Piriformospora indica PCR (Polymerase Chain Reaction) detection specific primer and detection method
By designing specific primers and fluorescence quantitative PCR detection methods based on P. indica RPB2 gene, the existing EF1α gene detection marker is not specific and the false positive rate is high, and rapid colonization of pyromosporin is achieved. , accurate and high sensitivity detection.
Patent Information
- Application Number
- CN202411830067.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-12
- Publication Date
- 2025-02-11
AI Technical Summary
The existing EF1α gene detection marker is not specific, resulting in high false positives and low amplification efficiency, which makes it impossible to effectively evaluate the colonization efficiency of the Indian pyramid in the plant root system.
Design and use specific primers for the detection of pyropodospora PCR. Based on the P. indica RPB2 gene, the rapid, accurate and high-sensitivity detection of pyropora colonization was achieved through fluorescence quantitative PCR detection method.
It improves the specificity and sensitivity of the detection, and can accurately detect the colonization of the saphenous saphenous in a short time, reduces the false positive rate, and enhances the accuracy and practicality of the detection.
Smart Images
Figure CN119410828A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial detection, and particularly relates to a specific primer for PCR detection of Indian pear-shaped spores and a fluorescent quantitative PCR detection method for Indian pear-shaped spores. Background Art
[0002] Pear-shaped spores of India Piriformospora indica ) belongs to Basidiomycota, Hymenomycetes, Sebacinales, Sebacinaceae, Pear-shaped spore genus ( Piriformospora ), was first isolated from the rhizosphere of Thar Desert shrubs by Indian scientist Verma et al. in 1998. It can colonize on the surface of plant roots, epidermal cells and intercellular spaces, and form typical pear-shaped thick-walled spores, which survive in plant roots. P. indica It has a wide host range and can coexist with more than 200 species of monocotyledonous and dicotyledonous plants. It promotes plant growth and enhances plant systemic resistance by enhancing plant absorption of nutrients such as N and P. It is a multifunctional plant endophytic fungus with wide application potential.
[0003] Currently, around P. indica The number of products developed is increasing, including microbial agents, seed coating agents, etc. P. indica Stable colonization in plant roots is a necessary condition for them to exert their functional diversity. Therefore, it is necessary to carry out efficient and precise P. indica Quantitative colonization testing can be used to evaluate P. indica The field application effect of the product. The accuracy of the traditional trypan blue staining method is affected by the root sampling location. More importantly, due to the local microscopic examination, it cannot fully reflect the colonization of endophytes, which affects the accuracy of the experiment. EF1α Gene detection markers have a low specificity, resulting in a high false positive rate and low amplification efficiency, which is not conducive to further application.
[0004] Therefore, the development of a rapid, accurate, specific and sensitive detection method to evaluate the colonization efficiency of P. indica in plant roots is of great significance for the promotion and application of corresponding products. Summary of the invention
[0005] The first object of the present invention is to provide a specific primer for PCR detection of Indian pear-shaped spores, so as to solve the existing EF1α Genetic detection markers have technical problems such as low specificity, high false positives, and low amplification efficiency.
[0006] In order to solve the above technical problems, the present invention adopts the following technical scheme, Indian pear-shaped spore PCR detection specific primers, characterized in that the nucleotide sequence of the specific primers is: Upstream primer PI-F: 5′-CGCTGGAGGAATTTGAGAAG-3′; Downstream primer PI-R: 5′-CCGTCTTCCCGATAATGATG-3′.
[0007] The second largest subunit of RNA polymerase II ( RPB2 ) is widely used in fungal taxonomy and phylogenetic research, especially in diverse fungal populations. Because it shows high sequence variability in different fungal species, it can better distinguish different types of fungi. P. indicaRPB2 Design of gene-specific primers for P. indica Quantitative colonization assay.
[0008] The invention discloses primers for rapidly detecting Indian pear-shaped spore, which are suitable for colonization detection in basic research on interaction between Indian pear-shaped spore and host plants, detection of colonization efficiency of plant samples roots after using Indian pear-shaped spore products in the field, and other purposes.
