Rapid streptococcus agalactiae detection kit based on RPA (recombinase polymerase amplification) and CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats) and application thereof

Abstract

The invention discloses a rapid streptococcus agalactiae detection kit based on RPA (recombinase polymerase amplification) and CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats) and application of the rapid streptococcus agalactiae detection kit. The rapid streptococcus agalactiae detection kit comprises an amplification primer of a recombinase polymerase amplification technology, CRISPR RNA (ribonucleic acid), an ssDNA (single-stranded deoxyribonucleic acid) probe and Cas12a protein Wherein an upstream primer sequence of an amplification primer of the recombinase polymerase amplification technology is as shown in SEQ ID NO: 1; and the sequence of the downstream primer is as shown in SEQ ID NO: 2. According to the invention, rapid, sensitive, accurate and specific detection of streptococcus agalactiae is realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a rapid detection kit for Streptococcus agalactiae based on RPA and CRISPR-Cas12a and an application thereof. Background Art

[0002] Streptococcus agalactiae, also known as Group B Streptococcus (GBS), can cause mastitis, meningitis and neonatal sepsis in dairy cows, and can also cause streptococcal disease in fish. It is a pathogen with a wide range of host infections. Large-scale outbreaks of Streptococcus agalactiae have occurred in many tilapia farms. Relevant data show that the mortality rate of infected fish exceeds 95%, causing serious economic losses to the tilapia industry. The first step in preventing and controlling Streptococcus agalactiae is to quickly and accurately detect the pathogen.

[0003] At present, the detection technologies of Streptococcus agalactiae mainly include traditional separation and identification methods, immunological detection methods, nucleic acid detection methods, etc. These technologies have the disadvantages of low detection sensitivity, cumbersome operation, and long time consumption. In addition, most technologies need to rely on expensive precision instruments and professional technicians, which greatly limits their scope of application, making it difficult to effectively prevent and treat Streptococcus agalactiae. Therefore, in order to diagnose Streptococcus agalactiae early and prevent the spread and outbreak of Streptococcus agalactiae, it is necessary to develop a rapid and accurate detection method suitable for tilapia farming sites.

[0004] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and its associated proteins (CRISPR-associated, Cas) are an acquired immune system in most bacteria and archaea. The system can protect bacteria from the invasion of viruses and exogenous DNA by sequence-specific recognition and silencing of foreign nucleic acids under the mediation of RNA. Cas12a protein can target and bind double-stranded DNA (Double stranded DNA, dsDNA) under the guidance of CRISPR RNA (crRNA), and produce "incidental cutting" activity to nearby non-target single-stranded DNA (Singlestrand DNA, ssDNA). Based on this "incidental cutting" activity, a fluorescent group and a quenching group are constructed at both ends of ssDNA, and when Cas12a protein specifically binds and shears the target sequence under the mediation of crRNA, ssDNA will be non-specifically cut, so that the fluorescent group is released, and by detecting the fluorescent signal, it can be determined whether the target nucleic acid exists in the sample. Summary of the invention

[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and to briefly introduce some preferred embodiments.

[0006] As one aspect of the present invention, the present invention provides a rapid detection kit for Streptococcus agalactiae based on RPA and CRISPR-Cas12a, which includes nucleic acid amplification primers of recombinase polymerase amplification technology, CRISPR RNA, ssDNA probe and Cas12a protein;

[0007] The upstream primer sequence of the nucleic acid amplification primer of the recombinase polymerase amplification technique is shown in SEQ ID NO: 1; the downstream primer sequence is shown in SEQ ID NO: 2.

[0008] As a preferred embodiment of the RPA and CRISPR-Cas12a-based Streptococcus agalactiae rapid detection kit of the present invention: the CRISPR RNA sequence is shown in SEQ ID NO: 3;

[0009] As a preferred embodiment of the RPA and CRISPR-Cas12a-based Streptococcus agalactiae rapid detection kit described in the present invention: the ssDNA probe sequence is shown in SEQ ID NO: 4.

[0010] The present invention also includes the use of the RPA and CRISPR-Cas12a-based Streptococcus agalactiae rapid detection kit in the preparation of a Streptococcus agalactiae detection reagent, which includes:

[0011] Extracting genomic DNA from the sample to be tested;

[0012] Using the extracted genomic DNA as a template, isothermal amplification is performed using nucleic acid amplification primers of the recombinase polymerase amplification technology to obtain a nucleic acid amplification product;

[0013] The nucleic acid amplification product, CRISPR RNA, ssDNA probe, Cas12a protein and water are added to a reaction tube for reaction; then fluorescence detection is performed.

