Application of substance for inhibiting expression quantity and / or activity of Yp1842 protein in reducing virulence of yersinia pestis
By inhibiting the expression and/or activity of Yp_1842 protein, recombinant Yersinia plague was solved, and the problem that the existing technology was difficult to reduce Yersinia plague was achieved, which significantly reduced Yersinia plague virility was achieved. .
Patent Information
- Application Number
- CN202411538922.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2025-02-11
AI Technical Summary
The prior art is difficult to effectively reduce the virulence of Yersinia plague, especially during the temperature conversion process, which makes the occurrence and spread of plague difficult to control.
By inhibiting the expression amount and/or activity of the Yp_1842 protein, recombinant Yersinia plague was constructed and its virulence was reduced by RNA interference, homologous recombination, gene knockout and other methods.
It significantly reduces the virulence of Yersinia plague and reduces the pathogenic ability to the host, thereby effectively preventing and controlling the occurrence of plague.
Smart Images
Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of a substance that inhibits the expression amount and / or activity of a Yp_1842 protein in reducing the virulence of Yersinia pestis. Background Art
[0002] Plague is a Class A infectious disease in China, and its pathogen is Yersinia pestis ( Yersinia pestis ). Plague is a natural epidemic disease. Yersinia pestis is mainly transmitted to host rodents by arthropod fleas through bites, and may be transmitted to humans, causing bubonic plague, pneumonic plague and sepsis, causing huge losses of life and property to humans. The World Health Organization has listed plague as a re-emerging infectious disease, so it must be given great attention.
[0003] Yersinia pestis is a Gram-negative short rod-shaped bacillus that is transmitted by fleas. Fleas are considered to be room-temperature animals with a body temperature of 26°C. After biting animals or humans, they enter a 37°C environment. Therefore, Yersinia pestis has a set of mechanisms to cope with the stimulation of this temperature change. It is important for Yersinia pestis to secrete virulence proteins to cope with temperature changes and exert pathogenicity. Summary of the invention
[0004] The purpose of the present invention is to reduce the virulence of Yersinia pestis.
[0005] The present invention firstly protects the application of Yp_1842 protein in regulating the virulence of Yersinia pestis and / or preventing plague.
[0006] In the above application, the Yp_1842 protein can be as follows: a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 2; a3) A protein associated with the virulence of Yersinia pestis obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in a1) or a2).
[0007] In a2), the tag may be a Poly-Arg tag (RRRRR), a FLAG tag (DYKDDDDK), a Strep-tag tag (WSHPQFEK) or a c-myc tag (EQKLISEEDL).
[0008] In a3), the substitution and / or deletion and / or addition of one or several amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0009] The Yp_1842 protein in a3) can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.
[0010] The Yp_1842 protein in a3) can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO:1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of any of the above-mentioned tags to its 5′ end and / or 3′ end.
[0011] Among them, SEQ ID NO: 2 consists of 310 amino acid residues.
[0012] In the above application, the Yersinia pestis may be Yersinia pestis 201 strain.
[0013] The present invention also protects the use of nucleic acid molecules encoding any of the above-mentioned Yp_1842 proteins in regulating the virulence of Yersinia pestis and / or preventing plague.
[0014] The nucleic acid molecule encoding any of the above Yp_1842 proteins may be a DNA molecule as shown in b1) or b2) or b3) or b4) below: b1) the coding region is the DNA molecule shown in SEQ ID NO: 1; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1; b3) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in b1) or b2), is derived from Yersinia pestis and encodes the Yp_1842 protein; b4) a DNA molecule that hybridizes under stringent conditions with the nucleotide sequence defined in b1) or b2), is derived from Yersinia pestis and encodes the Yp_1842 protein.
[0015] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.
[0016] Wherein, SEQ ID NO: 1 consists of 933 nucleotides, and the DNA molecule shown in SEQ ID NO: 1 encodes the amino acid sequence shown in SEQ ID NO: 2.