[0009] The second object of the present invention is to provide a fluorescent quantitative PCR detection method for Indian pear-shaped spores, comprising the following steps: (1) Establishing a standard curve: (1-1) Primer synthesis: synthesizing the upstream primer and downstream primer described in claim 1; (1-2) DNA template extraction: Take the activated Indian pear-shaped spore hyphae and extract the fungal genomic DNA; (1-3) Obtaining the target fragment: Using PI-F upstream primer and PI-R downstream primer, PCR amplification was performed on the fungal genomic DNA sample to obtain the target gene fragment; (1-4) Construction of positive plasmid: Connect the target gene fragment to the linearized plasmid vector, transform it into Escherichia coli for replication, screen and identify, and obtain the positive plasmid; (1-5) Establishment of standard curve: The positive plasmid is measured by UV spectrophotometer and diluted in gradients for fluorescence quantitative PCR amplification; according to the cycle threshold of each concentration gradient, a fluorescence quantitative PCR standard curve is drawn; (2) Fluorescence quantitative PCR detection (2-1) Take the root of the host plant, extract the total DNA, and obtain a DNA sample; (2-2) Using the PI-F upstream primer and the PI-R downstream primer, the DNA sample obtained in step (2-1) and the negative control ddH 20 respectively perform fluorescence quantitative PCR amplification, compare the cycle threshold value of the DNA sample in step (2-1) with the fluorescence quantitative PCR standard curve in step (1-5), obtain the copy number of the target gene fragment in the DNA sample in step (2-1), and then obtain the concentration of Indian pear-shaped spore in the DNA sample in step (2-1).
[0010] The invention discloses a method for rapidly detecting Indian pear-shaped spore, which is suitable for various purposes such as colonization detection in basic research on interaction between Indian pear-shaped spore and host plants, detection of root colonization efficiency of plant samples after use of Indian pear-shaped spore products in the field, and the like.
[0011] The present invention has the following beneficial effects: First, the specificity is good and the identification is fast. The primers are designed based on the specific sequence of Indian pear-shaped spores, with high detection specificity and the ability to obtain results in a relatively short time.
[0012] Second, accurate quantification and high sensitivity. Compared with the conventional PCR method, the detection method of the present invention can accurately quantify, and the detection limit reaches 20 copies / μL.
[0013] Third, it has good practicability and a wide range of applications. It can be used to quantitatively detect the colonization of Indian pear-shaped spores in the roots of different host plants, and can also be used to evaluate the application effect of Indian pear-shaped spore products in actual production.
[0014] In order to solve the technical problem of how to implement the PCR reaction system in step (1-3), the present invention adopts the following technical solution. The PCR reaction system in step (1-3) is 50 μL, specifically: Table 1 Step (1-3) PCR amplification reaction system The PCR reaction program was: 94°C, 4 min; 94°C, 30 s, 55°C, 30 s, 72°C, 30 s, 34 cycles; 72°C, 10 min.
[0015] In order to solve the technical problem of how to implement the fluorescence quantitative PCR reaction system in step (1-5) and step (2-2), the present invention adopts the following technical solution. The fluorescence quantitative PCR reaction system in step (1-5) and step (2-2) is 20 μL, specifically: Table 2 Fluorescence quantitative PCR reaction system in steps (1-5) and (2-2) The fluorescence quantitative PCR reaction program was: 95°C, 30 s; 95°C, 5 s, 60°C, 34 s, 40 cycles.
[0016] In order to solve the technical problem of how to determine the specificity of fluorescent quantitative PCR reaction, the present invention adopts the following technical solution. After the PCR in step (1-5) and step (2-2) is completed, the temperature is adjusted to 0.1℃·S -1 The heating rate was increased from 60°C to 95°C for melting curve analysis to determine the specificity of the fluorescence quantitative PCR reaction. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is an agarose gel electrophoresis diagram of the primer specificity verification analysis in Example 2 of the present invention.
[0018] Lane M is D2000 plus DNA Ladder (Solarbio, China), which is from top to bottom: 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.
[0019] Lane 1 is rice; Lane 2 is wheat; Lane 3 is corn; Lane 4 is soybean; Lane 5 is green vegetables; Lane 6 is tobacco; Lane 7 is Fusarium oxysporum; Lane 8 is Bacillus thuringiensis; Lane 9 is Indian pear-shaped spore; Lane 10 is blank control (sterile ultrapure water).
[0020] Figure 2 This is the standard curve of fluorescence quantitative PCR amplification in Example 3. The vertical axis is the Ct value, the horizontal axis is the logarithm of the starting template, and the standard curve determination coefficient R 2 =0.992.
[0021] Figure 3 This is the melting curve diagram in Example 4.
[0022] Figure 4 is the existing paper in Example 5 EF1α Standard curve diagram of genetic testing method.
[0023] Figure 5 Fluorescence quantitative PCR detection was used in Example 5 EF1α When the gene was expressed, the melting curves of the four sample reaction wells showed a double peak phenomenon.
