FcRn affinity parent peptide, derived peptide and application of FcRn affinity parent peptide and derived peptide

Abstract

The invention discloses an FcRn affinity parent peptide, a derivative peptide and application thereof. The amino acid sequence of the FcRn affinity parent peptide is WPHHRHH or WHHPHKK, the FcRn affinity parent peptide and the derivative peptide thereof can be specifically combined with an FcRn extracellular domain, and the FcRn affinity parent peptide and the derivative peptide thereof have an excellent affinity effect on FcRn protein under the condition of acidic pH (pH 6.0). Besides, an endocytosis experiment finds that the FcRn affinity parent peptide and the derivative peptide thereof have a better endocytosis effect under an acidic (pH 6.0) or neutral (pH 7.4) condition, and the FcRn protein is highly expressed in intestinal mucosa, so that the FcRn affinity parent peptide and the derivative peptide can be used for improving mucosa delivery, can be used as an accelerant for oral administration and absorption of medicines, and can be used for preparing medicines for oral administration. The method has a wide application prospect in the aspect of targeted FcRn protein drug delivery.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an FcRn affinity parent peptide, a derivative peptide and applications thereof. Background Art

[0002] FcRn is an important membrane protein that belongs to the major histocompatibility complex (MHC) family. FcRn plays a key role in multiple physiological processes, especially in the immune system and antibody transport. The protein is distributed throughout the intestine. In the adult intestine, the expression of FcRn mRNA from high to low is proximal colon>ileum>jejunum>duodenum. FcRn is widely expressed. In addition to the intestine, FcRn is expressed in vascular endothelium, blood-brain barrier, placenta, kidney, liver, lung, breast, genitals, eyes, skin, bones, antigen-presenting cells and the entire hematopoietic system. Related studies have shown that the most important biological function of FcRn in adults is to protect its ligands IgG and serum albumin, avoiding their intracellular degradation, thereby prolonging the half-life. When interacting with the ligand, the N in the imidazole ring of the key amino acid histidine is deprotonated at pH 6-7, making the binding of FcRn to the ligand pH-dependent, that is, binding under acidic conditions and releasing under neutral conditions, thereby allowing the ligand to escape lysosomal phagocytosis and have a longer half-life.

[0003] At present, the drugs targeting FcRn are mainly drugs that block the FcRn pathway and are used for immune-related diseases. These include FcRn-targeted monoclonal antibody drugs and in vitro recombinant Fc fragment proteins, such as the Fc recombinant protein drug Efgartigimod and monoclonal antibodies Rozanolixizumab (UCB-7665), Nipocalimab (M281), Batoclimab (RVT1401) and Orilanolimab (SYNT001). Among them, Efgartigimod is an in vitro recombinant protein fragment of the Fc structure of human IgG1. Its intended indications include myasthenia gravis, pemphigus, immune thrombocytopenia and chronic inflammatory demyelinating polyneuropathy. Rozanolixizumab (UCB-7665) is a subcutaneously administered humanized IgG4 antibody that specifically binds to human FcRn, blocks the interaction between FcRn and IgG, and induces the clearance of pathogenic IgG autoantibodies. It is currently in Phase III clinical trials. The nipocalimabM281 molecule is essentially a deglycosylated fully human IgG1 antibody that targets FcRn and is used to prevent fetal and neonatal hemolytic disease. It is currently in Phase III clinical research. Batoclimab (RVT1401) is a fully human monoclonal antibody that blocks the FcRn-IgG interaction by binding to FcRn to accelerate the degradation of autoantibodies and treat various pathogenic IgG-mediated autoimmune diseases. Clinical studies for multiple indications are currently underway. Orilanolimab (SYNT001) is a humanized IgG4 antibody that targets FcRn and is indicated for warm autoimmune hemolytic anemia (WAIHA), pemphigus vulgaris (PV) or pemphigus foliaceus (PF) (terminated in Phase II clinical trials). However, IgG proteins and antibody drugs usually have large molecular weights, high production costs, poor tissue permeability, and cannot penetrate well into the tumor. For this reason, small molecule drugs such as peptides have gradually become a research hotspot due to their advantages such as easy synthesis and modification, small molecular weight, and strong tissue permeability.

[0004] In related studies, researchers used phage display technology to discover an IgG Fc segment binding peptide, which is a collection of five peptides, with a common peptide motif consisting of the sequence GHFGGXY (where X is preferably a hydrophobic amino acid), which can bind to FcRn and inhibit the protein interaction between human IgG and FcRn. On this basis, the researchers modified the obtained peptides, including truncation, alanine scanning, N-methyl scanning and other experiments, and studied the effects of analogs by systematically replacing amino acids in the peptide sequence with other analogs. These peptides are collectively referred to as FcBP. FcBPs all contain an eleven-membered ring containing a highly similar heptapeptide sequence Gly-His-Phe-Gly-Gly-X-Tyr (X represents a hydrophobic amino acid), which is formed by disulfide bonds formed by sulfhydryl groups on cysteines at different positions. However, the synthesis method of cyclic peptides is complicated, and the existing IgG Fc segment binding peptides are used to target the Fc segment of IgG, block the interaction between IgG and FcRn to accelerate the metabolism of IgG in the body, and remove pathological IgG. There are no relevant reports on whether FcRn affinity peptides can be used as transport tools to improve mucosal delivery. Based on this, it is urgent to find an FcRn affinity peptide that not only has a good affinity effect on FcRn protein, but can also be used as a transport tool to improve mucosal delivery. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes an FcRn affinity parent peptide, a derivative peptide and its application, the FcRn affinity parent peptide and its derivative peptide can specifically bind to the FcRn extracellular domain, and have excellent affinity effect on FcRn protein under acidic pH conditions. In addition, the present invention finds through endocytosis experiments that the FcRn affinity parent peptide and its derivative peptide of the present invention have better endocytosis effect under acidic (pH 6.0) conditions compared with neutral pH conditions, and can be endocytosed by adjusting pH, and has broad application prospects in drug delivery targeting FcRn protein.

