosmetic composition

[0044] The present invention also provides a cosmetic composition, comprising the bio-based composition provided above.

[0045] In some embodiments, the cosmetic composition includes: 1.5 wt % to 6.0 wt % of the bio-based composition, based on the total weight of the cosmetic composition.

[0046] In the present invention, the cosmetic composition includes at least one cosmetic active agent, which can be selected from moisturizers, fillers, ultraviolet absorbers, thickeners, emulsifiers, emollients, surfactants, fragrances, antioxidants, stabilizers, preservatives, pH adjusters, chelating agents, cooling agents, etc., but is not limited thereto.

[0047] Moisturizers that may be mentioned are those chosen from polyols, urea and derivatives thereof, such as, in particular, hydroxyalkyl urea, in particular hydroxyethyl urea, hyaluronic acid, glycine, β-alanine, taurine, trimethylglycine and mixtures thereof, preferably from polyols such as ethylene glycol, pentaerythritol, trimethylolpropane, propylene glycol, glycerol, polyglycerol, polyethylene glycol and mixtures thereof, more preferably from propylene glycol and glycerol, but not limited thereto.

[0048] Fillers that may be mentioned may be selected from talc, mica, silica, kaolin, poly-β-alanine powder and polyethylene powder, tetrafluoroethylene polymer powder, nylon powder, polymethyl methacrylate powder, lauroyl lysine, starch, boron nitride, hollow polymer microspheres, for example hollow polymer microspheres of polyvinylidene chloride / acrylonitrile, acrylic copolymer microspheres, silicone resin microbeads, polyorganosiloxane elastomer particles, precipitated calcium carbonate, magnesium carbonate, magnesium hydrogen carbonate, hydroxyapatite, barium sulfate, aluminum oxide, polyurethane powder, composite fillers, hollow silica microspheres, glass or ceramic microcapsules, particles in the form of hollow spherical parts, and mixtures thereof, preferably from talc, mica, silica, nylon powder, polymethyl methacrylate powder and mixtures thereof, even more preferably talc, but not limited thereto.

[0049] Examples of the ultraviolet absorber that may be mentioned include benzoic acid derivatives, salicylic acid derivatives, cinnamic acid derivatives, dibenzoylmethane derivatives, β,β-diphenylacrylate derivatives, benzophenone derivatives, benzylidene camphor derivatives, phenylbenzimidazole derivatives, triazine derivatives, phenylbenzotriazole derivatives, anthranilic acid derivatives, imidazoline derivatives, benzalmalonate derivatives and 4,4-diarylbutadiene derivatives, but are not limited thereto.

[0050] Examples of thickeners that may be mentioned include acrylic thickeners; cellulose thickeners such as methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, carboxymethylcellulose, carboxyethylcellulose, stearylhydroxypropylmethylcellulose, nitrocellulose and sodium cellulose sulfate; microbial thickeners such as xanthan gum, hydroxypropylxanthan gum, gum arabic, tragacanth gum, cabrogum, guar gum and dextran; thickeners including polyvinyl alcohol, high molecular weight dimethylpolysiloxane, starch, algecolloid, succinyl glucan, collagen, gelatin, casein, albumin, carboxymethyl starch, sodium alginate, polyvinyl methyl ether, sodium polyacrylate, polyethylene glycol acrylate, cationic polymers; and other polymer compounds, but are not limited thereto.

[0051] Examples of emulsifiers that may be mentioned include glycerides and derivatives, alkoxylated carboxylic acids (PEG-30 dipolyhydroxystearate), oxyalkylenated fatty acid esters of glycerol, oxyalkylenated fatty acid esters of sorbitan, oxyalkylenated fatty acid esters, oxyalkylenated fatty acid esters, oxyalkylenated fatty alkyl ethers, sugar esters (eicosyl glucoside) and mixtures thereof, but are not limited thereto.

