Lactobacillus casei and application thereof in preparation of fermented dairy products

Abstract

The invention discloses a lactobacillus casei strain and application thereof in preparation of fermented dairy products. The lactobacillus casei TGA is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number of the lactobacillus casei TGA is CCTCC M 20242379. The invention further provides a fermentation agent, and the fermentation agent contains the Lactobacillus casei TGA (Lactobacillus casei). The invention also provides an application of the Lactobacillus casei TGA (Lactobacillus casei) in the preparation of the fermented milk. Detection and sensory evaluation are carried out on flavor compounds of the fermented cow milk. Results show that the yield of acetaldehyde in the fermented milk prepared by using the lactobacillus casei TGA is relatively high, the sensory score is relatively high, the aroma quality of the fermented milk is improved, and the quality of the fermented milk is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a strain of Lactobacillus casei and application thereof in the preparation of fermented dairy products. Background Art

[0002] Fermented dairy products are a type of dairy product made from fresh milk through the fermentation activity of lactic acid bacteria. They are increasingly favored by consumers due to their rich nutritional value and unique flavor quality. Among them, lactic acid bacteria play a key role in the formation of flavor compounds and the quality of products during the fermentation process. The flavor substances produced by lactic acid bacteria fermentation include ketones, aldehydes, esters, alcohols and acids, which give fermented dairy products pleasant flavors such as butter and cream. Acetaldehyde is one of the characteristic flavor substances in fermented milk, which gives fermented milk a fresh and fruity aroma.

[0003] At present, fermented dairy products on the market usually enhance the flavor quality of the product by adding flavors from outside. However, as consumers pursue the "natural" attributes of food, the means of improving the flavor of fermented milk has gradually shifted from adding flavors from outside to endogenous flavor enhancement by lactic acid bacteria. Lactic acid bacteria and their starter are one of the core technologies in the fermented dairy industry, but their market has long been monopolized by foreign products. Although my country has a large number of lactic acid bacteria resources with rich varieties, the development of various strains of resources started late and is insufficient.

[0004] Chinese patent CN116555114B discloses a starter and its application, a milk tofu and its preparation method. The specification records that Lactococcus lactis IMAU12063 and Lactobacillus paracasei IMAU12062 are compounded in proportion as a starter for fermenting whole milk and making milk tofu, and the texture and flavor characteristics of the milk tofu are better than those of milk tofu made from naturally fermented milk. The fermentation time of milk can be shortened, the fermentation process is controllable, and the flavor substances of fermented milk are mainly acetaldehyde, diacetyl, acetoin, etc., which gives the milk tofu the unique flavor characteristics of traditional milk tofu while improving the sanitary quality and safety of milk tofu, making up for the deficiency of natural fermentation of raw milk in the traditional milk tofu production process that is only controlled by experience. However, the scheme does not explain whether there is a significant improvement in acetaldehyde, and according to the records of its embodiments, it can be seen that the acetaldehyde content does not change much.

[0005] Therefore, it is of great significance to screen lactic acid bacteria that can improve the flavor of fermented milk through endogenous flavor enhancement and enhance the aroma quality of fermented milk, which can provide certain guidance for the production of the dairy industry. Summary of the invention

[0006] The technical problem to be solved by the present invention is that the prior art lacks lactic acid bacteria with high-quality acetaldehyde production performance and the ability to improve the flavor of fermented dairy products.

[0007] In order to solve the above technical problems, the present invention provides a strain of Lactobacillus casei and application thereof in preparing fermented dairy products.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] The present invention first provides a Lactobacillus casei TGA, whose biological name is Lacticaseibacillus casei, and whose classification name is Lactobacillus casei. It is deposited in China Center for Type Culture Collection (CCTCC for short) on October 30, 2024, with a deposit address of Wuhan University, Wuhan, China, zip code: 430072, and a deposit number of CCTCC NO: M 20242379.

[0010] The Lactobacillus casei TGA is a lactic acid bacterium with high acetaldehyde production capacity. When used for preparing fermented dairy products, it can produce high acetaldehyde and significantly increase the types and contents of flavor compounds in fermented milk, thereby improving the aroma quality of the product.

[0011] The present invention further provides 16S rRNA of Lactobacillus casei TGA, and the nucleotide sequence thereof is shown as SEQ ID NO.1.