[0006] In a first aspect of the present invention, there is provided an FcRn affinity peptide, wherein the FcRn affinity peptide is any one of A1) to A4):

[0007] A1), a polypeptide with an amino acid sequence as shown in SEQ ID NO.1 or SEQ ID NO.2;

[0008] A2), a derivative polypeptide obtained by subjecting the amino acid residues 1 to 7 of the polypeptide as described in A1) to 1 to 2 mutations;

[0009] A3), a fusion polypeptide obtained by connecting a PD-L1 blocking polypeptide sequence to the N-terminus and / or C-terminus of the polypeptide described in A1) or A2);

[0010] A4), a fusion polypeptide obtained by connecting a tag sequence to the N-terminus and / or C-terminus of the polypeptide as described in any one of A1) to A3).

[0011] The FcRn affinity peptide according to the embodiments of the present invention has at least the following beneficial effects:

[0012] The FcRn affinity parent peptide and its derivative peptides of the present invention can specifically bind to the FcRn extracellular domain, and have excellent affinity effects on the FcRn protein under acidic pH conditions. In addition, the present invention has found through endocytosis experiments that compared with neutral pH conditions, the FcRn affinity parent peptide and its derivative peptides of the present invention have better endocytosis effects under acidic conditions (pH 6.0), and can be endocytosed by adjusting the pH method, which has broad application prospects in the delivery of targeted FcRn protein drugs.

[0013] In some embodiments of the present invention, the amino acid residues in the FcRn affinity peptide are in L configuration and / or D configuration, preferably in L configuration.

[0014] In some embodiments of the present invention, the FcRn affinity peptide comprises at least 1, 2, 3, 4, 5, 6 or 7 D-configuration amino acid residues.

[0015] In some embodiments of the present invention, the FcRn affinity peptide comprises 6 D-configuration amino acid residues.

[0016] In some embodiments of the present invention, the amino acid sequence of the PD-L1 blocking polypeptide sequence is shown as SEQ ID NO.15.

[0017] In some embodiments of the present invention, the amino acid sequence of the affinity peptide is shown in any one of SEQ ID NO.1 to SEQ ID NO.14 and SEQ ID NO.16.

[0018] The second aspect of the present invention provides a biomaterial related to the FcRn affinity peptide as described in any one of the first aspect, wherein the biomaterial is any one of C1) to C8):

[0019] C1), a nucleic acid molecule encoding the FcRn affinity peptide according to any one of the first aspects;

[0020] C2), an expression cassette containing the nucleic acid molecule described in C1);

[0021] C3), a recombinant vector containing the nucleic acid molecule described in C1);

[0022] C4), a recombinant vector containing the expression cassette described in C2);

[0023] C5), a recombinant biological cell containing the nucleic acid molecule described in C1);

[0024] C6), a recombinant biological cell containing the expression cassette described in C2);

[0025] C7), a recombinant biological cell containing the recombinant vector described in C3);

[0026] C8), a recombinant biological cell containing the recombinant vector described in C4).

[0027] In some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the FcRn affinity peptide in a host cell. The DNA may include not only a promoter for initiating transcription of the FcRn affinity peptide gene, but also a terminator for terminating transcription of the FcRn affinity peptide gene. Further, the expression cassette may also include an enhancer sequence.

[0028] In some embodiments of the present invention, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0029] In some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the FcRn affinity peptide into the multiple cloning site of the vector.

[0030] In some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. Among them, the bacteria can be Escherichia coli, such as E. coli DH5α or E. coli BL21. The recombinant organism does not contain reproductive material.

[0031] In some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule C1), the expression cassette C2) or the recombinant vector C3) into a biological cell. Specifically, it can be a recombinant Escherichia coli obtained by introducing the recombinant vector into E. coli DH5α or E. coli BL21.

[0032] The third aspect of the present invention provides a method for preparing the FcRn affinity peptide as described in any one of the first aspect, comprising preparing it by any one of solid phase synthesis, liquid phase synthesis or genetic recombination expression.

[0033] In some embodiments of the present invention, the method for preparing the FcRn affinity peptide is preferably solid phase synthesis.