[0052] Examples of emollients that may be mentioned include volatile or nonvolatile silicone oils and gums; dimethicone, dimethiconol; silicone resins such as polypropylsilsesquioxane and polyphenyltrimethicone; silicone elastomers such as dimethicone crosspolymer, PEG-12 dimethicone / PPG crosspolymer, dimethicone / bis-isobutyl PPG-20 crosspolymer; alkyl methyl siloxanes such as caprylyl methicone; volatile or nonvolatile hydrocarbon compounds such as squalene, paraffin oil, petrolatum and naphthyl oil; hydrogenated or partially hydrogenated polyisobutene; isoeicosane; squalane; isoparaffin; isododecane; isodecane or isohexadecane; branched C8-C16 esters; isohexyl neopentanoate; ester oils such as isononyl isononanoate, cetearyl octanoate, isopropyl myristate, palmitate derivatives, stearate derivatives, isostearyl isostearate, and heptanoic acid esters, caprylic acid esters, capric acid esters or ricinoleic acid esters of alcohols or polyols or mixtures thereof; hydrocarbon oils of plant origin such as wheat germ, sunflower, grape seed, castor, shea, avocado, olive, soybean, sweet almond, palm, rapeseed, cotton seed, hazelnut, macadamia, jojoba, black currant, evening primrose; or triglycerides of caprylic acid / capric acid; higher fatty acids such as oleic acid, linoleic acid or linolenic acid and mixtures thereof.

[0053] The surfactant that may be mentioned includes nonionic surfactants, anionic surfactants, and amphoteric or zwitterionic surfactants and the like generally used in the art.

[0054] The fragrances that may be mentioned include hexyl cinnamaldehyde, anisealdehyde, methyl 2-n-hexyl-3-oxocyclopentanecarboxylate, patchouli; frankincense resin; labdanum; vetiver oil; cuppa balsam; fir balsam; 4-(4-hydroxy-4-methylpentyl)-3-cyclohexene-1-carbaldehyde; methyl anthranilate; geraniol; geranyl acetate; linalool; citronellol; terpinyl acetate; benzyl salicylate, etc., but are not limited thereto.

[0055] Examples of antioxidants that may be mentioned include ascorbic acid and its derivatives, such as ascorbyl palmitate, ascorbyl tetraisopalmitate, ascorbyl glucoside, magnesium ascorbyl phosphate, sodium ascorbyl phosphate and ascorbyl sorbate; tocopherol and its derivatives, such as tocopherol acetate, tocopherol sorbate and other tocopherol esters; BHT and BHA; gallic acid esters, phosphoric acid, citric acid, maleic acid, malonic acid, succinic acid, fumaric acid, cephalin, hexametaphosphate, etc.

[0056] Examples of stabilizers that may be mentioned include, for example, aqueous phase stabilizers such as electrolytes, in particular chlorides, borates, citrates and sulfates of sodium, potassium, calcium and magnesium, and also aluminum chlorohydrates and polyelectrolytes, in particular hyaluronic acid and sodium hyaluronate, polyols (glycerol, propylene glycol, butylene glycol and sorbitol), alcohols (such as ethanol) and hydrocolloids and mixtures thereof, but are not limited thereto.

[0057] Examples of stabilizers that may be mentioned include paraben derivatives, hydantoin derivatives, imidazolidinyl urea, phenoxyethanol, silver derivatives, salicylate derivatives, triclosan, ciclopirox olamine salt, hexamidine, oxyquinoline and its derivatives, povidone iodine, zinc salts and their derivatives such as zinc pyrithione and mixtures thereof, but are not limited thereto.

[0058] pH adjusting agents that may be mentioned include, but are not limited to, mineral bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, ammonia; organic bases such as monoethanolamine, diethanolamine, triethanolamine, triisopropylamine, tri[(2-hydroxy)1-propyl)]amine, N,N-dimethylethanolamine, 2-amino2-methyl1-propanol, 2-amino2-methyl1,3-propanediol, triethylamine, dimethylaminopropylamine; and amphoteric bases (i.e., bases having both anionic and cationic functional groups), such as primary, secondary, tertiary or cyclic organic amines, amino acids such as glycine, lysine, arginine, taurine, histidine, alanine, valine, cysteine, trishydroxymethylaminomethane (TRISTA), triethanolamine, etc.; inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid; organic acids such as acetic acid, lactic acid, glycolic acid, mandelic acid, citric acid, ascorbic acid, and any mixtures thereof.