[0012] The present invention further provides a starter containing the Lactobacillus casei TGA.

[0013] The present invention provides a method for preparing a starter containing Lactobacillus casei TGA, comprising the following steps:

[0014] Step 1): streak the Lactobacillus casei TGA strain on a culture medium plate and culture until a single colony grows;

[0015] Step 2): Pick the single colony and culture it in liquid culture using MRS broth to a concentration of 1×10 9 CFU / mL, washing the obtained culture solution twice with physiological saline, and finally suspending it in physiological saline to obtain a starter containing the Lactobacillus casei TGA.

[0016] In one embodiment of the present invention, in step 1), the culture medium is MRS agar medium.

[0017] In one embodiment of the present invention, in step 1), the culture conditions are: culture in a 37° C. incubator for 24-48 hours.

[0018] In one embodiment of the present invention, in step 2), the culture conditions are 37° C. for 14-16 h.

[0019] In one embodiment of the present invention, in step 2), the mass concentration of the physiological saline is 0.85%, and the washing method is: controlling the rotation speed to 6000-8000 r / min and centrifuging for 5-10 min.

[0020] The present invention further provides application of the Lactobacillus casei TGA or a starter containing the Lactobacillus casei TGA in the preparation of fermented dairy products.

[0021] In one embodiment of the present invention, the fermented dairy product is fermented milk.

[0022] In one embodiment of the present invention, when preparing the fermented dairy product, whole milk powder or whole milk is used as a raw material.

[0023] In one embodiment of the present invention, the application is specifically:

[0024] Take whole milk powder as raw material, dissolve it in water at 50-55°C and stir to obtain reconstituted milk with a mass fraction of 10-12%, add sucrose with a mass ratio of 6-8%, and sterilize it at 90-95°C for 5-10 minutes;

[0025] After cooling to 30-40° C., adding the high-acetaldehyde-producing Lactobacillus casei TGA or a starter containing the Lactobacillus casei TGA, mixing well and fermenting at 37° C. until the pH reaches 4.6;

[0026] After stirring and breaking the emulsion, the mixture was stored at 4°C for 12 hours to obtain a fermented dairy product with high acetaldehyde production.

[0027] The concentration of Lactobacillus casei TGA in the starter culture containing Lactobacillus casei TGA is 10 9 CFU / mL and above.

[0028] The present invention further provides a fermented dairy product prepared by using the Lactobacillus casei TGA or a starter containing the Lactobacillus casei TGA.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] (1) The high-acetaldehyde-producing Lactobacillus casei TGA of the present invention was fermented in whole milk to pH = 4.6, and the acetaldehyde production was measured by GC-MS external standard method to reach 3.57 mg / kg, which was the highest production among 16 strains of Lactobacillus casei;

[0031] (2) The flavor compounds of milk fermented by different lactic acid bacteria were detected and sensory evaluated. The results showed that the Lactobacillus casei TGA of the present invention had a higher acetaldehyde production in fermented milk, a higher sensory score, and increased the aroma quality of the fermented milk. The Lactobacillus casei TGA of the present invention significantly increased the types and contents of flavor compounds in fermented milk, thereby improving the aroma quality of the product, and had broad prospects in the field of fermented dairy products. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 is the acetaldehyde content in fermented milk of the strains isolated from different fermentation samples;

[0033] Figure 2 is a phylogenetic tree based on the 16S rRNA sequence of Lactobacillus casei TGA;

[0034] Figure 3 is the growth curve of Lactobacillus casei TGA;

[0035] Figure 4 is the optimum growth temperature of Lactobacillus casei TGA;

[0036] Figure 5 GC-MS heat map and cluster analysis of fermented milk containing Lactobacillus casei TGA;

[0037] Figure 6 Radar chart of sensory evaluation of fermented milk containing Lactobacillus casei TGA;

[0038] Figure 7 Radar graph of the electronic nose response to fermented milk containing Lactobacillus casei TGA. DETAILED DESCRIPTION

[0039] In order to make the present invention more clearly understood, preferred embodiments are described in detail below.

[0040] The Lactobacillus casei TGA used in each embodiment of the present invention has a biological name: Lactobacillus casei, a classification name: Lactobacillus casei, and was deposited in the China Center for Type Culture Collection (CCTCC) on October 30, 2024, with a preservation address: Wuhan University, Wuhan, China, Postal Code: 430072, and a preservation number of CCTCC NO: M 20242379.