[0034] The solid-phase synthesis method is simple, easy, low-cost, and highly practical. The resulting polypeptide has a small molecular weight and strong specificity. It can effectively avoid the blood toxicity easily produced by FcRn antibodies. It has good biosafety and high application value, and is conducive to the development of early diagnosis and immunotherapy of tumors with high FcRn expression.

[0035] In some embodiments of the present invention, the solid phase synthesis method is Fmoc solid phase synthesis method.

[0036] The fourth aspect of the present invention provides a pharmaceutical composition comprising the FcRn affinity peptide according to any one of the first aspect, and a pharmaceutically acceptable carrier.

[0037] The term "pharmaceutically acceptable" refers to a substance that is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents. The choice of carrier should match the mode of administration, specifically matching according to methods well known to those of ordinary skill in the art.

[0038] In some embodiments of the present invention, the pharmaceutically acceptable carrier comprises at least one of water, saline, buffer, glycerol, ethanol, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, and nanogels.

[0039] In some embodiments of the present invention, the FcRn affinity peptide can be chemically modified to extend the half-life while retaining the activity of the FcRn affinity peptide, such as cyclization modification, acetylation modification, PAS modification, PEG modification, fatty acid modification, albumin modification, albumin affinity peptide modification, NOTA modification, radionuclide modification, tumor homing peptide coupling, membrane-penetrating peptide coupling, nanocarrier coupling and the like.

[0040] The fifth aspect of the present invention provides an FcRn protein detection reagent, comprising the FcRn affinity peptide described in any one of the first aspects.

[0041] The FcRn protein detection reagent according to the embodiment of the present invention has at least the following beneficial effects: the affinity peptide of the present invention has excellent affinity effect on FcRn protein, especially under acidic conditions, and can be used to prepare FcRn protein detection reagent.

[0042] In some embodiments of the present invention, the FcRn protein detection reagent further comprises a developer and / or a tracer.

[0043] The sixth aspect of the present invention provides use of the FcRn affinity peptide as described in any one of the first aspect, the biomaterial of the second aspect, or the pharmaceutical composition of the fourth aspect in the preparation of a drug carrier.

[0044] The FcRn affinity peptide of the present invention has excellent affinity effect on FcRn protein, and since FcRn protein is highly expressed in the intestinal mucosa, combining the drug with the FcRn parent peptide and the derivative peptide of the present invention helps to improve the mucosal delivery efficiency.

[0045] Other features and advantages of the present invention will be set forth in the description which follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0047] Figure 1 is the mass spectrum of the FcRn affinity parent peptide 1 of the present invention;

[0048] Figure 2 is the mass spectrum of the FcRn affinity parent peptide 2 of the present invention;

[0049] Figure 3 is the mass spectrum of the polypeptide W1A of the present invention;

[0050] Figure 4 is the mass spectrum of the polypeptide P2A of the present invention;

[0051] Figure 5 is the mass spectrum of polypeptide H3A of the present invention;

[0052] Figure 6 is the mass spectrum of polypeptide H4A of the present invention;

[0053] Figure 7 is the mass spectrum of the polypeptide R5A of the present invention;

[0054] Figure 8 is the mass spectrum of polypeptide H6A of the present invention;

[0055] Fig. 9 is the mass spectrum of polypeptide H7A of the present invention;

[0056] Fig.10 is the mass spectrum of the polypeptide P2A (W1P) of the present invention;

[0057] Fig.11 is the mass spectrum of the polypeptide A2W of the present invention;

[0058] Fig.12 is the mass spectrum of the polypeptide A2K of the present invention;

[0059] Fig.13 is the mass spectrum of the polypeptide P2A (R5Q) of the present invention;

[0060] Fig.14 is the mass spectrum of the polypeptide P2A (H7W) of the present invention;

[0061] Fig.15 is the mass spectrum of the polypeptide A2K+rvysf of the present invention;

[0062] Fig.16 The results of the affinity test of the FcRn affinity parent peptide and its derivative peptides of the present invention to THP-1 cells;

[0063] Fig.17 The FcRn affinity parent peptide and its derivative peptide of the present invention are combined with HEK-293T hFcRn&β2M HEK-293T cells pLVX-puro Cell affinity effect test data;

[0064] Fig.18 The results of the endocytosis detection of the FcRn affinity parent peptide and its derivative peptides in RAW264.7 cells under pH 6.0 conditions of the present invention, wherein A is a fluorescence colorimetric diagram, B is a statistical result of the average fluorescence signal, and the scale length is 100 μm;

[0065] Fig.19 The results of the endocytosis detection of the FcRn affinity parent peptide and its derivative peptides in RAW264.7 cells under pH 7.4 conditions of the present invention, wherein A is a fluorescence colorimetric diagram, B is a statistical result of the average fluorescence signal, and the scale length is 100 μm;

[0066] Fig. 20 The results of the endocytosis test of the FcRn affinity parent peptide and its derivative peptides in 293T cells under pH 6.0, where A is HEK-293T pLVX-puro Cells, B is HEK-293T hFcRn&β2M cells, scale length is 30 μm;