[0059] The cosmetic composition of the present invention may also contain other additives in biological cosmetics.

[0060] The compositions according to the invention may comprise a physiologically acceptable medium.

[0061] The term "physiologically acceptable medium" is used to denote a medium that is non-toxic and that is particularly capable of being applied to the skin.

[0062] The physiologically acceptable medium is generally adapted to the nature of the support onto which the composition is to be applied, and likewise to the manner in which the composition is to be packaged.

[0063] Obviously, a person skilled in the art should carefully choose these optional additional compounds, and / or their amounts, so that the advantageous properties of the active ingredients of the composition according to the invention are not or not substantially altered by the envisaged addition.

[0064] Form of cosmetic composition

[0065] The cosmetic composition of the present invention can be a skin care product, such as day cream, night cream, sunscreen, after-sun cream, facial mask, etc.

[0066] The cosmetic composition of the present invention may be a hair care product, such as shampoo, conditioner, hair styling gel, hair dye product.

[0067] The cosmetic composition of the present invention can be a base makeup product, such as foundation, primer, concealer, eye shadow, mascara, lipstick, lip gloss, lip gloss, eyeliner, and nail polish.

[0068] It is known to those skilled in the art that appropriate additives can be selected according to the form of the cosmetic composition.

[0069] The composition of the present invention may be in the form of a water-in-oil or oil-in-water emulsion, or in the form of an ointment, milk, cream, gel, etc., but is not limited thereto.

[0070] The cosmetic composition of the present application is preferably stable. As used herein, the term "stable" means that the cosmetic composition does not visually phase separate or crystallize, and does not completely degrade.

[0071] The application also relates to methods of using the cosmetic compositions described herein. For example, the cosmetic compositions can be used in methods comprising applying the cosmetic compositions to keratinous materials (including hair and skin). In some cases, the compositions are applied to skin, such as face, hands, lips, etc. In some embodiments, the compositions are applied to hair. It should be understood that the above methods are non-therapeutic.

[0072] Hereinafter, specific examples will now be given to illustrate the present invention, but this is not restrictive.

[0073] In the examples, unless otherwise indicated, temperature is ambient temperature (25° C.) in degrees Celsius, and pressure is atmospheric pressure unless otherwise indicated.

[0074] In the examples, the amounts of ingredients of the compositions are given as % by weight (% w / w) relative to the total weight of the composition.

[0075] Example

[0076] The biobased composition according to the present invention is prepared as follows.

[0077] Preparation Example 1. Preparation of bio-based composition

[0078] 1.5 g of a light skin beautifying agent (Gosulin Agave, purchased from Gosulin Agave, the Netherlands), 0.2 g of sodium carrageenan and 1.5 g of yeast polysaccharide were mixed to obtain a bio-based composition.

[0079] Preparation Examples 2 to 5

[0080] Based on the formulation listed in Table 1, a bio-based composition was obtained in the same manner as Preparation Example 1.

[0081] Table 1. Components and amounts of Preparation Examples 1 to 5

[0082] project The first natural biodegradable material Second natural biodegradable material Third natural biodegradable material Preparation Example 1 1.5g Light Skin Beautifier 0.2g sodium carrageenan 1.5g yeast polysaccharide Preparation Example 2 1.5g Light Skin Beautifier 0.2g sodium carrageenan 2.0g Pullulan polysaccharide Preparation Example 3 1.5g Light Skin Beautifier 0.2g sodium carrageenan 2.5g hydrolyzed corn starch Preparation Example 4 1.5g Light Skin Beautifier 0.2g sodium carrageenan 0.4g sodium hyaluronate Preparation Example 5 1.5g yeast polysaccharide 2.0g Pullulan polysaccharide 2.5g hydrolyzed corn starch

[0083] Test Case

[0084] First, prepare an aqueous solution of the material to be tested.

