Setaria italica glume color control gene functional marker primer and application thereof

Abstract

The invention relates to a millet glume color control gene functional marker primer and application, and belongs to the technical field of molecular biology, a Kasp marker is developed at an SNP site of a gene CAD2 which causes the millet glume to be mutated from brown to golden yellow, and the marker is Kasp-CAD2 and is located in an interval from 5495505bp to 5497605bp of a No.1 chromosome of millet. The SNP site causes the 90th amino acid of the gene to be changed into valine of Jigu 19 from isoleucine of Yugu 18 so as to cause color change, a primer is designed according to the SNP site, and genetic typing identification is carried out by combining PCR amplification with a fluorescent typing technology. The defects that in the prior art, the flux is low, and identification errors are caused due to the fact that linkage markers are possibly subjected to exchange recombination are overcome, and the glume color identification range is widened.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a primer for marking the function of a millet husk color control gene and an application thereof. Background Art

[0002] Millet is a traditional grain crop in my country. It has become a popular health food among consumers in recent years due to its drought resistance, barrenness tolerance, high photosynthetic efficiency, balanced nutrition, and green and pollution-free. The color of millet husk and seed coat is a signature feature of millet varieties. Not only does the millet product after husking the grain have high nutritional value, but the husk is also rich in flavonoids with antioxidant function, which can be made into excellent feed and can also be extracted into bran oil with outstanding nutritional and health functions. The different colors of husk reflect the differences in the nutrients contained. Therefore, identifying the millet husk color control gene is of great significance to fully explore the utilization value of husk in feed production and health food development.

[0003] Functional markers are derived from mutations within functional genes, including SNPs and INDELs. Such mutations cause changes in the phenotypic traits controlled by the genes. Therefore, Kasp markers are developed based on competitive allele-specific PCR technology based on key SNP sites within functional genes, and combined with fluorescence identification technology to achieve high throughput and high sensitivity. In addition, the development of functional markers using mutation sites within functional genes can overcome the erroneous results caused by exchange recombination when molecular-assisted selection is performed using linked markers near genes, making them more reliable. The development of markers based on mutations within genes has not yet been applied to the development of millet husk color trait markers. Summary of the invention

[0004] Although there are reports on the development of millet husk molecular markers, the identified husk colors are limited to yellow and white, and there are no reports on the development of markers related to other colors such as brown and yellow husks; in addition, the existing technology is based on PCR and gel electrophoresis, and distinguishes genotypes according to electrophoresis band types, which has the disadvantages of low sensitivity and limited detection quantity. The present invention develops Kasp markers based on a SNP site of the gene CAD2 that causes the millet husk to mutate from brown to golden yellow, and combines it with fluorescence typing technology to overcome the shortcomings of low throughput of the existing technology and identification errors due to possible exchange and recombination of linked markers, and broaden the scope of husk color identification.

[0005] In order to achieve the above object, the specific scheme adopted by the present invention is: In a first aspect, the present invention provides primers for functional markers of millet hull color control genes, wherein the marker is Kasp-CAD2, located within the range of 5495505bp to 5497605bp on millet chromosome 1; the primers of Kasp-CAD2 are CAD-5496Fa as shown in SEQ ID NO.1, CAD-5496Fg as shown in SEQ ID NO.2, and CAD-5496R as shown in SEQ ID NO.3.

[0006] In a second aspect, the present invention provides a kit for identifying millet husk color traits, comprising the above-mentioned primers and further comprising a PARMS master mix for PCR amplification, wherein the PARMS master mix contains two detection probes with different fluorescence.

[0007] In a third aspect, the present invention provides the use of the above primers or kits in early identification of millet husk color traits and molecular screening breeding.

[0008] In a fourth aspect, a method for identifying millet husk color traits comprises the following steps: Step 1, extracting genomic DNA from the millet material to be tested; Step 2, PCR amplification: using the genomic DNA extracted in step 1 as a template and the above primers as primers, PARMS technology is used to perform SNP genotyping based on fluorescence detection; Step 3: Result determination: Use an ELISA reader to read the fluorescence signal, obtain the typing diagram after analysis and conversion, and output the genotype result according to different colors.

[0009] As a further optimization of the above identification method, the PCR amplification system contains FAM and HEX labeled probes. When judging the results, if it is green in color, the genotype of the millet material to be tested is A, and the corresponding millet husk color is golden yellow. If it is blue in color, the genotype of the millet material to be tested is G, and the corresponding millet husk color is brown. If it is red in color, the genotype of the millet material to be tested is a heterozygous genotype A / G, and the corresponding millet material husk color is golden yellow.

[0010] Compared with the prior art, the present invention has the following beneficial effects: (1) The specific primers designed in the present invention are located inside the husk color control gene, have a higher degree of linkage with the husk color, and have better reliability.

[0011] (2) The present invention applies fluorescent probes to Kasp-PCR and performs genotyping based on fluorescent signals. It has the advantages of high throughput and high sensitivity and is suitable for large-scale identification of husk color.