[0024] Figure 6 For Example 5 RPB2 Melting curve of gene fluorescence quantitative PCR.
[0025] Figure 7 It is the colonization amount of Indian Piriform spore on the roots of different host plants 14 days after the inoculation treatment of Indian Piriform spore in Example 6; the vertical axis is the colonization amount; the horizontal axis is different host plants.
[0026] Figure 8The colonization amount of Indian Piriformis spores on the rice root system after the inoculation treatment with Indian Piriformis spores in Example 7; the vertical axis is the colonization amount; the horizontal axis is the inoculation treatment time (3, 5, 7, 9, 11 days).
[0027] Fig. 9 The figure shows the effect of Indian pear-shaped spore PI-020 on the yield of green vegetables in Example 8; PI-020 is the treatment group and CK is the control group.
[0028] Fig.10 This is a graph showing the results of detecting the root colonization of green vegetables in the treatment group and the control group in Example 8; PI-020 is the treatment group and CK is the control group. DETAILED DESCRIPTION
[0029] The present invention will be further described below in conjunction with the accompanying drawings.
[0030] In order to better understand the present invention, the present invention is further described below by way of examples, but the scope of the present invention is not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention except for the primers are all conventional reagents, methods and equipment in the art.
[0031] Comparison example based on P. indica Transcription elongation factor EF1α Gene, build P. indica The real-time fluorescence quantitative PCR (qPCR) detection method was used to detect the root system of rice seedlings. P. indica Colonization detection.
[0032] EF1α Gene primers, specifically including: Pi-F: 5′-TCCGTCGCGCACCATT-3′; Pi-R: 5′-AAATCGCCCTCTTTCCACAA-3′.
[0033] The results showed that using EF1α The gene sequence primers were used to amplify the 84 bp specific product, and the recombinant plasmid pCE2-Pi was constructed with the specific product as the standard template for qPCR amplification. The established standard curve had a good linear relationship and high sensitivity, and the lower limit of qPCR detection was 2.03×10 2 copies / μL.
[0034] Rice seedling root system P. indica The qPCR method was used to detect the colonization of the root system during the 3-13 day colonization period. P. indica The colonization was the highest on the 7th day, reaching 1.51×10 4 copies / μL.
[0035] Example 1: Design and synthesis of primers The present invention is based on the disclosed Indian pear-shaped spore ( Piriformospora indica ) genome sequence, select RPB2 The gene is used as the detection target gene, and its sequence is: ATGGAGAAGACTGCAGGTCAGATCACGCTGGAGGAATTTGAGAAGCCCTCTCGCGACACGACTCTTCGTATGAAGCACGGAAACTATGACAAATTAGATGACGACGGCCTTATCGCACCAGGCATGAACGTCATTGGTGAAGACATCATTATCGGGAAGACGGCGCCGTTGCCTCCA GACAGTCAAGAACTGGGTCAACGAACAGATCGACATACCCGTCGCGACGTCTCAACTCCCCTCAAGAGCACAGAGAGCGGCATCATCGATCACGTTYTGATCACGGTTGATGGCGAAGGGTCCAAGTTTGTCAAGATCCGGGTTCGCTCGACACGTATYCCCCAAGTCGGCGATAA.
[0036] The bold part in the sequence is the target gene fragment.
[0037] Primers were designed using Primer Primer 5.0 software and synthesized by General Biotech Anhui Co., Ltd.: PI-F: 5′-CGCTGGAGGAATTTGAGAAG-3′; PI-R: 5′-CCGTCTTCCCGATAATGATG-3′.
[0038] The second largest subunit of RNA polymerase II ( RPB2 ) is widely used in fungal taxonomy and phylogenetic research, especially in diverse fungal populations. Because it shows high sequence variability in different fungal species, it can better distinguish different types of fungi. P. indicaRPB2 Design of gene-specific primers for P. indica Quantitative colonization assay.
[0039] Example 2: Verification of primer specificity Root DNA of different host plants, such as rice, wheat, corn, soybean, green vegetables, and tobacco, as well as DNA of Fusarium oxysporum, DNA of Bacillus thuringiensis, and DNA of Indian pear-shaped spore were used as templates, and sterilized ultrapure water was used as blank control. Conventional PCR reaction combined with agarose gel electrophoresis was used to verify whether the specific primers can be amplified in other species. The PCR reaction system is as follows: Table 3 PCR reaction system The PCR reaction program was: 94°C, 4 min; 94°C, 30 s, 55°C, 30 s, 72°C, 30 s, 34 cycles; 72°C, 10 min.