[0041] Example 1

[0042] The steps of collecting and isolating a strain of Lactobacillus casei that produces high acetaldehyde are as follows:

[0043] (1) Sample collection and sample pretreatment

[0044] Take samples from fermented foods, including sour rice porridge, kimchi, milk lumps, and rice wine mash. Put the collected samples in an ice box for refrigeration. Then take 5 mL of liquid sample or 5 g of solid sample and put it into a 200 mL conical flask filled with 45 mL of sterile water. After shaking, let it stand for 20 minutes for use.

[0045] (2) Isolation of lactic acid bacteria strains

[0046] The pretreated samples were serially diluted with sterile water at a volume ratio of 1:10. 0.1 mL of the diluted samples were taken at each dilution and spread on MRS agar plates. The plates were cultured at 37°C under anaerobic conditions for 24-48 hours. A single colony with a round, medium-sized, raised, slightly white, moist, neat edges and a diameter of 3 mm ± 1 mm was picked with a sterile toothpick.

[0047] Then, the strain was streaked on an MRS agar plate to obtain a pure single colony, i.e., a purified strain, and subjected to Gram staining;

[0048] The purified strains were stored in the corresponding isolation medium, supplemented with 30% glycerol as a protective agent, and frozen at -20°C;

[0049] The MRS agar medium used in the above-mentioned MRS agar plate is a lactic acid bacteria selective medium, which was purchased from Beijing Luqiao Company.

[0050] The 16 strains isolated from the fermentation samples showed stringy, viscous and mucous forms on MRS agar medium.

[0051] (3) Determination of acetaldehyde production capacity of different strains

[0052] The lactic acid bacteria selected on the MRS agar medium were cultured in MRS liquid medium at 37°C for 12 hours, and then activated for the second time at an inoculum volume of 2% (v / v). The bacterial solution after activation for 12 hours was centrifuged at 4°C and 6000r / min for 10 minutes to obtain the bacterial bodies. After rinsing with physiological saline for 3 times, physiological saline was added and mixed for use.

[0053] The whole milk powder was used to prepare a reconstituted milk with a mass ratio of 12%, and the milk was sterilized at 85°C for 15 min or 95°C for 5 min. The bacterial suspension was added at a rate of 4% (v / v), and the commercial starter YF-L904 was added to the sterilized reconstituted milk at a rate of 4% (v / v). After mixing, the milk was fermented at 37°C until the pH was 4.6, then cooled to room temperature, and then stored in a refrigerator at 4°C.

[0054] Weigh 5.00 g of the fermented milk after refrigeration for 12 hours and place it in a 20 mL headspace solid phase microextraction vial. Place the headspace vial in a constant temperature water bath at 55°C and insert the aged extraction head (50 / 30 μm DVB / CAR / PDMS). Perform headspace adsorption for 40 minutes. After the extraction is completed, place the extraction head in GC-MS analysis for 5 minutes to complete the injection.

[0055] The program conditions of GC-MS are: HP-INNOWAX column (60m×0.25mm×0.25mm); injection port temperature: 230℃; temperature program: 40℃ constant temperature for 3min, then 120℃ at 4℃ / min, and finally 230℃ at 5℃ / min, and keep for 10min; carrier gas: He; flow rate: 1mL / min; injection mode: splitless injection. Mass spectrometry conditions: ion source temperature: 230℃; ion source: EI; electron energy: 70eV; scanning range: 30-300amu; full ion scanning mode. Acetaldehyde was quantitatively analyzed using the external standard method. The experimental results are listed in Table 1. Figure 1 From the chart, we can see that the acetaldehyde content in the milk fermented by the strain A8 isolated from kimchi is relatively high, and higher than that in the milk fermented by the commercial starter. This strain was selected and named aldehyde-flavored TGA.

[0056] The aldehyde-flavored TGA strains obtained in the initial screening were further identified by molecular biology and bioinformatics methods, including PCR amplification of genomic DNA and 16S rRNA sequence detection.

[0057] Table 1 Preliminary isolation of acetaldehyde-producing lactic acid bacteria

[0058]

[0059]

[0060] Example 2

[0061] The aldehyde-aroma TGA strain obtained in Example 1 was subjected to microbiological identification.