[0067] Fig.21 The results of the endocytosis test of the FcRn affinity parent peptide and its derivative peptides in 293T cells under pH 7.4, where A is HEK-293T pLVX-puro Cells, B is HEK-293T hFcRn&β2M cells, scale length is 30 μm;

[0068] Fig. 22 The statistical results of the endocytosis effect of the FcRn affinity parent peptide and its derivative peptides under different pH conditions of the present invention, A is the statistical data under pH 6.0, and B is the statistical data under pH 7.4;

[0069] Fig.23The data are the detection data of the drug delivery promoting effect of the polypeptide A2K+rvysf of the present invention, wherein A is the fluorescence color development diagram, B is the statistical result of the average fluorescence signal, and the scale length is 200 μm. DETAILED DESCRIPTION

[0070] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0071] The words "preferably", "more preferably" and the like in the present invention refer to embodiments of the present invention that may provide certain beneficial effects in certain circumstances. However, other embodiments may also be preferred under the same circumstances or other circumstances. In addition, the description of one or more preferred embodiments does not imply that other embodiments are not applicable, nor is it intended to exclude other embodiments from the scope of the present invention.

[0072] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0073] In the description of the present invention, the term "and / or" includes all and any combinations of one or more related listed items.

[0074] In the description of the present invention, the description of the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0075] In the description of the present invention, the term "amino acid" refers to the basic unit constituting protein, which gives the protein a specific molecular structure and makes its molecule have biochemical activity. For example, the "amino acid" used in the present invention includes the following 20 natural amino acids: alanine (Ala or A), glycine (Gly or G), isoleucine (Ile or I), asparagine (Asn or N), arginine (Arg or R), lysine (Lys or K), cysteine ​​(Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), leucine (Leu or L), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), valine (Val or V) and tyrosine (Tyr or Y).

[0076] In the embodiments of the present invention, hFcRn & β2M-His eukaryotic protein was purchased from Sino Biological; hβ2M-His eukaryotic protein was purchased from Sino Biological; heptapeptide library phage display kit was purchased from NEB; Streptavidin-PE was purchased from eBioscience; DAPI solution was purchased from Beijing Solebao; chloral hydrate was purchased from Shanghai Yuduo Biotechnology. C57BL / 6 mice were purchased from Zhuhai Bestone Company.

[0077] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0078] Example 1: Screening of FcRn-affinity parent peptides and design of derivative peptides

[0079] This embodiment provides a method for screening FcRn affinity parent peptides and designing derivative peptides thereof, which specifically includes the following contents.

[0080] 1. Screening of FcRn affinity parent peptides:

[0081] (1) This example uses a solid phase protein screening method to screen a phage display heptapeptide library based on a heptapeptide library phage display kit, uses hFcRn & β2M-His eukaryotic protein for solid phase screening of polypeptides, and uses hβ2M-His eukaryotic protein for differential screening;

[0082] (2) Using hFcRn & β2M His eukaryotic protein as the target, four rounds of solid phase screening were performed, and hβ2M-His eukaryotic protein was used for differential screening starting from the second round, so that the peptides obtained by screening had specific affinity to FcRn rather than β2M;

[0083] (3) In the fourth round of conditional elution, elution was first performed with PBST at pH 7.4, the eluted product was collected, and then eluted with PBST at pH 2.2. Phage monoclones with affinity to the extracellular segment of the target protein human FcRn were enriched in each round;

[0084] (4) Selecting positive clones for sequencing, a total of multiple inserted heptapeptide sequences, i.e., affinity heptapeptide sequences, were obtained. This method was used to screen out two affinity peptides with repeated clones (i.e., FcRn affinity parent peptides), and their amino acid sequences are as follows:

[0085] FcRn affinity parent peptide 1: WPHHRHH (SEQ ID NO. 1);

[0086] FcRn affinity parent peptide 2: WHHPHKK (SEQ ID NO. 2).

[0087] The amino acid configurations of the above-mentioned FcRn affinity parent peptides are all L-type.

[0088] 2. Design of derivative peptides of FcRn affinity parent peptides:

[0089] In order to analyze the effect of specific amino acids on the activity of the entire polypeptide, the present invention designed the following alanine scanning peptides and related derivative peptides based on the amino acid sequence of the above-mentioned FcRn affinity parent peptide 1, and their amino acid sequence information is specifically shown in Table 1.

[0090] Table 1: Sequence information of FcRn affinity parent peptide and its derivative peptides

[0091]

[0092] Note: The amino acids indicated by capital letters in the amino acid sequence of Table 1 above are "L" configuration amino acids, and the amino acids indicated by lowercase letters are "D" configuration amino acids. The underlined amino acid residues in the amino acid sequence are the mutated amino acid residues.