[0017] Those skilled in the art can easily mutate the nucleotide sequence encoding the Yp_1842 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the Yp_1842 protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the Yp_1842 protein.
[0018] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the Yp_1842 protein of the present invention that encodes the amino acid sequence shown in SEQ ID NO:1. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0019] In any of the above applications, the Yersinia pestis may be Yersinia pestis 201 strain.
[0020] The present invention also protects a recombinant Yersinia pestis A, and the preparation method thereof is as follows: inhibiting the expression level and / or activity of any of the above-mentioned Yp_1842 proteins in Yersinia pestis, and the obtained recombinant bacteria is the recombinant Yersinia pestis A; compared with Yersinia pestis, the virulence of the recombinant Yersinia pestis A is reduced.
[0021] In the above-mentioned preparation method, the "inhibiting the expression level and / or activity of any of the above-mentioned Yp_1842 proteins in Yersinia pestis" can be achieved by RNA interference, homologous recombination, gene knockout, gene site-directed editing and other methods well known in the art to achieve the purpose of inhibiting the expression level and / or activity of any of the above-mentioned Yp_1842 proteins.
[0022] In the above preparation method, the inhibition of the expression level and / or activity of any of the above Yp_1842 proteins in Yersinia pestis is achieved by introducing a substance that inhibits the expression level and / or activity of any of the above Yp_1842 proteins into Yersinia pestis.
[0023] In any of the above methods, the "substance that inhibits the expression and / or activity of the Yp_1842 protein" can be specifically a PCR amplification product obtained by PCR amplification using a plasmid containing a DNA fragment with a nucleotide sequence such as SEQ ID NO: 3 as a template and a primer pair consisting of primers pDS-1842del-F and primers pDS-1842del-R in Table 1 of the embodiment. The PCR amplification product is a mutant gene with homology arms.
[0024] In any of the above methods, the Yersinia pestis may be Yersinia pestis 201 strain. In one embodiment of the present invention, when the Yersinia pestis is Yersinia pestis 201 strain, the recombinant Yersinia pestis A is specifically Yersinia pestis △yp_1842 .
[0025] The present invention also protects any of the above-mentioned substances that inhibit the expression level and / or activity of the Yp_1842 protein.
[0026] The present invention also protects the use of any of the above-mentioned substances for inhibiting the expression level and / or activity of the Yp_1842 protein in regulating the virulence of Yersinia pestis and / or preventing plague.
[0027] In the above application, the Yersinia pestis may be Yersinia pestis 201 strain.
[0028] In any of the above methods, the Yersinia pestis may be Yersinia pestis 201 strain. In one embodiment of the present invention, when the Yersinia pestis is Yersinia pestis 201 strain, the recombinant Yersinia pestis A is specifically Yersinia pestis △yp_1842 .
[0029] The present invention also protects any of the above-mentioned substances that inhibit the expression level and / or activity of the Yp_1842 protein.
[0030] The present invention also protects the use of any of the above-mentioned substances for inhibiting the expression level and / or activity of the Yp_1842 protein in regulating the virulence of Yersinia pestis and / or preventing plague.
[0031] In the above application, the Yersinia pestis may be Yersinia pestis 201 strain.
[0032] In any of the above applications, the regulation of the virulence of Yersinia pestis may be reducing the virulence of Yersinia pestis.
[0033] In the present embodiment, 100 CFU of Yersinia pestis was injected subcutaneously into the groin of Bal b / c mice. △yp_1842(equivalent to recombinant Yersinia pestis strain A) or Yersinia pestis strain 201, and then fed normally for 14 days; the survival of the mice was observed during this period. The results showed that compared with Yersinia pestis strain 201, △yp_1842 The virulence of Yp_1842 is significantly reduced. It can be seen that the Yp_1842 protein has an important influence on the virulence of Yersinia pestis. The present invention has great application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 This is the survival curve of the mutant group and the control group mice in the mouse virulence experiment. DETAILED DESCRIPTION
[0035] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0036] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0037] The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0038] Yersinia pestis 201 strain is recorded in the following document: Song Y, Tong Z, Wang J, Wang L, Guo Z, Han Y, Zhang J, Pei D, Zhou D, Qin H et al. Complete genome sequence of Yersiniapestis strain 91001, an isolate avirulent to humans. DNA research: an international journal for rapid publication of reports on genes and genomes 2004, 11(3): 179-197. Hereinafter, Yersinia pestis 201 strain is referred to as Yersinia pestis 201 strain.