[0062] (1) Colony characteristics

[0063] The strain was streaked and separated on an MRS plate and cultured anaerobically at 37°C for 48 hours. The strain grew well and its colonies were round, raised, with neat edges, milky white, opaque, moist and smooth surfaces, and could be drawn into threads.

[0064] (2) Morphological characteristics of bacteria

[0065] Gram staining was used to observe the TGA strain. The results showed that the bacteria were non-motile rods, mostly arranged in chains of varying lengths, and also individually dispersed. They did not produce spores and were Gram-positive.

[0066] (3) Genetic identification of high-acetaldehyde TGA strains

[0067] The TGA strains obtained from the initial screening were further identified by molecular biological methods, including PCR amplification of genomic DNA and 16S rRNA sequence detection. After the DNA of the TGA strains was amplified by PCR, the amplified products were subjected to agarose gel electrophoresis, and the amplified bands were observed under a gel imager. The TGA strain band was clear, about 1500 bp.

[0068] A single colony of the purified TGA strain was picked and inoculated into 10 mL of MRS liquid medium. After culturing at 37°C for 12 h, the bacterial solution was centrifuged (4000 r / min, 15 min) to collect the bacteria. The bacterial DNA obtained above was extracted using a genomic DNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). Two synthetic universal primers (16s 27F: GAGAGTTGATCCTGGCTCAG; 16s 1492R: CGGCTACCTTGTTACGACTT) were used for PCR amplification. The PCR product was recovered using a column PCR product purification kit (Sangon Biotech (Shanghai) Co., Ltd.) and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing after purification.

[0069] The 16S rRNA nucleotide sequence of the obtained strain is shown in SEQ ID NO.1, specifically:

[0070]

[0071] The obtained nucleotide sequences were compared with the GenBank sequences using the National Center for Biotechnology Information (NCBI) database and analyzed by BLAST and combined with the phylogenetic tree ( Figure 2 ), the TGA strain that was preliminarily identified as having good aldehyde aroma production ability was identified as Lactobacillus casei.

[0072] Example 3

[0073] Analysis of the Growth Characteristics of Lactobacillus casei with High Acetaldehyde Production by TGA

[0074] (1) Growth curve of Lactobacillus casei with high acetaldehyde production by TGA

[0075] The high-acetaldehyde-producing Lactobacillus casei TGA was inoculated into MRS broth medium and cultured at 37°C. The OD of the culture medium was measured every 2 hours. 600nm , with OD 600nm The growth curve of Lactobacillus casei TGA in MRS was obtained by plotting the value against time. Figure 3 ) showed that Lactobacillus casei TGA grew rapidly in MRS medium, entering the logarithmic phase in about 4 h and the stable phase in about 12 h.

[0076] (2) Optimal culture temperature of Lactobacillus casei TGA with high acetaldehyde production

[0077] Lactobacillus casei TGA was inoculated with 2% (v / v) in 10 mL MRS liquid culture medium and cultured at 25°C, 30°C, 37°C, 42°C and 45°C for 12 h. Uninoculated MRS liquid culture medium was used as a control to measure the OD of the culture medium cultured at different temperatures. 600nm , according to OD 600nm Determine the optimal growth temperature. The results show that ( Figure 4 ), Lactobacillus casei TGA can grow at 25-45℃, and the optimal growth temperature is 37℃.

[0078] Example 4

[0079] The preparation of TGA fermented milk containing Lactobacillus casei with high acetaldehyde production specifically comprises the following steps:

[0080] The high-acetaldehyde-producing Lactobacillus casei TGA plate was streaked with a single colony, inoculated into MRS liquid medium for activation for two generations, centrifuged at 7000r / min for 5min at 4°C, washed twice with saline, and then resuspended in saline for standby use. Whole milk powder was used as the raw material, dissolved in 50°C water and stirred to obtain a reconstituted milk with a mass fraction of 12%, and sucrose with a mass ratio of 7% was added, and sterilized at 85°C for 15min. After cooling to 30°C, the starter containing the high-acetaldehyde-producing Lactobacillus casei TGA strain (initial concentration>10 9 CFU / mL) was added at a volume ratio of 4%, mixed and fermented at 37°C until the pH was 4.6. After stirring and breaking the emulsion, the milk was stored at 4°C for 12 hours to obtain the fermented milk of Lactobacillus casei TGA with high acetaldehyde production.