[0085] 1.5 g of the light skin beautifying agent was added to 98.5 g of water to prepare an aqueous solution of the light skin beautifying agent.

[0086] 0.2 g of sodium carrageenan was added to 99.8 g of water to prepare an aqueous solution of sodium carrageenan.

[0087] 1.5 g of yeast polysaccharide was added to 98.5 g of water to prepare an aqueous solution of yeast polysaccharide.

[0088] 2.0 g of Pullulan polysaccharide was added to 98.0 g of water to prepare an aqueous solution of Pullulan polysaccharide.

[0089] 2.5 g of hydrolyzed corn starch was added to 97.5 g of water to prepare an aqueous solution of hydrolyzed corn starch.

[0090] 0.4 g of sodium hyaluronate was added to 99.6 g of water to prepare an aqueous solution of sodium hyaluronate.

[0091] Contact angle

[0092] Prepare a round dish, soak the artificial bionic skin in 10 ml of the above-prepared aqueous solution of the material to be tested, and place it in a 55°C drying oven for 24 hours. A uniform film will form on the surface of the artificial bionic skin. Artificial sweat is dripped on the film, and then the contact angle is measured by a contact angle meter. The results are shown in Table 2.

[0093] Table 2

[0094] Raw material name Initial contact angle (°) Terminal contact angle (°) Duration(s) Sweat resistance ranking Pullulan 81.25 79.84 85 1 Hydrolyzed corn starch 91.06 71.59 31 2 Light Skin Beautifier 68.41 67.21 29 3 Sodium Carrageenan 66.95 63.55 31 4 Yeast polysaccharide 70.93 52.4 8 / Sodium Hyaluronate 55.97 35.97 6 /

[0095] Sebum contact angle

[0096] In a round dish, the artificial bionic skin was soaked in 10 ml of the above-prepared aqueous solution of the material to be tested, and placed in a 55°C drying oven for 24 hours. A uniform film was formed on the surface of the artificial bionic skin. Artificial sebum was dropped onto the film, and then the contact angle was measured by a contact angle meter. The results are shown in Table 3.

[0097] Table 3

[0098] Raw material name Average contact angle (°) Anti-sebum level ranking Yeast polysaccharide 57 1 Light Skin Beautifier 49 2 Sodium Carrageenan 47 3 Sodium Hyaluronate 45 4 other Less than 30 /

[0099] Flexibility

[0100] The aqueous solution of the above-mentioned material to be tested was dropped into three circular droplets on the film drawing cardboard, dried in an oven at 50°C for 24 hours, and the film-forming properties were observed. The results are shown in Table 4.

[0101] Table 4

[0102] Status Observation Light Skin Beautifier Complete demoulding, good toughness, thick, hard, and can be curled Sodium Carrageenan Complete demoulding, good toughness, can be curled, relatively soft Yeast polysaccharide Complete demoulding, good toughness, thick, hard, and can be curled Pullulan Very sticky, but can be demoulded completely, relatively thin and soft, and can be curled Hydrolyzed corn starch Easy to stick, incomplete demoulding, only a small part of the film can be removed, and it is fragile Sodium Hyaluronate Complete demoulding, good toughness, not easy to tear off, easy to stick after the film is torn off

[0103] Examples 1 to 5 and Comparative Examples 1 to 6

[0104] In all the Examples and Comparative Examples, the ingredients mentioned in the following table were used, and compositions were prepared using the components and contents in Table 5 below.

[0105] First, mix the components of the water phase and stir them evenly;

[0106] Then, mix the components of the oil phase and stir them evenly;

[0107] The aqueous phase was added to the oil phase and homogenized at 6500 rpm for 2 minutes.