[0039] The plasmid extraction kit was a product of Qiagen.
[0040] The primer names and nucleotide sequences involved in the following examples are shown in Table 1.
[0041]
[0042] Note: The single underline is the recognition sequence of the restriction endonuclease Sph I, and the double underline is the recognition sequence of the restriction endonuclease Sac I.
[0043] Example 1. Discovery of Yp_1842 protein The process of Yersinia pestis from the transmission medium to the mammalian host has experienced a change from the environmental temperature of 26℃ to 37℃. Many virulence genes are activated at 37℃ and begin to express in large quantities, which greatly increases the virulence of Yersinia pestis to the host. Studies have shown that by mass spectrometry analysis of the bacterial proteins of Yersinia pestis strain 201 using three different methods, Shotgun-LC-MS-MS, 1D-LC-MS-MS and 2D-MS, a total of 1193 proteins were identified, accounting for 28.7% of the CDS predicted in the genome. The proteomics analysis of Yersinia pestis strain 201 under in vitro flea simulation conditions using the LTQ-FT method identified a total of 1926 proteins, accounting for 46.50% of the CDS predicted in the genome. The inventors of the present invention used TMT (Tandem Mass Tag) mass spectrometry to identify the differences in the proteomes of Yersinia pestis under flea-simulated conditions and human-simulated conditions. After redundancy removal, a total of 2,141 proteins were detected, accounting for 52.2% of the predicted CDS of the genome (the highest coverage rate in the reported literature). Afterwards, the Yp_1842 protein, which may be related to the virulence of Yersinia pestis, was screened out through analysis. The specific steps are as follows: 1. Prepare secretory protein sample 1 of Yersinia pestis 201 strain at 26°C (simulating the internal environment of fleas), secretory protein sample 2 of Yersinia pestis 201 strain at 37°C (simulating the internal environment of mice), protein sample 3 of Yersinia pestis 201 strain at 26°C (i.e., bacterial protein sample 3) and protein sample 4 of Yersinia pestis 201 strain at 37°C (i.e., bacterial protein sample 4).
[0044] 2. After completing step 1, the tandem mass tags (TMT) method was used to quantitatively analyze secreted protein sample 1, secreted protein sample 2, bacterial protein sample 3 and bacterial protein sample 4, respectively, thereby establishing a protein analysis platform for Yersinia pestis strain 201.
[0045] 3. After completing step 2, the protein analysis platform of Yersinia pestis strain 201 was analyzed, and the Yp_1842 protein was screened out from the secreted proteins with significantly upregulated expression in secreted protein sample 2, combining the protein expression level and omics analysis results.
[0046] The amino acid sequence of Yp_1842 protein is shown in SEQ ID NO: 2. The gene encoding Yp_1842 protein (hereinafter referred to as yp_1842The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0047] Embodiment 2, yp_1842 Gene knockout strains (i.e., Yersinia pestis △yp_1842 ) Constructing gene mutants is one of the most important methods for studying gene function. The inventors of the present invention knocked out the yp_1842 Genes to obtain plague bacteria △yp_1842 The specific steps are as follows: 1. Recombinant plasmid pDS132- 1842del Construction (1) The DNA fragment with the nucleotide sequence shown in SEQ ID NO: 3 and the pUC19 plasmid are connected to obtain an intermediate vector.