[0093] Example 2: Synthesis and purification of FcRn affinity parent peptide and derivative peptides

[0094] This embodiment provides a method for synthesizing an FcRn affinity parent peptide and its derivative peptides, which specifically comprises the following steps:

[0095] (1) Rink resin is used as a carrier, and the target peptide is synthesized from the C-terminus to the N-terminus of the sequence. Specifically, amino acids (W, P, K, H, R) protected by Fmoc (Fmoc-methyloxycarbonyl) or Boc (tert-butyloxycarbonyl) are used as raw materials, and the amount added is 3 times the equivalent of the resin. Then, 3 times the equivalent of the Rink resin, condensing agent 6-chlorobenzotriazole 1,1,3,3-tetramethyluronium hexafluorophosphate (HCTU) and condensing agent N,N-diisopropylethylamine (DIEA) are added respectively for coupling for 45 minutes, and then N,N-dimethylformamide (DMF) and dichloromethane (DCM) are washed alternately. When the Rink resin does not turn blue after ninhydrin detection, DMF and piperidine in a ratio of 4:1 are used to remove the Fmoc protecting group, and the steps of "washing-coupling-ninhydrin detection-deprotection" are repeated until the last amino acid is coupled.

[0096] (2) using a peptide cleavage reagent to cleave the polypeptide of step (1) from the carrier Rink resin for 3 hours, adding ether pre-cooled on ice to precipitate the polypeptide, then centrifuging to collect the precipitate and washing it with ether for 3 times, and finally drying it in a fume hood to obtain a crude polypeptide; wherein the peptide cleavage reagent is prepared from trifluoroacetic acid (TFA), anisole, phenol, ethanedithiol and double distilled water in a ratio of 7:9:6:6:3.

[0097] (3) Purify the crude polypeptide obtained in step (2) by preparative reverse phase liquid chromatography (RP HPLC), wherein mobile phase A is 0.1% trifluoroacetic acid (TFA) / water, mobile phase B is acetonitrile; the linear elution gradient is 10% B, 50% B; the flow rate is 10 mL / min, and the detection wavelength is 220 nm; finally, the purified polypeptide is obtained after freeze drying.

[0098] The above method was used to prepare the FcRn affinity parent peptide and its derivative peptide, and the purified polypeptides were subjected to mass spectrometry analysis. Figure 1 to Figure 15 As shown, Figure 1 This is the mass spectrum of FcRn affinity parent peptide 1, with a theoretical molecular weight of 1531.5, 1 / 2 (M+2H) 2+ =766.5; Figure 2 This is the mass spectrum of FcRn affinity parent peptide 2, with a theoretical molecular weight of 1494.5, 1 / 2 (M+2H) 2+ =748.25; Figure 3 This is the mass spectrum of peptide W1A, with a theoretical molecular weight of 1416.54, 1 / 2 (M+2H) 2+ =709.82; Figure 4 This is the mass spectrum of polypeptide P2A, with a theoretical molecular weight of 1505.64, 1 / 2 (M+2H) 2+ =753.82; Figure 5This is the mass spectrum of polypeptide H3A, with a theoretical molecular weight of 1465.61, 1 / 2 (M+2H) 2+ =733.805; Figure 6 This is the mass spectrum of polypeptide H4A, with a theoretical molecular weight of 1465.61, 1 / 2 (M+2H) 2+ =733.805; Figure 7 This is the mass spectrum of peptide R5A, with a theoretical molecular weight of 1446.57, 1 / 2 (M+2H) 2+ =724.285; Figure 8 This is the mass spectrum of polypeptide H6A, with a theoretical molecular weight of 1465.61, 1 / 2 (M+2H) 2+ =733.805; Fig. 9 This is the mass spectrum of peptide H7A, with a theoretical molecular weight of 1465.61, 1 / 2 (M+2H) 2+ =733.805; Fig.10 This is the mass spectrum of the peptide P2A (W1P), with a theoretical molecular weight of 1415.3, 1 / 2 (M+2H) 2+ =708.65; Fig.11 This is the mass spectrum of peptide A2W, with a theoretical molecular weight of 1619.5, 1 / 2 (M+2H) 2+ =810.75; Fig.12 This is the mass spectrum of peptide A2K, with a theoretical molecular weight of 1561.5, 1 / 2 (M+2H) 2+ =781.75; Fig.13 This is the mass spectrum of the peptide P2A (R5Q), with a theoretical molecular weight of 1476.3, 1 / 2 (M+2H) 2+ =739.15; Fig.14 This is the mass spectrum of the peptide P2A (H7W), with a theoretical molecular weight of 1553.3, 1 / 2 (M+2H) 2+ =777.65; Fig.15 This is the mass spectrum of the peptide A2K+rvysf, with a theoretical molecular weight of 1834.01, 1 / 2 (M+2H) 2+ =918.00. The results are consistent with expectations.

[0099] Example 3: Affinity testing of FcRn-affinity parent peptide and derived peptides for human FcRn protein

[0100] In this example, the overexpression transient cell line HEK-293T hFcRn&β2M The affinity of the FcRn affinity parent peptide and its derivative peptides to the human FcRn protein (hFcRn protein) under different pH conditions was detected, specifically including the following contents.