[0014] The isothermal amplification was performed at 37°C for 30 min. After the reaction, 8 μL of 6×Loading buffer was added to the reaction product and mixed, and the mixture was incubated at 56°C for 5 min.

[0015] Wherein, the reaction is carried out at 37° C. for 30 minutes.

[0016] Wherein, the excitation wavelength of the fluorescence detection is 480nm; the scanning wavelength is 510-650nm.

[0017] Among them, the reaction was carried out, and the reaction system included 5 μL RPA amplification product, 5 μL 50 μM crRNA, 1 μL 10 μM Cas12a protein, 5 μL 50 μM ssDNA, 74 μL DEPC water, and 10 μL reaction buffer.

[0018] Beneficial effects of the present invention: This study combines the CRISPR-Cas12a system with the recombinase polymerase amplification technology (RPA) to construct a method for detecting Streptococcus agalactiae based on the RPA-CRISPR-Cas12a system. The method achieves rapid, sensitive, accurate and specific detection of Streptococcus agalactiae. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solution of the embodiment of the present invention, the following briefly introduces the drawings required for describing the embodiment, wherein:

[0020] Figure 1 This is the selection of RPA primers; in the figure, M: nucleic acid marker; 1: primer neuB-F1 / R1; 2: primer neuB-F2 / R2; 3: primer neuB-F3 / R3.

[0021] Figure 2 The expression and purification of Cas12 protein (A) Western blot verification of Cas12 protein (B) and cleavage activity (C) detection results. Among them, (A) M: protein marker; 1-2: bacteria; 3-5: Cas12 protein purification results; (B) M: protein maker; 1, 3: purified Cas12 protein; 2: negative control.

[0022] Figure 3 This is the crRNA screening result.

[0023] Figure 4 It is the result of ssDNA screening.

[0024] Figure 5 The RPA-CRISPR-Cas12a system was established and optimized. (A) Cas12a protein dosage was optimized; (B) crRNA dosage was optimized; (C) ssDNA reporter gene dosage was optimized.

[0025] Figure 6 This is the RPA-CRISPR-Cas12a sensitivity test result.

[0026] Figure 7 This is the RPA-CRISPR-Cas12a specificity test result. DETAILED DESCRIPTION

[0027] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0028] The present invention provides RPA primers for specific Streptococcus agalactiae target genes, and the nucleotide sequences thereof are as follows:

[0029] Upstream primer F: 5′-TAAATTGAACACTACTACTATACTTGTCTCCTCC-3′ (SEQ ID NO: 1).

[0030] Downstream primer R: 5′-GGTTTTTTGATGCTAGAAAAGAAAAATTACTGCA-3′ (SEQ ID NO: 2).

[0031] The present invention also provides a crRNA for detecting Streptococcus agalactiae, wherein the nucleotide sequence of the crRNA is UAAUUUCUACUCUUGUAGAUAGCUAACUCAGGAAAAACAGUCAAAU (SEQ ID NO: 3).

[0032] The present invention also provides a ssDNA probe for fluorescence detection, the sequence of which is 5′-FAM-TTTTTTTTATTT-BHQ1-3′ (SEQ ID NO: 4).

[0033] The present invention also provides a detection method for Streptococcus agalactiae based on RPA-CRISPR-Cas12a, which mainly comprises the following steps:

[0034] (1) Extracting genomic DNA from the sample to be tested using a DNA extraction kit;

[0035] (2) using the genomic DNA in step (1) as a template, performing an isothermal amplification reaction using the RPA primers to obtain an RPA amplification product;

[0036] The RPA reaction system is composed as follows: the total volume is 50 μL, including 2 μL of upstream primer (concentration 10 μM), 2 μL of downstream primer (concentration 10 μM), 29.4 μL of A Buffer, 2.5 μL of B Buffer, 5 μL of Streptococcus agalactiae genomic DNA, and the rest is supplemented with DEPC water; RPA amplification program: 37°C, 30 min. After the reaction is completed, incubate in a metal bath at 56°C for 5 min. (DNA isothermal rapid amplification kit was purchased from Nanjing Wobo Biotechnology Co., Ltd., item number: WLB8201KIT)

[0037] (3) CRISPR / Cas12a detection: After the reaction in step (2) is completed, take 5 μL of the RPA amplification product in step (2) and add it to the CRISPR / Cas12a reaction system to continue the detection. The CRISPR / Cas12a reaction system includes 5 μL crRNA (50 μM), 1 μL Cas12a protein (10 μM), 5 μL ssDNA (50 μM), 74 μL DEPC water, and 10 μL 10× reaction buffer. Keep the reaction at 37°C for 30 minutes and read the detection signal.