[0048] SEQ ID NO: 3 is: gatactgaagccgcacaggacgcttttatccttatcgctcactccgagcccaaaggttggttgtcatgggtctatgacaagaactcactcgaacctattg aatctatttgtaccagcctccaagcgtcaaggatacagatgtacgtgagaatgctcggtgccatgaacgcgactcaagctgtgcctgttttggaaaaact ggcaaagtctacatatgcaaactttgttcgttgggaagcggtcgaaagcctctcacttattgatcctcaatctactctagagttactcgactatttggtg aagaatgactctgacgctcaaataattgaggccgcagaacagagccttgcaataaataaagcagaagagtcagaggtgtaaatattatggctgtcaaagtg gacgggagaaactagcaatgctcctaaataatattacgccagtgaataaatcactgacactacaagatttattaggaattttgagtcactcatcggcaat ttccaatgtggcaaatgggatttatgtggaaagcgaaatccttgaagtaggttcatggctttcagcctacgcggctaataaagatgaaattttttcgcag atcattaccgagttggagaacccttatcaattccagctggagaatgacatacaggcaccgagttttattctttacagtaatgaacgcataactattcgtcttgttatgtggctcccattgcagggaaaattagatcggacaccttattcctacgaagaagcacatgatcataattttgacttttggacagtgaattttttt ggaggtgg (2) Using the intermediate vector obtained in step (1) as a template, PCR amplification was performed using a primer pair consisting of primer pDS-1842del-F and primer pDS-1842del-R, and a PCR amplification product of about 840 bp was recovered.
[0049] (3) Plasmid pDS132 was double-digested with restriction endonucleases Sph I and Sac I (products of NEB, catalog numbers R0182S and R3156S, respectively) to recover a vector backbone of approximately 5286 bp.
[0050] (4) The PCR amplification product recovered in step (2) and the vector backbone recovered in step (3) were recombined using a BM seamless cloning kit (product of Biomed, catalog number BM220220716) to obtain a recombinant plasmid pDS132- 1842del .
[0051] The recombinant plasmid pDS132- 1842del The sequencing results showed that the recombinant plasmid pDS132- 1842del The recombinant plasmid is obtained by replacing the small DNA fragment between the restriction endonucleases Sph I and Sac I of the plasmid pDS132 with the DNA fragment shown in SEQ ID NO: 3.
[0052] 2. Obtaining recombinant Escherichia coli S17-1842del The RP4-2 plasmid is integrated into the chromosome of the Escherichia coli S17-1 λpir strain, and this plasmid can carry part of the chromosomal DNA and be transferred between conjugating strains.
[0053] (1) Recombinant plasmid pDS132- 1842del The gene was transformed into competent cells of Escherichia coli S17-1 λpir strain to obtain several transformants.
[0054] (2) After completing step (1), each transformant was inoculated onto a LB solid plate (chloramphenicol resistance) and cultured in a constant temperature incubator at 37°C for 1 day (for bacterial growth).
[0055] (3) After completing step (2), PCR amplification is performed using the colonies of the transformants as templates and a primer pair consisting of primer pDS132-F and primer pDS132-R to obtain PCR amplification products, which are then judged as follows: If the PCR amplification product contains a 1200 bp DNA fragment, the corresponding transformant is a positive transformant.
[0056] Positive transformants contain recombinant plasmid pDS132- 1842del The recombinant Escherichia coli S17-1 λpir strain was named as recombinant Escherichia coli S17-1842del.
[0057] The recombinant Escherichia coli S17-1842del was stored in glycerol stock at -20°C.
[0058] 3. Conjugation transfer of recombinant Escherichia coli S17-1842del (donor bacteria) and Yersinia pestis 201 strain (recipient bacteria) (1) Inoculate a single clone of Y. pestis strain 201 into 1 ml of fresh LB liquid medium and culture at 26°C with shaking overnight to obtain 201 strain culture solution 1; then inoculate 300 μL of 201 strain culture solution 1 into 5 ml of fresh LB liquid medium and culture at 26°C with shaking until an OD of 0. 620nm The concentration of 201 strain culture solution 2 is 0.8-1.0.