[0108] Table 5. Components and contents of Examples and Comparative Examples

[0109]

[0110]

[0111]

[0112]

[0113] Performance testing of the composition

[0114] Anti-sweat and anti-sebum properties

[0115] 0.02 g of the compositions of Examples 1 to 5 and Comparative Examples 1 to 6 were evenly applied on artificial bionic skin of the same area, left to stand for 8 hours, simulating daily makeup for 8 hours, and the anti-sweat and anti-sebum contact angles were measured. The test results are shown in Tables 6 and 7 below.

[0116] Table 6

[0117]

[0118] Table 7

[0119]

[0120]

[0121] It can be seen from Tables 6 and 7 above that, compared with the composition without adding the film-forming agent group and the composition with adding a single raw material, the composition comprising the composition of the present application has excellent anti-perspiration and anti-sebum properties.

[0122] Gentle performance

[0123] Chicken embryo chorioallantoic membrane experiment

[0124] The composition obtained in Preparation Example 1 was dissolved in 96.8 g of water to obtain an aqueous solution of Preparation Example 1.

[0125] According to SN / T2329-2009 "Chicken Embryo Chorioallantoic Membrane Test for Eye Irritation / Corrosion of Cosmetics", 0.3 ml of the aqueous solution of Preparation Example 1 was dripped onto the CAM. After 3 minutes of action, the test substance on the CAM membrane was gently rinsed with physiological saline to observe the occurrence of bleeding, coagulation, and vascular dissolution, and photographs were taken. At the same time, a negative control of 0.9% NaCl and positive controls of 0.2%, 0.3%, and 0.5% sodium hydroxide solutions were set.

[0126] The test results are as follows Figure 1 As shown in the figure, it can be seen that the composition of Preparation Example 1 acts on the chicken embryo chorioallantoic membrane, and no CAM bleeding is observed, indicating that the bio-based composition of the present application is non-irritating.

[0127] Patch test

[0128] Select qualified patch test equipment, use the skin occlusion patch test method, put about 0.020ml-0.025ml of the test substance in the patch tester, apply the patch tester to the back or forearm of the subject, remove the test substance after 24 hours, observe the skin reaction 30min (after the indentation disappears), 24h, and 48h after removal, and follow the skin reaction in the current effective technical specifications. The group without any substance was used as the blank control group.

[0129] The test results are shown in Table 8 below.

[0130] Table 8. Patch test results of the composition of Example 3 on human skin

[0131]

[0132]

[0133] Through mild performance testing, it can be seen that the bio-based composition of the present application showed no irritation in the chicken embryo chorioallantoic membrane experiment, and the cosmetics containing the bio-based composition of the present application showed no adverse reactions in 31 patch testers, indicating that the bio-based composition provided by the present invention and its implementation in cosmetics have no potential irritation to the skin.

[0134] Moisturizing properties

[0135] Test principle: The protein that plays a role in water transport in the human skin epidermis is mainly aquaporin (AQP3). AQP3 can transport substances such as urea and glycerol in and out of the skin while transporting water, and is a key factor in maintaining skin hydration. AQP3 is expressed in the keratinocytes of the epidermis and is responsible for the transport of water and glycerol throughout the stratum corneum. Previous studies have shown that the water content and elasticity of the corneal skin epidermis of AQP3-deficient mice are significantly lower than those of wild-type mice. Water adsorption-desorption experiments have shown that the water retention capacity of the stratum corneum of AQP3-deficient mice is reduced. The skin moisturizing ability of AQP3-deficient mice is impaired, and AQP3 is necessary for maintaining skin moisture. Therefore, detecting the expression level of the AQP3 gene in HaCaT cells by qRT-PCR can reflect the moisturizing ability of cosmetic raw materials / products.

[0136] The moisturizing performance test was conducted on the bio-based composition of Preparation Example 1. The test process is as follows.