[0081] Comparative Example 1

[0082] A preparation method of Lactobacillus casei TGA fermented milk without high acetaldehyde production specifically comprises the following steps:

[0083] The steps are the same as those in Example 4, except that the commercial starter YF-L904 is directly added to the sterilized whole-fat reconstituted milk at an addition amount of 4% (v / v), and fermented at 37° C. to pH = 4.6, thereby obtaining fermented milk without high-acetaldehyde-producing Lactobacillus casei TGA.

[0084] Effect Example 1

[0085] Comparison of the ability to produce flavor compounds between fermented milk containing high-acetaldehyde-producing Lactobacillus casei TGA and fermented milk without high-acetaldehyde-producing Lactobacillus casei TGA.

[0086] The flavor compounds of fermented milk were enriched and extracted by headspace solid phase microextraction (HS-SPME). 5.0g of fermented milk samples of Lactobacillus casei TGA with high acetaldehyde production and Lactobacillus casei TGA without high acetaldehyde production were accurately weighed, placed in extraction bottles, balanced in a constant temperature water bath at 55℃ for 5min, and extracted at 55℃ for 40min through a DVB / CAR / PDMS three-in-one extraction head. The chromatographic column used was HP-INNOWAX (60m×0.25mm×0.25μm); injection port temperature: 250℃; program temperature rise: 40℃ for 3min, raised to 140℃ at a rate of 5℃ / min, maintained for 2min, raised to 240℃ at 3℃ / min, maintained for 15min; carrier gas: helium (purity of 99.99%); flow rate: 2mL / min; injection mode: splitless injection. Mass spectrometry conditions: electron bombardment energy: 70eV; ion source temperature: 230℃; quadrupole temperature: 150℃; emission current: 35μA; scanning speed: 1.9scans / s; mass scanning range: 30-450amu. The qualitative analysis of all volatile compounds was performed using the NIST17 mass spectrum library, and the compounds were determined based on the matching degree, ion fragments and other information. The retention index (RI) of C7-C30 normal alkanes was then calculated and compared with the values ​​reported in the literature. The combination of the two was used to accurately analyze the cheese lactone compounds.

[0087] The results are as follows Figure 5 As shown in the figure, GC-MS identified 18 flavor compounds from fermented milk samples containing high-acetaldehyde-producing Lactobacillus casei TGA and fermented milk samples without high-acetaldehyde-producing Lactobacillus casei TGA, including 7 ketone compounds, 1 alcohol compound, 4 acid compounds, 2 heterocyclic compounds, and 4 aldehyde compounds. Cluster analysis showed that the addition of high-acetaldehyde-producing Lactobacillus casei TGA enriched the flavor spectrum of fermented milk.

[0088] Effect Example 2

[0089] The sensory analysis experiment evaluated the aroma intensity of fermented milk containing high-acetaldehyde-producing Lactobacillus casei TGA and fermented milk without high-acetaldehyde-producing Lactobacillus casei TGA.

[0090] The sensory evaluation was conducted by 10 evaluators, who were trained before the evaluation so that the evaluators understood the sensory characteristics and were familiar with the evaluation criteria for fermented milk. Samples with random codes (samples in Example 4 and Comparative Example 1) were taken out of the refrigerator and randomly presented to the evaluators for sensory evaluation tests. The sensory evaluators scored each fermented milk sample according to the attributes and definitions on the evaluation form. In particular, in the sensory evaluation of fermented milk aroma, each aroma attribute was divided into an intensity level of 0-10 points (intensity description: 0 = no intensity or no aroma is perceived, 5 = medium intensity, 10 = very strong). Each fermented milk sample was tested three times.

[0091] Table 2 Basic sensory terms for descriptive analysis of fermented milk

[0092]

[0093] Combined with the sensory analysis results ( Figure 6 ), the fermented milk containing Lactobacillus casei TGA with high acetaldehyde production has higher fruity and creamy aroma than the fermented milk of commercial starter YF-L904, which is consistent with the high acetaldehyde production capacity of Lactobacillus casei TGA in Effect Example 1. Acetaldehyde has a fruity and fragrant aroma, both of which can significantly improve the overall flavor characteristics of fermented milk and bring better sensory experience to consumers, and this conclusion can also be drawn from the sensory evaluation radar chart.