[0059] (2) The recombinant E. coli S17-1842del single clone was inoculated into 1 ml of fresh LB liquid medium and cultured at 37°C overnight to obtain S17-1842del culture solution 1; then 100 μL of S17-1842del culture solution 1 was inoculated into 5 ml of fresh LB liquid medium and cultured at 37°C with shaking until an OD of 0. 600nm The S17-1842del culture solution 2 is 0.4-0.8.
[0060] (3) After completing steps (1) and (2), take 1 mL of S17-1842del culture medium 2, centrifuge, and collect the precipitate; resuspend the precipitate in 1 ml of LB liquid medium to obtain a resuspension; then add 100 μL of 201 strain culture medium 2 to the resuspension, gently mix, centrifuge at 4500 rpm for 5 min, and collect the bacteria; resuspend the bacteria in 50 μL of LB liquid medium, and then transfer to LB solid medium covered with sterile filter paper and culture overnight at 26°C.
[0061] (4) After completing step (3), wash the bacteria on the filter paper with 1 ml of fresh LB liquid medium, then perform a 10-fold gradient dilution with LB liquid medium, and finally spread it on a Cm-resistant YSAB plate and culture it at 26°C for 3-4 days to obtain several conjugates.
[0062] The preparation method of Cm-resistant YSAB plates is as follows: dissolve 59.5 g of Yersinia selective agar base powder (product of BD, product catalog number 5152716) in an appropriate amount of deionized water, then dilute to 1 L with deionized water, sterilize by high pressure for 15 minutes, cool to 50°C, pour onto the plate, and use after solidification.
[0063] (5) After completing step (4), inoculate each conjugate into LB liquid culture medium and culture it in a constant temperature incubator at 26°C overnight (for the purpose of bacterial growth).
[0064] (6) The bacterial solution obtained in step (5) was graded diluted with LB liquid medium, then spread on a Hessler plate containing 7% sucrose and cultured at 26°C until a single colony grew.
[0065] The preparation method of Hessler plate is as follows: dissolve 33.2g of hemolytic (0.1%) Hessler agar (product of Haibo Biotechnology Co., Ltd., product catalog number HB6243-1) in an appropriate amount of deionized water, then dilute to 1L with deionized water, sterilize by high pressure for 15 minutes, cool to 50℃, pour onto the plate, and use after solidification.
[0066] (7) The single clone obtained in step (6) was inoculated into a Hessler plate and cultured at 26°C for 1 day (for bacterial proliferation).
[0067] (8) After completing step (7), PCR amplification is performed using the colonies of the single clones as templates and a primer pair consisting of primer pDS-1842del-F and primer pDS-1842del-R to obtain PCR amplification products, which are then judged as follows: if the PCR amplification product contains a DNA fragment of 840 bp and the partial nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 3, the corresponding single clone is a positive conjugate.
[0068] Pick the positive conjugates (i.e., pestis) on the plate △yp_1842 ), glycerol seed preservation, stored at -80℃.
[0069] The above construction of Y. pestis △yp_1842 The method is based on the λ-Red recombination system of Escherichia coli, which can yp_ 1842 The gene undergoes homologous recombination with the mutant gene with homologous arms and is replaced by the mutant gene, thus yp_1842 Gene function failure. This method will cause two recombination events: the first recombination is the ingestion of recombinant E. coli S17-1842del by Y. pestis 201 strain, which will enable it to grow on Cm-resistant YSAB plates; then the second recombination will occur when growing in the absence of antibiotics. The suicide plasmid pDS132 cannot replicate in Y. pestis and can only be integrated into the genome or lost; the role of the Hessler plate containing 7% sucrose is that the plasmid pDS132 carries sacB Gene, sucrose can kill plague bacteria, so only two clones were screened out, one was plague bacteria that lost the plasmid pDS132, and the other was a mutant strain of plague bacteria that retained the mutant gene. Finally, PCR amplification and sequencing were performed to screen and obtain yp_1842 Genetically inactivated plague bacteria △yp_1842 .