[0137] 1) Cell plating: HaCaT cells were plated at 3×10 5 The cells were inoculated at a density of 100 / mL in a 6-well plate, 2 mL / well, and cultured overnight in a 37°C, 5% CO2 incubator.

[0138] Among them, a blank control group, a test sample group and a positive control group were set up for each test, and three replicate wells were set up for each group.

[0139] 2) Sample addition: After culturing for 24 hours, the cell culture medium was replaced with a culture medium containing the test sample (complete culture medium containing 1.6% aqueous solution of the composition of Preparation Example 1 or complete culture medium containing 3.2% aqueous solution of the composition of Preparation Example 1), 2 mL / well, and culture was continued for 24 hours. The positive control group was a complete culture medium containing 3% glycerol.

[0140] 3) RNA extraction: Take out the cells from the 6-well plate, wash them twice with PBS, add 1 mL of trypsin containing 0.25% EDTA, and digest them in a CO2 incubator for 7 minutes. After observing the cells falling off the culture bottle under a microscope, add 3 mL of complete medium to stop digestion, transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1300 rpm for 5 minutes, and discard the supernatant. Resuspend and wash the cells once with PBS, add 1 ml of Trizol to resuspend, then add 200 μL of chloroform and shake up and down quickly for about 30 times; place in a centrifuge, set the temperature to 4°C, and centrifuge at 12000g for 15 minutes; then add isopropanol at 4°C and centrifuge at 12000g for 10 minutes; then add 75% ethanol and centrifuge at 7500g for 5 minutes; discard the supernatant, dry in the air, add 5 μL to 20 μL of RNase-free water, and measure the total RNA concentration.

[0141] 4) Reverse transcription of cDNA

[0142] First, add gDNA remover and 500 ng template RNA, place at room temperature for 30 minutes to remove gDNA, then add mix and use PCR instrument for reverse transcription;

[0143] 5) Detection of AQP3 gene expression level

[0144] Amplification reagent, ROX, target gene, internal reference gene, etc. were added in sequence for amplification using a qRT-PCR instrument;

[0145] AQP3-F:GACAGAAGGAGCTGGTGTCC

[0146] AQP3-R: GGCTGTGCCTATGAACTGGT

[0147] Pre-denaturation at 95°C for 30 s, PCR amplification (95°C for 5 s, 60°C for 20 s, 45 cycles), and finally 65°C for 15 s.

[0148] Experimental results and statistics

[0149] Calculate the ΔΔCT value of each experimental group, and use t-test statistical analysis to compare the groups; P<0.05 is a significant difference, and P<0.01 is an extremely significant difference. If there is a statistical difference between the positive control and the blank control in each batch of tests, the experimental system is considered to be effective, and there is no need to add a positive control group to each batch of experiments unless necessary.

[0150] The results of the test on the regulation of AQP3 gene expression level by the bio-based composition of Preparation Example 1 are recorded in the following Tables 9 and Figure 2 middle.

[0151] Table 9

[0152]

[0153] The above test results show that the bio-based composition of the present application can up-regulate the expression of the AQP3 gene within the range of 1.6% and 3.2%, indicating that it has good moisturizing function.

[0154] Repair barrier properties

[0155] The test principle is as follows:

[0156] The skin barrier is mainly composed of the tightly connected structure of the epidermal stratum corneum and the granular layer. The stratum corneum is like a wall, which plays a role in maintaining the water balance in the body and preventing the invasion of various external pathogens. Filaggrin (FLG) is an important structural protein in the skin barrier. It is produced in the epidermal stratum corneum and has the function of cross-linking keratin fibers. Studies have shown that genetic defects in skin barrier-related proteins (such as FLG, CLDN1, etc.) can lead to defects in skin barrier function. FLG has a polymerization effect during keratin formation and can quickly aggregate the keratin cell skeleton, together with its accessory proteins and membrane components, to form a corneocyte membrane after sufficient cross-linking. The main function of the corneocyte membrane is to form the outermost barrier of the skin. Therefore, the expression level of HaCaT cell skin barrier-related genes (FLG) detected by qRT-PCR can reflect the barrier repair ability of cosmetic raw materials / products.