[0101] 1. Construction of overexpression transient cell line HEK-293T hFcRn&β2M

[0102] Construction of overexpression transient cell line HEK-293T using lentiviral expression system hFcRn&β2M , specifically including the following steps:

[0103] (1) Based on the human FcRn (hFcRn) gene sequence (Gene ID: 2217), the human β2M gene sequence (GeneID 127829449) and the lentiviral expression vector pLVX puro (Clontech), the restriction sites XhoI and XbaI were selected and the upstream and downstream primer sequences were synthesized by Sangon Biotech Co., Ltd. The primer sequences designed for each gene sequence are shown in Tables 2, 3 and 4 below:

[0104] Table 2: Human FcRn primer sequence list

[0105]

[0106] Table 3: Humanβ2M primer sequence list

[0107]

[0108] Table 4: Human FcRn & β2M primer sequence list

[0109]

[0110] (2) Peripheral blood was drawn from healthy volunteers and centrifuged with commercial lymphocyte separation solution (purchased from Tianjin Haoyang Biological Products Technology Co., Ltd.) to obtain human peripheral blood mononuclear cells (PBMCs). RNA was extracted from human peripheral blood mononuclear cells (PBMCs) and cDNA was obtained after reverse transcription. Human FcRn gene fragments were obtained by PCR (the PCR reaction system was 20 μL, including 10 μL of 2×Mix premix, 1 μL of 10 μM primer F, 1 μL of 10 μM primer R, 1 μL of cDNA template, and 7 μL of sterile water). The desired FcRn gene was obtained after separation and purification by agarose gel electrophoresis. Finally, the FcRn gene and plvx-puro vector were digested with XhoI and XbaI enzymes and recovered.

[0111] (3) We commissioned Sangon Biotech to synthesize a partial FcRn fragment plus the P2A linker and the full length of β2M. The specific sequence information is as follows:

[0112] AATGTGATTCCAGCCACCGCCGGATCCGGCTCCGGAGCCACGAACTTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCTATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGC TATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAA(SEQ ID NO.21).

[0113] (4) Using overlap extension PCR technology, the obtained FcRn gene and the company's synthetic fragment were used as templates, and plvx hFcRn F (XhoI) and plvx hβ2M R (XbaI) primers were used to obtain FcRn-P2A-β2M by PCR. The desired FcRn & β2M genes were obtained after separation and purification by agarose gel electrophoresis, and finally the FcRn & β2M genes were digested with XhoI and XbaI enzymes and recovered.

[0114] (5) Add 3 μL of FcRn & β2M gene digested in step (2), 3 μL of pLVX puro vector DNA digested in step (2), and 3 μL of Ligation high in sequence, mix well, and ligate in a 16°C metal bath for 1 hour.

[0115] (6) Add 5 μL of the ligation product from step (3) to 50 μL of commercial competent cells DH5α (purchased from Beijing Quanshijin) and mix well. Place on ice for 30 min, heat shock at 42°C for 90 s, and place on ice. Add 800 μL of fresh LB medium and shake on a shaker for 1 h to activate the bacteria.

[0116] (7) The bacterial solution after shaking in step (4) was centrifuged at 3000 rpm for 5 min, 600 μL of the supernatant was discarded, the bacterial solution was blown evenly, and spread on an LB plate with ampicillin resistance and cultured overnight.

[0117] (8) The next day, a single white colony was selected and cultured in LB liquid culture medium using a pipette tip. After culture, the colony was sequenced and the correct sequence was the lentiviral expression vector pLVX hFcRn&β2M containing the target gene sequence.

[0118] (9) HEK293T cells were cultured in DMEM medium (containing 10% FBS, 100 U / mL penicillin and 100 μg / mL streptomycin), and logarithmically growing cells were collected and counted. 6 The cells / well were inoculated into 6-well or 10 mm cell culture plates and placed in a cell culture incubator at 37°C and 5% CO 2 Cultivated under conditions.

[0119] (10) Set up tube A and tube B, where the configurations of tube A and tube B are as follows:

[0120] Tube A: Pipette 24 μL PEI and add it dropwise to 300 μL Opti MEM serum-free medium and mix well;

[0121] Tube B: Mix 6 μg of lentiviral plasmid in 300 μL Opti MEM serum-free medium.

[0122] When the density of the HEK 293T cells cultured in step (6) reaches 70-80% confluence, the transfection reagent in tube A is evenly added to tube B, gently shaken and mixed, and incubated at room temperature for 15 minutes. After the incubation is completed, the mixed solution of tubes A and B is dripped into the DMEM medium containing HEK 293T cells. After culturing for 6 hours, the HEK 293T cells are replaced with fresh DMEM complete medium again. After transfection for 48 hours, transient cells are obtained, that is, the overexpression transient cell line HEK-293T hFcRn&β2M The transfection efficiency was detected by flow cytometry.

[0123] 2. Affinity effect detection of parent peptide and derived peptide

[0124] (1) Set up sample tubes, PBS negative control tubes, and GA peptide (GAGAAGGAGGGGGGG, SEQ ID NO.22) negative control tubes, and place THP-1 cells, HEK-293T cells, and hFcRn&β2M or HEK-293T pLVX-puro The cells were cultured in DMEM medium and collected in the logarithmic growth phase. The cells were counted and counted as 2×10 5 cells / tube were divided into sample tubes and negative control tubes. Pre-cooled PBS buffer (pH = 7.4) was added to the sample tubes and negative control tubes, centrifuged at 4°C, 1500 × g for 5 min, and then placed on ice;

[0125] (2) Weigh a small amount of the polypeptide to be tested and GA peptide and add them to PBS buffer (pH = 7.4) to dissolve them to a final concentration of 1 mM for later use;

[0126] (3) Add 10 μL of the corresponding peptide and 90 μL of PBS buffer (pH = 7.4) to the sample tube and the control tube to make the final peptide concentration 100 μM. Vortex mix and incubate on ice for 30 min. Then wash away the unbound peptide with PBS buffer (pH = 7.4) for 3 times.