[0038] (4) Detection using an ELISA reader. Detection of fluorescence intensity using an ELISA reader: excitation wavelength 480 nm; scanning wavelength: 510-650 nm.

[0039] (5) Result determination: The cumulative fluorescence value obtained by the fluorescence detector was used as the signal intensity and analyzed and determined according to the following criteria.

[0040] Negative judgment criteria: fluorescence reading is the base value;

[0041] Positive judgment criteria: Detectable fluorescence reading.

[0042] The strains used in the following examples are as follows:

[0043] Table 1 Experimental strains

[0044]

[0045]

[0046] Embodiment 1:

[0047] Bacterial genomic DNA extraction:

[0048] Bacterial genomic DNA was extracted using a bacterial genome extraction kit. DNA concentration was measured using a Nano Drop instrument and stored in a -20°C refrigerator for later use.

[0049] Embodiment 2:

[0050] Primer, CRISPR RNA (crRNA) and single strand DNA (ssDNA) design:

[0051] Primers and crRNA were designed based on the conserved gene neuB (locus_tag=A964_1136) of Streptococcus agalactiae published in the GenBanK database. The sequences and related information are shown in Table 2.

[0052] Table 2 Primer information

[0053]

[0054]

[0055] Primer screening:

[0056] RPA reaction was performed using positive DNA of Streptococcus agalactiae as template. 2 μL of upstream and downstream primers, 29.4 μL of A Buffer, 2.5 μL of B Buffer, 5 μL of template DNA and 9.1 μL of ddH2O. Mix well with a pipette, then transfer the sample to a reaction tube with dry powder and mix it upside down. Finally, place the product in a preheated constant temperature metal bath and react at 37°C for 30 minutes. Add 8 μL of 6× Loading buffer to the reaction product and mix well. Incubate in a metal bath at 56°C for 5 minutes, and take 5 μL of the mixture for agarose gel electrophoresis.

[0057] Results Figure 1 According to the grayscale of the bands in agarose gel electrophoresis, a pair of primers with better effect, neuB-F3 / R3, was screened, and the amplified product can produce a bright band at 159bp.

[0058] Embodiment 3:

[0059] Preparation of Cas12a protein:

[0060] pMBP-LbCas12a plasmid (Cat. No. 113431) was purchased from Addgene, and pET-32a(+) vector was used for prokaryotic expression. 600 When the expression was induced at 0.6, IPTG concentration of 0.5mM and temperature of 16℃, a specific band appeared near 135kD, which was consistent with the expected size of the protein. After the bacteria expressing the recombinant protein were broken by ultrasound, their solubility was detected by SDS-PAGE. The target protein mainly appeared in the supernatant of the broken bacteria ( Figure 2 A). The recombinant protein expressed in the supernatant was purified by His-tag gel affinity column to obtain a relatively pure protein with a single band and consistent size ( Figure 2 A). The recombinant protein was transferred to NC membrane after SDS-PAGE for Western blot analysis. The results are shown in Figure 2 B, showing a positive reaction at the target band. And the cleavage activity can reach the same level as the commercial Cas12a protein ( Figure 2 C). The present invention can also use commercial Cas12a protein.

[0061] Embodiment 4:

[0062] crRNA screening:

[0063] CRISPR / Cas12a reaction system: 5 μL RPA amplification product, 5 μL crRNA (50 μM), 1 μL Cas12a protein (10 μM), 5 μL ssDNA1 (50 μM), 74 μL DEPC water, 10 μL 10× reaction buffer. Reaction at 37°C for 30 min, and read the detection signal.

[0064] like Figure 3 As shown, when the system uses crRNA1, an obvious fluorescence signal can be detected, while the fluorescence signals of crRNA2 and crRNA3 are weak.

[0065] ssDNA screening:

[0066] CRISPR / Cas12a reaction system: 5 μL RPA amplification product, 5 μL crRNA (50 μM), 1 μL Cas12a protein (10 μM), 5 μL ssDNA (50 μM), 74 μL DEPC water, 10 μL 10× reaction buffer. The reaction was kept at 37°C for 30 min, and the detection signal was read.