[0157] The bio-based composition of Preparation Example 1 was subjected to a barrier repair test. The test process is as follows.

[0158] 1) Cell plating: HaCaT cells were plated at 3×10 5 The cells were inoculated at a density of 100 / mL in a 6-well plate, 2 mL / well, and cultured overnight in a 37°C, 5% CO2 incubator.

[0159] Among them, a blank control group, a test sample group and a positive control group were set up for each test, and three replicate wells were set up for each group.

[0160] 2) Sample addition: After culturing for 24 hours, the cell culture medium was replaced with a culture medium containing the test sample (complete culture medium containing 1.6% aqueous solution of the composition of Preparation Example 1 or complete culture medium containing 3.2% aqueous solution of the composition of Preparation Example 1), 2 mL / well, and culture was continued for 24 hours. The positive control group was a complete culture medium containing 3% glycerol.

[0161] 3) RNA extraction: Take out the cells from the 6-well plate, wash them twice with PBS, add 1 mL of trypsin containing 0.25% EDTA, and digest them in a CO2 incubator for 7 minutes. After observing the cells falling off the culture bottle under a microscope, add 3 mL of complete medium to stop digestion, transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1300 rpm for 5 minutes, and discard the supernatant. Resuspend and wash the cells once with PBS, add 1 ml of Trizol to resuspend, then add 200 μL of chloroform and shake up and down quickly for about 30 times; place in a centrifuge, set the temperature to 4°C, and centrifuge at 12000g for 15 minutes; then add isopropanol at 4°C and centrifuge at 12000g for 10 minutes; then add 75% ethanol and centrifuge at 7500g for 5 minutes; discard the supernatant, dry in the air, add 5 μL to 20 μL of RNase-free water, and measure the total RNA concentration.

[0162] 4) Reverse transcription of cDNA

[0163] First, add gDNA remover and 500 ng template RNA, place at room temperature for 30 minutes to remove gDNA, then add mix and use PCR instrument for reverse transcription;

[0164] 5) Detection of FLG gene expression level

[0165] Amplification reagent, ROX, target gene, internal reference gene, etc. were added in sequence for amplification using a qRT-PCR instrument;

[0166] FLG-F: AGAAGGAAGAGTATGTGGAATATG

[0167] FLG-R: CAACAACCTATATTTACTTCCCAAC

[0168] Pre-denaturation at 95°C for 30 s, PCR amplification (95°C for 5 s, 60°C for 20 s, 45 cycles), and finally 65°C for 15 s.

[0169] Experimental results and statistics

[0170] Calculate the ΔΔCT value of each experimental group, and use t-test statistical analysis to compare the groups; P<0.05 is a significant difference, and P<0.01 is an extremely significant difference. If there is a statistical difference between the positive control and the blank control in each batch of tests, the experimental system is considered to be effective, and there is no need to add a positive control group to each batch of experiments unless necessary.

[0171] The results of the test on the regulation of FLG gene expression level by the bio-based composition of Preparation Example 1 are recorded in the following Tables 10 and Figure 3 middle.

[0172] Table 10

[0173]

[0174] The above test results show that the bio-based composition of the present application can up-regulate the expression of the FLG gene within the range of 1.6% and 3.2%, indicating that it has a good barrier repair function.

[0175] Hyaluronidase inhibition rate

[0176] The test principle is as follows.

[0177] Hyaluronic acid is an important extracellular matrix, which is related to the moisturizing and firming of the skin. It is a natural moisturizing component that can bind a large number of water molecules. It is a linear high molecular polymer and the mucopolysaccharide with the highest content in the skin. This test uses the turbidimetric method of hyaluronidase activity. There is an absorption peak at 600nm. The OD value at 600nm can be detected by an enzyme marker to calculate the hyaluronidase inhibition rate of the sample.