[0012] (3) The colors of millet husk identified by the functional markers of the present invention are golden yellow and brown. There is no related technical report so far, which broadens the identification range of millet husk color.

[0013] (4) This functional marker can be used to predict millet husk color, providing molecular-assisted technical support for the early identification and screening of millet husk color traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a fluorescence detection genotyping diagram of some single plants after amplification of a total of 234 single plants in the paternal, maternal and RIL populations using functional marker primers (CAD-5496Fa, CAD-5496Fg and CAD-5496R). DETAILED DESCRIPTION

[0015] The present invention provides a functional marker closely linked to the millet hull color trait, the marker is Kasp-CAD2, and is located in the interval of 5495505bp to 5497605bp on chromosome 1 of millet. The primers of Kasp-CAD2 are CAD-5496Fa (SEQ ID NO. 1), CAD-5496Fg (SEQ ID NO. 2) and CAD-5496R (SEQ ID NO. 3), wherein the primer sequences are as follows: CAD-5496Fa: 5'-GAAGGTGACCAAGTTCATGCTCACCGCGTCGGCGATA-3'; CAD-5496Fg: 5'-GAAGGTCGGAGTCAACGGATTACCGCGTCGGCGATG-3'; CAD-5496R: 5'-CGTTATAGGACCAGATCCTCTTGT-3'.

[0016] The method for identifying millet husk color by Kasp-CAD2 marker comprises the following steps: (1) Extracting genomic DNA from leaves of millet material to be tested; (2) PCR amplification: 10 μL system, the content of each component is: 30 ng genomic DNA, 3 primers 10 μM each, 5 μL 2×PARMS master mix (containing FAM and HEX labeled probes), ddH2O to make up to 10 μL, mix well; PCR reaction procedure: (3) Genotyping: After PCR, the fluorescence signal was read using a TECAN infinite M1000 microplate reader. The online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was then used to analyze and convert the fluorescence signal to obtain a clear and intuitive genotyping diagram. The genotype results were output based on the color. If the color was green, the genotype of the millet material to be tested was A, and the corresponding millet husk color was golden yellow. If the color was blue, the genotype of the millet material to be tested was G, and the corresponding millet husk color was brown. If the color was red, the genotype of the millet material to be tested was the heterozygous genotype A / G, and the corresponding millet husk color was golden yellow.

[0017] The present invention is described in detail below in conjunction with specific examples, but it should not be understood as limiting the present invention. The experimental methods in the following examples without specifying specific conditions are all carried out according to conventional methods and conditions in the art.

[0018] The present invention provides a functional marker tightly linked to the millet husk color trait, the marker is Kasp-CAD2, and is located in the range of 5495505bp to 5497605bp of chromosome 1 of millet, wherein the sequence of Kasp-CAD2 in the female parent Yugu 18 is shown as SEQ ID NO.4, and the sequence of Kasp-CAD2 in the male parent Jigu 19 is shown as SEQ ID NO.5.

[0019] SEQ ID NO.4: AACAGCTCCACACCTGTGAACCGATAGTGTTGTGAAATGCACACTTGTAATCATGGGCTGCCTTGCTGATGACTGAAACTTTTCAGGCATGAGGTGGTCGGTGAGGTAGTGGAGGTTGGGCCCGAGGTGAGCAGGCACCGCGTCGGCGAT ATCGTCGGCGTCGGGGTGATCGTCGGGTGCTGCCGCGAGTGCCGCCCCTGCAAGGCCAACGTCGAGCAGTACTGCAACAAGAGGATCTGGTCCTATAACGATGTCTACACCGACGGCCGGCCCACGCAGGGAGGGTTCGCCTCCACCATGA SEQ ID NO.5: AACAGCTCCACACCTGTGAACCGATAGTGTTGTGAAATGCACACTTGTAATCATGGGCTGCCTTGCTGATGACTGAAACTTTTCAGGCATGAGGTGGTCGGTGAGGTAGTGGAGGTTGGGCCCGAGGTGAGCAGGCACCGCGTCGGCGAT GTCGTCGGCGTCGGGGTGATCGTCGGGTGCTGCCGCGAGTGCCGCCCCTGCAAGGCCAACGTCGAGCAGTACTGCAACAAGAGGATCTGGTCCTATAACGATGTCTACACCGACGGCCGGCCCACGCAGGGAGGGTTCGCCTCCACCATGA Example 1: Method for obtaining labeled Kasp-CAD2 Yugu 18, with golden husk color, was selected as the female parent; Jigu 19, with brown husk color, was selected as the male parent. After hybridization, F1 was identified, and 400 recombinant self-pollination segregation populations were obtained by selfing the single F1 for 6 generations. In 2018 and 2019, the parents and 400 recombinant self-pollination populations were planted in Chengde and Anyang for two consecutive years, and the husk color was investigated. The population plants showed obvious husk color segregation, but the performance was consistent between the two environments. The genomic DNA of the parents and 400 recombinant self-pollination materials was sequenced using the RAD-seq method, and 133.4Gb of raw data was obtained, with an average of 331.8Mb per individual. The sequenced sequences were aligned to the reference genome, with an average alignment rate of 96.45%, an average coverage of 13.89%, and an average sequencing depth of 5.62X.