[0040] Agarose gel electrophoresis Figure 1 As shown, only P. indica can amplify the target fragment of 138 bp, and DNA of other species have no bands, which indicates that the specific primers of the present invention have good specificity and can be used for the detection of P. indica.
[0041] The target gene fragment is: CGCTGGAGGA ATTTGAGAAG CCCTCTCGCG ACACGACTCT TCGTATGAAG CACGGAAACT 60 ATGACAAATT AGATGACGAC GGCCTTATCG CACCAGGCAT GAACGTCATT GGTGAAGACA 120 TCATTATCGG GAAGACGG 138.
[0042] Example 3: Preparation of positive control and establishment of standard curve According to the published Indian pear-shaped spore ( Piriformospora indica ) Genome sequence, design RPB2 Gene amplification primers PI-F: 5′-CGCTGGAGGAATTTGAGAAG-3′; PI-R: 5′-CCGTCTTCCCGATAATGATG-3′, using the DNA of Indian piriform spore sample as template, firstly carried out conventional PCR amplification reaction, then the PCR product was subjected to agarose gel electrophoresis, and the target fragment was recovered by GeneJET Gel Extraction Kit (Thermo, USA) and ligated to pCE3-Blunt vector (Vazyme, China), and then transformed into Transl-Tl Phage Resistant chemically competent cells (TransGenBiotech, China) were used to obtain the recombinant plasmid pCE3-PI. Positive clones were screened and sequenced for verification, and the constructed pCE3-PI plasmid was extracted. The concentration of the plasmid was detected using a spectrophotometer, and the copy number of the target gene was calculated. Then, the positive PI plasmid was diluted with sterile ultrapure water to a certain concentration of copies / μL as a positive standard control.
[0043] The positive control plasmid was added at 2 × 10 6 , 2×10 5 , 2×10 4 , 2×10 3 , 2×10 2 , 20 copies / μL dilution, take 1μL as template, and perform fluorescence quantitative PCR reaction. The fluorescence quantitative PCR reaction system is 20μL, specifically: Table 4 Fluorescence quantitative PCR reaction system The fluorescence quantitative PCR reaction program was: 95°C, 30 s; 95°C, 5 s, 60°C, 34 s, 40 cycles.
[0044] The results showed that there was an obvious linear relationship between the number of cycles (Ct) required for the fluorescence signal in each reaction tube to reach the threshold and the logarithm of the starting template copy number (R 2 =0.992)( Figure 2 ).
[0045] Example 4: Sensitivity detection The positive control plasmid (pCE3-PI) was diluted 10 times in a gradient manner. 1 μL of each was taken as a template and amplified on a fluorescent PCR instrument (the reaction system and reaction procedure were the same as in Example 3).
[0046] The amplification curve and Ct value are obtained by the fluorescent quantitative PCR system. If the Ct of the sample to be tested is ≤35 and a typical amplification curve appears, it can be determined that the sample to be tested contains Indian pear-shaped spores; if the Ct of the sample to be tested is ≥35 and a typical amplification curve appears, the test needs to be repeated; if the sample Ct value cannot be detected and there is no obvious amplification curve, it can be determined that the sample to be tested does not contain Indian pear-shaped spores.
[0047] The results showed that the detection limit of fluorescence quantitative PCR reached 20 copies / μL, and the corresponding Ct value was 33.55 ( Figure 3 ).
[0048] Example 5: Pear-shaped spores of India RPB2 Gene and EF1α Comparative analysis of the advantages of genetic testing methods The present invention RPB2 Genetic testing methods compared to existing papers EF1α Genetic testing methods have the following advantages: 1) Amplification efficiency increased by 24%. The amplification efficiency was calculated based on the standard curve. The amplification efficiency (E) calculation formula is: E=(10 -1 / k -1)×100%, k is the slope of the standard curve. EF1α The gene amplification efficiency was 79.3% ( Figure 4 ),and RPB2 The gene amplification efficiency was 98.4% ( Figure 2 ).
[0049] 2) Sensitivity increased 10 times. EF1α The detection limit is 203 copies / μL. RPB2 The detection limit reached 20 copies / μL ( Figure 3 ).