[0178] The in vitro efficacy evaluation of the samples was carried out in accordance with the Basic Research Department's "Q / YGEMG-SOP-2012 Cosmetic Hyaluronic Acid Inhibition Rate Detection Operating Procedure A0".

[0179] Samples were added as shown in Table 11, and three replicate wells were set for each concentration of the sample group (hyaluronic acid), and a negative blank control group was set to observe whether the hyaluronidase and substrate reacted completely. The hyaluronidase inhibition rate was calculated by comparing the control group, control blank group, sample group, and sample blank group.

[0180] Hyaluronidase inhibition rate (%) = (OD sample group - OD sample blank) (OD control group - OD control blank) × 100%

[0181] Table 11

[0182]

[0183] The above test results show that as the content of the bio-based composition of the present application increases, the inhibitory effect on hyaluronidase also shows an increasing trend, and at a concentration of 3.2%, an inhibition rate of 74.94% can be achieved.

[0184] The above description is only a preferred embodiment of the present invention and is not intended to limit the protection scope of the present invention.

Claims

1. A bio-based composition, especially a bio-based film former composition, comprising: at least two, preferably three, naturally degradable materials; The first natural degradable material among the at least two natural degradable materials has a sebum contact angle greater than or equal to 45°, and the time from the initial contact angle to the final contact angle of the second natural degradable material among the at least two natural degradable materials is greater than 25 seconds.

2. The bio-based composition according to claim 1, wherein The first natural degradable material has a sebum contact angle greater than or equal to 45° and less than or equal to 60°, and the duration from the initial contact angle to the final contact angle of the second natural degradable material is greater than 25 seconds and less than 90 seconds.

3. The bio-based composition according to claim 1 or 2, wherein: The first natural degradable material is selected from a light skin beautifying agent or yeast polysaccharide, and the second natural degradable material is selected from sodium carrageenan or budding pullulan polysaccharide, wherein the light skin beautifying agent refers to a mixture in which maltose is greater than 80wt% and Agave tatarinowii leaf extract is less than 20wt% relative to the total weight of the mixture.

4. The bio-based composition according to any one of claims 1 to 3, wherein The bio-based composition comprises a light skin beautifying agent and sodium carrageenan, and a third natural degradable material selected from budding pullulan polysaccharide, hydrolyzed corn starch, yeast polysaccharide or sodium hyaluronate.

5. The bio-based composition according to claim 4, wherein: The mass ratio of the first natural degradable material: the second natural degradable material: the third natural degradable material is (1-30): (1-5): (1-50).

6. The bio-based composition according to claim 4 or 5, wherein: The third natural degradable material is yeast polysaccharide, and preferably the mass ratio of the light skin beautifying agent: sodium carrageenan: yeast polysaccharide is 15:2:

15.

7. A cosmetic composition comprising: 1.5 wt % to 6.0 wt % of the bio-based composition of any one of claims 1 to 6, based on the total weight of the cosmetic composition.

8. The cosmetic composition according to claim 7, wherein The cosmetic composition further comprises at least one cosmetic active agent, wherein the at least one cosmetic active agent is selected from moisturizers, fillers, UV absorbers, thickeners, emulsifiers, emollients, surfactants, fragrances, antioxidants, stabilizers, preservatives, pH adjusters, chelating agents, cooling agents; and / or The cosmetic composition is in the following forms: skin care products, preferably day cream, night cream, sunscreen, after-sun cream, and facial mask; hair care products, preferably shampoo, conditioner, styling hair spray, and hair dye products; base makeup products, preferably foundation, primer, concealer, eye shadow, mascara, lipstick, lip gloss, lip gloss, eyeliner, and nail polish; more preferably, the cosmetic composition is a base makeup product.

9. Use of the bio-based composition according to any one of claims 1 to 6 in the preparation of a cosmetic composition.

10. A method for makeup or care of keratinous materials, comprising: At least one cosmetic composition according to claims 7 and 8 is applied to the keratinous material.

Images