[0127] (4) Add Streptavidin-PE and incubate at 4°C for 30 min. Resuspend with 200 μL PBS buffer (pH = 7.4), and then use flow cytometry to detect the binding of the test polypeptide to the cells under the above pH 7.4 condition.

[0128] Referring to the above steps (1) to (4), PBS was replaced with pH 6.0 for affinity experiments to compare the pH-selective affinity effects of the parent peptide and its derivative peptides on FcRn.

[0129] The statistical diagram of the affinity effect of FcRn parent peptide and THP-1 cells under different pH conditions is shown in the figure Fig.16 As shown, the FcRn parent peptide was stained with HEK-293T hFcRn&β2M The statistical data of affinity effect of HEK-293T-pLVX-puro cells are as follows Fig.17 As shown; FcRn parent peptide and HEK-293T hFcRn&β2M The affinity data test results of cells or HEK-293T-pLVX-puro cells are shown in Table 5.

[0130] Table 5: Affinity test results

[0131]

[0132] The test results showed that these peptides all interacted with 293T hFcRn&β2M The binding is stronger under neutral conditions, while the binding is relatively weaker under neutral conditions, which is consistent with the pH-dependent binding of FcRn ligands, indicating that these peptides can all have affinity for the FcRn target.

[0133] Example 4: Detection of the endocytosis effect of FcRn affinity parent peptide and derived peptides

[0134] This example detects the endocytosis effect of the FcRn affinity parent peptide and its derivative peptides (P2A, A2W and A2K) under different pH conditions. Taking pH 7.4 as an example, the specific detection method is as follows:

[0135] (1) RAW264.7 cells (or HEK-293ThFcRn&β2M HEK-293T cells pLVX-puro Cells) were plated on confocal microplates;

[0136] (2) The peptide was dissolved in PBS (pH 7.4) and the peptide to be tested and the cells were placed in a 37°C, 5% CO 2 Incubate in a constant temperature incubator for 0.5 h, and the final concentration of the peptide is 100 μM;

[0137] (3) After co-incubation, wash once with PBS (pH 7.4), add 500 μL of 37°C preheated DAPI working solution to stain the nucleus for 0.5 h (final concentration of 2 μg / mL);

[0138] (4) After nuclear staining, wash once with PBS (pH 7.4) and fix with 500 μL of fixative at room temperature in the dark for 30 min;

[0139] (5) After fixation, discard the fixative, add 500 μL of membrane permeabilization agent, and incubate at room temperature for 5 min;

[0140] (6) Aspirate and discard the membrane permeabilization agent, add 200 μL of antibody diluent SA-APC, add 0.5 μL of antibody stock solution for every 50 μL of membrane permeabilization agent, and incubate at 25°C for 30 min;

[0141] (7) Aspirate and discard the antibody, add 1 mL PBS (pH 7.4) to wash twice, and then use Olympus confocal microscope to detect the internalization of the polypeptide. Each group of experiments was repeated three times and the average value was taken.

[0142] Referring to the above steps (1) to (7), PBS was replaced with pH 6.0 for detection, and the pH-selective throughput of cells for the parent peptide and its derivative peptide was compared.

[0143] Fig.18 and Fig.19 The results of endocytosis detection of the parent peptide and RAW264.7 cells, where Fig.18 The test results at pH 6.0 are shown in Table 1. Fig.19 The test results are at pH 7.4; Fig. 20 The parent peptide and some of its derivative peptides were cultured with HEK-293T cells at pH 6.0. pLVX-puro HEK-293T cells hFcRn&β2M The results of cell endocytosis detection, Fig.21 The parent peptide and some of its derivative peptides were incubated with HEK-293T-pLVX-puro cells and HEK-293T at pH 7.4. hFcRn&β2M The results of cell endocytosis detection, Fig. 22 Table 6 is the statistical result of its average fluorescence intensity, and Table 7 is the detection result of its average fluorescence intensity.

[0144] Table 6: Endocytosis effect test results

[0145]

[0146]

[0147] The test results show: compared with 293T pLVX-puro These peptides were all expressed in 293T hFcRn&β2M The results showed that these peptides were more internalized and bound more weakly under neutral conditions, which was consistent with the affinity experiment, indicating that these peptides could bind to the FcRn target in a pH-dependent manner and be internalized.