[0070] Immunoblotting was used to detect the test bacteria (Yersinia pestis 201 strain or Yersinia pestis △yp_1842 The results showed that Yp_1842 protein was expressed in both the supernatant and the precipitate of Y. pestis strain 201. △yp_1842 There was no expression in the bacterial supernatant or bacterial precipitate.
[0071] Example 3, toxicity experiment in mice Twenty Bal b / c mice were randomly divided into two groups (10 mice in each group): mutant group and control group. The following treatments were performed: Mutation group: On the first day of the experiment, each mouse was subcutaneously injected with 100 CFU of Yersinia pestis in the groin △yp_1842 ; Then feed normally for 14 days; During this period, observe the survival of mice; Control group: On the first day of the experiment, each mouse was subcutaneously injected with 100 CFU of Yersinia pestis 201 in the groin; then the mice were fed normally for 14 days; during this period, the survival of the mice was observed.
[0072] The results showed that mice in the control group began to die on the 4th day and all died on the 6th day; mice in the mutant group began to die on the 9th day and 6 mice were still alive on the 14th day. △yp_1842 The toxicity was significantly reduced.
[0073] The survival curves of the two groups of mice were drawn using GraphPadPrism software (URL: https: / / www.graphpad.com / scientific-software / prism / ). The results are shown in Figure 1 .
[0074] The chi-square test method Logrank and Gehan-Breslow-Wilcoxon provided by GraphPadPrism software were used to analyze whether the difference between the control group and the mutant group was statistically significant. The statistical results of the difference between the control group and the mutant group are shown in Table 2. The results showed that the statistical results of the difference between the control group and the mutant group were statistically significant. p The value was <0.0001, indicating a significant statistical difference.
[0075]
[0076] The above results indicate that the Yp_1842 protein has an important influence on the virulence of Yersinia pestis.
[0077] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.
Claims
1. Application of Yp_1842 protein in regulating the virulence of Yersinia pestis and / or preventing plague; The Yp_1842 protein is as follows: a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 2; a3) A protein associated with the virulence of Yersinia pestis obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in a1) or a2).
2. The use according to claim 1, characterized in that: The Yersinia pestis is Yersinia pestis 201 strain.
3. Use of a nucleic acid molecule encoding the Yp_1842 protein of claim 1 in regulating the virulence of Yersinia pestis and / or preventing plague.
4. The use according to claim 3, characterized in that: The nucleic acid molecule encoding the Yp_1842 protein in claim 1 is a DNA molecule as shown in b1) or b2) or b3) or b4) below: b1) the coding region is the DNA molecule shown in SEQ ID NO: 1; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1; b3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or b2), derived from Yersinia pestis and encoding the Yp_1842 protein of claim 1; b4) A DNA molecule that hybridizes with the nucleotide sequence defined in b1) or b2) under stringent conditions, is derived from Yersinia pestis and encodes the Yp_1842 protein as claimed in claim 1.
5. The use according to claim 3 or 4, characterized in that: The Yersinia pestis is Yersinia pestis 201 strain.
6. A recombinant Yersinia pestis A, the preparation method of which is as follows: inhibiting the expression level and / or activity of the Yp_1842 protein described in claim 1 in Yersinia pestis, and the resulting recombinant bacteria is recombinant Yersinia pestis A; compared with Yersinia pestis, the virulence of the recombinant Yersinia pestis A is reduced.
7. The recombinant Yersinia pestis A according to claim 6, characterized in that: The inhibition of the expression level and / or activity of the Yp_1842 protein in claim 1 in Yersinia pestis is achieved by introducing a substance that inhibits the expression level and / or activity of the Yp_1842 protein in claim 1 into Yersinia pestis.
8. The recombinant Yersinia pestis A according to claim 6 or 7, characterized in that: The Yersinia pestis is Yersinia pestis 201 strain.
9. Use of the substance for inhibiting the expression and / or activity of the Yp_1842 protein as claimed in claim 7 in regulating the virulence of Yersinia pestis and / or preventing plague.
10. The use according to claim 9, characterized in that: The Yersinia pestis is Yersinia pestis 201 strain.