[0067] like Figure 4 As shown, Figure 4 As shown, when the system uses ssDNA1, an obvious fluorescence signal can be detected, while the fluorescence signals of ssDNA2 and ssDNA3 are weak.

[0068] Embodiment 5:

[0069] Establishment and optimization of the RPA-CRISPR-Cas12a system:

[0070] like Figure 5 As shown, the most suitable amount of Cas12a protein in 100uL reaction system is 0.5pmol ( Figure 5 A), the most suitable amount of crRNA is 0.5 pmol ( Figure 5 B), the most suitable amount of ssDNA reporter gene is 2pmol ( Figure 5 C).

[0071] Embodiment 6:

[0072] RPA-CRISPR-Cas12a sensitivity test:

[0073] After overnight culture of Streptococcus agalactiae, the concentration of the bacterial solution was adjusted to 5×10 8CFU / mL, and 10-fold gradient dilution was performed. 1 mL of culture medium was taken to extract genomic DNA using the kit method. The sensitivity experiment was performed using the optimal RPA-CRISPR / Cas12a system in Example 5. The results showed that the detection limit of the RPA-CRISPR / Cas12a method was 5×10 1 CFU / mL( Figure 6 ). The sensitivity of this method is much higher than that of conventional detection methods such as ELISA, colloidal gold immunochromatography, and PCR.

[0074] Embodiment 7:

[0075] RPA-CRISPR-Cas12a specificity assay:

[0076] In order to evaluate the specificity of RPACRISPR / Cas12a detection, genomic DNA of Streptococcus agalactiae, Aeromonas hydrophila, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, and Escherichia coli were extracted, and specificity experiments were performed according to the optimal RPA-CRISPR-Cas12a system in Example 5. The results showed that only the genomic DNA sample of Streptococcus agalactiae showed a strong fluorescence signal, and the test result was positive. No obvious fluorescence signal appeared in other bacterial DNA samples ( Figure 7 ).

[0077] In summary, the RPA-CRISPR-Cas12a-based rapid detection method for Streptococcus agalactiae established in the present invention has good specificity and sensitivity, and short detection time, and can provide a technical means for the rapid diagnosis of Streptococcus agalactiae.

[0078] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A rapid detection kit for Streptococcus agalactiae based on RPA and CRISPR-Cas12a, characterized in that: Including nucleic acid amplification primers, CRISPR RNA, ssDNA probes and Cas12a protein for recombinase polymerase amplification technology; The upstream primer sequence of the nucleic acid amplification primer of the recombinase polymerase amplification technique is shown as SEQ ID NO: 1; the downstream primer sequence is shown as SEQ ID NO:

2.

2. The rapid detection kit for Streptococcus agalactiae based on RPA and CRISPR-Cas12a according to claim 1, characterized in that: The CRISPR RNA sequence is shown in SEQ ID NO:

3.

3. The rapid detection kit for Streptococcus agalactiae based on RPA and CRISPR-Cas12a according to claim 1, characterized in that: The ssDNA probe sequence is shown in SEQ ID NO:

4.

4. The use of the RPA and CRISPR-Cas12a-based Streptococcus agalactiae rapid detection kit according to claim 1 in the preparation of a Streptococcus agalactiae detection reagent, characterized in that: include, Extracting genomic DNA from the sample to be tested; Using the extracted genomic DNA as a template, isothermal amplification is performed using nucleic acid amplification primers of the recombinase polymerase amplification technology to obtain a nucleic acid amplification product; The nucleic acid amplification product, CRISPR RNA, ssDNA probe, Cas12a protein and water are added to a reaction tube for reaction; then fluorescence detection is performed.

5. The use according to claim 4, characterized in that: The temperature of the isothermal amplification was 37°C; after the reaction was completed, the reaction was incubated at 56°C for 5 minutes.

6. The use according to claim 5, characterized in that: The isothermal amplification time is 30 min.

7. The use according to claim 4, characterized in that: The reaction was carried out at 37°C for 30 min.

8. The use according to claim 4, characterized in that: The excitation wavelength of the fluorescence detection is 480 nm; the scanning wavelength is 510-650 nm.

9. The use according to claim 4, characterized in that: The reaction was carried out, and the reaction system included 5 μL of nucleic acid amplification primers, 5 μL of 50 μM CRISPR RNA, 1 μL of 10 μM Cas12a protein, 5 μL of 50 μM ssDNA, 74 μL of DEPC water, and 10 μL of reaction buffer.

Images