[0148] Example 5: Application of FcRn affinity parent peptide and derivative peptides in promoting drug delivery

[0149] In this example, A2K+rvysf polypeptide (wkHhrhhGsrvysf) and control polypeptide (rvysf) were used as experimental objects to detect their effects in promoting drug delivery. The specific method is as follows:

[0150] First, three C57BL / 6 mice were fasted the night before to promote intestinal emptying. Then, the C57BL / 6 mice were anesthetized according to the recommended dose of chloral hydrate instructions. After waiting for a few minutes, the mice were anesthetized. At this time, surgical scissors and forceps were used to perform abdominal incision surgery, and the wound was as small as possible; a clean intestinal segment was selected, the two ends of the intestinal segment were ligated, and 500μL PBS was injected into the intestinal cavity of the segment; the other two mice were subjected to the same operation, one of which was injected with 500μL 100μMA2K+rvysf polypeptide, and the other was injected with the control group polypeptide (rvysf). After 1 hour, the above intestinal segment was cut off, the mouse was killed by dislocation of the neck, and the cut intestinal segment was irrigated with PBS 5 times, and then fixed with 4% PFA, and the sample was sent for frozen section processing; after returning the sample, a digital pathology slide scanner was used to detect the uptake of the polypeptide in the intestine.

[0151] Test results such as Fig.23 As shown, SEQ ID NO.15 and SEQ ID NO.16 respectively refer to the control polypeptide and A2K+rvysf polypeptide. The results show that SEQ ID NO.15 has a small amount of intestinal uptake relative to PBS, while SEQ ID NO.16 has a stronger uptake. SEQ ID NO.16 has a significant difference compared with SEQ ID NO.15, indicating that A2K polypeptide can promote intestinal delivery of other polypeptides.

[0152] In summary, the present invention obtains a seven-peptide that can specifically bind to the extracellular domain of FcRn by screening a phage display peptide library, and prepares FcRn affinity parent peptides WPHHRHH (SEQ ID NO.1) and WHHPHKK (SEQ ID NO.2) by solid phase synthesis with amino acids (W, P, H, R, K) protected by Fmoc (methoxycarbonyl) or Boc (tert-butyloxycarbonyl). Further, the present invention performs site mutation on the polypeptide based on the FcRn affinity parent peptide WPHHRHH by alanine scanning, bioinformatics technology, etc., and performs affinity effect detection and endocytosis effect detection. The results show that the FcRn affinity parent peptide of the present invention and its derivative peptides can effectively bind to FcRn protein, and can be taken up and discharged under acidic conditions (pH 6.0), and can be used for drug delivery.

[0153] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. An FcRn affinity peptide, characterized in that: The FcRn affinity peptide is any one of A1) to A4): A1), a polypeptide with an amino acid sequence as shown in SEQ ID NO.1 or SEQ ID NO.2; A2), a derivative polypeptide obtained by subjecting the amino acid residues 1 to 7 of the polypeptide as described in A1) to 1 to 2 mutations; A3), a fusion polypeptide obtained by connecting a PD-L1 blocking polypeptide sequence to the N-terminus and / or C-terminus of the polypeptide described in A1) or A2); A4), a fusion polypeptide obtained by connecting a tag sequence to the N-terminus and / or C-terminus of the polypeptide as described in any one of A1) to A3).

2. The affinity peptide according to claim 1, characterized in that: The amino acid residues in the FcRn affinity peptide are in L configuration and / or D configuration.

3. The affinity peptide according to claim 1, characterized in that: The FcRn affinity peptide comprises at least 1, 2, 3, 4, 5, 6 or 7 amino acid residues in D configuration; Preferably, the FcRn affinity peptide comprises 6 D-configuration amino acid residues.

4. The affinity peptide according to claim 1, characterized in that: The amino acid sequence of the PD-L1 blocking polypeptide sequence is shown in SEQ ID NO.

15.

5. The affinity peptide according to claim 1, characterized in that: The amino acid sequence of the affinity peptide is shown in any one of SEQ ID NO.1 to SEQ ID NO.14 and SEQ ID NO.

16.

6. A biomaterial related to the FcRn affinity peptide according to any one of claims 1 to 5, characterized in that The biological material is any one of C1) to C8): C1), a nucleic acid molecule encoding the FcRn affinity peptide according to any one of claims 1 to 5; C2), an expression cassette containing the nucleic acid molecule described in C1); C3), a recombinant vector containing the nucleic acid molecule described in C1); C4), a recombinant vector containing the expression cassette described in C2); C5), a recombinant biological cell containing the nucleic acid molecule described in C1); C6), a recombinant biological cell containing the expression cassette described in C2); C7), a recombinant biological cell containing the recombinant vector described in C3); C8), a recombinant biological cell containing the recombinant vector described in C4).

7. A method for preparing the FcRn affinity peptide according to any one of claims 1 to 5, characterized in that: The preparation is carried out by using any one of solid phase synthesis method, liquid phase synthesis method or gene recombination expression method.

8. A pharmaceutical composition, characterized in that: Comprising the FcRn affinity peptide according to any one of claims 1 to 5, and a pharmaceutically acceptable carrier.

9. A FcRn protein detection reagent, characterized in that: Comprising the FcRn affinity peptide according to any one of claims 1 to 5.

10. Use of the FcRn affinity peptide according to any one of claims 1 to 5, the biomaterial according to claim 6, or the pharmaceutical composition according to claim 8 in the preparation of a drug carrier.

Images