[0094] Effect Example 3

[0095] The electronic nose performed differential analysis of the olfactory fingerprint information of fermented milk containing high-acetaldehyde-producing Lactobacillus casei TGA and fermented milk without high-acetaldehyde-producing Lactobacillus casei TGA.

[0096] The fermented milk prepared in Example 4 and Comparative Example 1 was measured using the PEN3 electronic nose: 5 g of fermented milk was measured in a sample bottle, and the sample was inserted into the sample bottle after standing for 5 min at 50 ° C. The electronic nose analysis was performed using the headspace aspiration method. The electronic nose measurement parameters were: cleaning time 120 s, zeroing time 5 s, pre-injection time 5 s, measurement time 60 s, and carrier gas flow rate 300 mL / min. The differences in olfactory fingerprint information of different Lactobacillus casei were analyzed by odor radar images.

[0097] Radar chart of sensor response values ​​of the electronic nose ( Figure 7) found that the response values ​​of W1C, W2S, W5S, and W1W sensors to fermented milk containing high-acetaldehyde-producing Lactobacillus casei TGA were higher than those to fermented milk without high-acetaldehyde-producing Lactobacillus casei TGA. Among them, W1C is sensitive to aromatic compounds, W2S is sensitive to aldehyde compounds, and W5S and W1W are sensitive to nitrogen oxides and terpenes, respectively. After adding high-acetaldehyde-producing Lactobacillus casei TGA, the sensor response values ​​related to the aldehyde flavor of fermented milk are all increased, indicating that high-acetaldehyde-producing Lactobacillus casei TGA makes the fermented milk have a stronger aldehyde flavor.

[0098] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A strain of Lacticaseibacillus casei TGA with high acetaldehyde production, which can increase the acetaldehyde content in fermented milk, is deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO: M 20242379, a deposit date of October 30, 2024, and a deposit address of Wuhan University, Wuhan, China.

2. A 16S rRNA of a strain of Lactobacillus casei TGA that produces high acetaldehyde, characterized in that: The deposit number of the Lactobacillus casei TGA is CCTCC NO: M 20242379, and its nucleotide sequence is shown in SEQ ID NO.

1.

3. A starter culture containing the high-acetaldehyde-producing Lactobacillus casei TGA of claim 1.

4. The method for preparing the leavening agent according to claim 3, characterized in that: The following steps are involved: Step 1): streak the high-acetaldehyde-producing Lactobacillus casei TGA strain on a culture medium plate, and culture it in a 37° C. incubator for 24-48 hours until a single colony grows; Step 2): Pick the single colony and culture it in liquid culture using MRS broth to a concentration of 1×10 9 CFU / mL, the culture conditions are 37°C, 14-16h; the obtained culture fluid is washed twice with physiological saline, and finally suspended in physiological saline.

5. The preparation method according to claim 4, characterized in that: The culture medium in step 1) is MRS agar culture medium.

6. The preparation method according to claim 4, characterized in that: The mass concentration of the physiological saline in step 2) is 0.85%, and the washing method is: controlling the rotation speed to 6000-8000 r / min and centrifuging for 5-10 minutes.

7. Use of the high acetaldehyde-producing Lactobacillus casei TGA according to claim 1 or the starter according to claim 3 in the preparation of fermented dairy products.

8. The use according to claim 7, characterized in that: The preparation method of the fermented dairy product is as follows: whole milk powder is used as a raw material, dissolved in 50-55° C. water and stirred to obtain reconstituted milk with a mass fraction of 10-12%, and sucrose with a mass ratio of 6-8% is added, and sterilized at 90-95° C. for 5-10 minutes; After cooling to 30-40° C., adding the high-acetaldehyde-producing Lactobacillus casei TGA of claim 1 or the starter of claim 3, mixing well and fermenting at 37° C. until the pH reaches 4.6; After stirring and breaking the emulsion, the mixture was stored at 4°C for 12 hours to obtain a fermented dairy product based on Lactobacillus casei TGA with high acetaldehyde production.

9. The use according to claim 8, characterized in that: The concentration of the high-acetaldehyde-producing Lactobacillus casei TGA of claim 1 or the Lactobacillus casei TGA in the starter culture of claim 3 is 10 9 CFU / mL and above.

10. A fermented dairy product obtained by fermenting with the Lactobacillus casei TGA according to claim 1 or the starter according to claim 3.

Images