[0020] Through sequencing and information analysis, 74698 SNP markers with polymorphism between parents were obtained. According to the window sliding method, 15 SNPs were selected as a window and one site was slid each time to obtain the genotype and exchange site of each individual. Finally, bin genotypes and bin maps were generated. Using the bin genotype data, the bin genetic map was constructed using JoinMap software. The constructed millet high-density genetic map was used to perform QTL analysis on the millet hull color trait phenotype using the composite interval mapping analysis (CIM) of WinQTLCart2.5. The QTL loci were determined using LOD>3 as the threshold. Finally, the physical interval of the hull color QTL was found to be located on chromosome 1, 1–6229734 bp. In order to further shorten the QTL interval, a new inconsistency rate analysis method (IRA) developed by us was used to detect chromosome fragments related to quality traits in the RIL population, and the hull color control QTL positioning interval was narrowed to two intervals of 70kb and 30kb, named IRA2HC and IRA3HC. A total of three genes with missense mutations (Seita.1G057100.v2.2, Seita.1G057300.v2.2 and Seita.1G060200.v2.2) were retrieved in the IRA2HC and IRA3HC intervals. Among them, Seita.1G057300.v2.2 encodes cinnamyl alcohol dehydrogenase, which controls rice husk color in rice. A base at position 268 on the third exon of Seita.1G057300.v2.2 was A in Yugu18 (golden husk) and changed to G in Jigu19 (brown husk). This SNP site caused the 90th amino acid of the gene to change from isoleucine in Yugu18 to valine in Jigu19. Primers CAD-5496Fa, CAD-5496Fg and CAD-5496R were designed based on this SNP site, and the genomic DNA extracted from three male and three female plants and the genomic DNA of 228 recombinant self-pollinated individuals were used as templates for amplification using primers CAD-5496Fa, CAD-5496Fg and CAD-5496R, respectively.After amplification, the fluorescence signal was read by TECAN infiniteM1000 microplate reader and analyzed and converted by online software snpdecoder (http: / / www.snpway.com / snpdecoder / ), and a clear and intuitive genotype diagram was obtained. The three male parents were all HEX signals, the corresponding base was G, and the genotype diagram was blue, while the three female parents were all FAM signals, the corresponding base was A, and the genotype diagram was green. The results of the identification of 228 recombinant self-pollinated plants showed that the genotypes of 151 plants with brown husks were all HEX signals, the corresponding base was G, and the genotype diagram was blue. Among the 77 plants with golden husks, 73 plants had FAM signals, the corresponding base was A, and the genotype diagram was green, and 4 plants were heterozygous genotypes, and the genotype diagram was red. The results showed that the husk color of the individual plants of the parents and the recombinant self-pollinated population was completely consistent with the genotype.

[0021] Figure 1 This is the fluorescence detection genotyping diagram of some individual plants after amplification of a total of 234 individual plants in the male, female and RIL populations using functional marker primers (CAD-5496Fa, CAD-5496Fg and CAD-5496R). The green dots represent plants with golden husks, the blue dots represent plants with brown husks, and the four red dots represent heterozygous plants (heterozygous plants have golden husks, and golden is dominant over brown).

[0022] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. A primer for marking the function of a millet husk color control gene, characterized in that: The marker is Kasp-CAD2, located in the interval from 5495505bp to 5497605bp of millet chromosome 1; the primers of Kasp-CAD2 are CAD-5496Fa as shown in SEQ ID NO.1, CAD-5496Fg as shown in SEQ ID NO.2 and CAD-5496R as shown in SEQ ID NO.

3.

2. A kit for identifying millet husk color traits, characterized in that: Comprising the primer of claim 1.

3. The kit according to claim 2, characterized in that: The invention also comprises a PARMS mastermix for PCR amplification, wherein the PARMS mastermix contains two detection probes with different fluorescence.

4. Use of the primer according to claim 1 or the kit according to any one of claims 2-3 in early identification of millet husk color traits and molecular screening breeding.

5. A method for identifying millet husk color traits, characterized in that: The following steps are involved: Step 1, extracting genomic DNA from the millet material to be tested; Step 2, PCR amplification: using the genomic DNA extracted in step 1 as a template, using the kit described in claim 3, and using PARMS technology to perform genotyping based on fluorescence detection; Step 3: Result determination: Use an ELISA reader to read the fluorescence signal, obtain the typing diagram after analysis and conversion, and output the genotype result according to different colors.

6. The identification method according to claim 5, characterized in that: The PCR amplification system contains FAM and HEX labeled probes. When judging the results, if it is green in color, the genotype of the millet material to be tested is A, and the corresponding millet husk color is golden yellow. If it is blue in color, the genotype of the millet material to be tested is G, and the corresponding millet husk color is brown. If it is red in color, the genotype of the millet material to be tested is a heterozygous genotype A / G, and the corresponding millet material husk color is golden yellow.

Images