[0050] 3) The false positive rate is significantly reduced. EF1α During gene fluorescence quantitative PCR detection, the melting curves of the reaction wells of 4 samples showed double peaks. After repeated tests to exclude other factors, it was considered that these samples had false positive reactions, with a false positive rate of 12.5% ( Figure 5 ).and RPB2 The melting curve of gene fluorescence quantitative PCR was a single peak at 83.7℃, indicating that there was no nonspecific amplification and primer dimer, and the primer had good specificity ( Figure 6 ).
[0051] Example 6: Quantitative detection of Pyriformis indica colonization in roots of different host plants Indian pear-shaped spores were inoculated into different host plants, such as rice, wheat, green vegetables, tobacco, and tomatoes, and the colonization of Indian pear-shaped spores was detected using the established fluorescent quantitative PCR technology system. The rice roots were taken 14 days after inoculation, washed with sterile water, and DNA was extracted to perform fluorescent quantitative PCR reaction.
[0052] The fluorescence quantitative PCR reaction system is 20 μL, specifically: Table 5 Fluorescence quantitative PCR reaction system The fluorescence quantitative PCR reaction program was: 95°C, 30 s; 95°C, 5 s, 60°C, 34 s, 40 cycles.
[0053] The results showed that the samples showed an obvious increase in fluorescence signals, and the samples showed a good amplification kinetic curve, which was consistent with the typical S-type amplification curve characteristics. This showed that the roots of rice, wheat, green vegetables, tobacco, and tomatoes were colonized by Indian pear-shaped spores. The Indian pear-shaped spore colonization amount ( Figure 7 ).
[0054] Example 7: Dynamic detection of the colonization of Pyriformis indica on rice roots The Indian pear-shaped spore was inoculated into rice (Indian pear-shaped spore-rice co-cultivation), and the colonization amount of Indian pear-shaped spore was dynamically detected using the established fluorescent quantitative PCR technology system. The rice roots were taken 3, 5, 7, 9, 11, and 13 days after inoculation, washed with sterile water, and DNA was extracted to perform fluorescent quantitative PCR reaction (the reaction system and reaction procedure were the same as those in Example 6).
[0055] The results showed that the samples showed a significant increase in fluorescence signals, and the samples showed a good amplification kinetic curve, which was consistent with the typical S-shaped amplification curve characteristics. Indian pear-shaped spores can colonize the rice root system 3 days after inoculation, and the colonization amount shows an upward trend with the increase of time. The colonization amount is the highest at 7 days after inoculation, and then it shows a downward trend ( Figure 8 ).
[0056] Example 8: Application of colonization detection in vegetable production The roots of Chinese cabbage (Suzhou green) were treated with Indian pear-shaped spore liquid (PI-020). The group treated with PI-020 was the treatment group, and the group treated with water was the control group. Half a month after transplanting, the growth of the cabbage in the treatment group was significantly better than that in the control group. Harvesting began one month later, and 10 cabbages were harvested and weighed every 10 days. Statistical analysis showed that the yield of cabbage treated with PI-020 increased by 13% ( Fig. 9 ). The roots of green vegetables in the treatment group and the control group were sampled, 3 plants were randomly selected from each group, 3 replicates were performed, and a total of 18 plants were obtained. After washing with sterile water, DNA was extracted and fluorescent quantitative PCR reaction was performed (the reaction system and reaction procedure were the same as in Example 6).
[0057] The results showed that Indian pear-shaped spores were detected in the roots of the green vegetables in the treatment group, but Indian pear-shaped spores were not detected in the roots of the green vegetables in the control group ( Fig.10 ), indicating that the spore liquid of Indian pear-shaped spore has a good effect, and its stable colonization in the root system of green vegetables increases the yield of green vegetables.
[0058] The above-mentioned implementation modes are only for illustrating the technical features and concepts of the present invention, and their purpose is to enable technicians familiar with this technology in the field to understand the contents of the present invention and implement them. They cannot be used to limit the protection scope of the present invention. All equivalent changes or modifications made according to the spirit and implementation modes of the present invention should be included in the protection scope of the present invention.
Claims
1. Specific primers for PCR detection of Indian pear-shaped spores, characterized by: The nucleotide sequence of the specific primer is: Upstream primer PI-F: 5′-CGCTGGAGGAATTTGAGAAG-3′; Downstream primer PI-R: 5′-CCGTCTTCCCGATAATGATG-3′.
2. A fluorescent quantitative PCR detection method for Indian pear-shaped spores, characterized in that: The following steps are involved: (1) Establish a standard curve: (1-1) Primer synthesis: synthesizing the upstream primer and downstream primer described in claim 1; (1-2) DNA template extraction: Take the activated Indian pear-shaped spore hyphae and extract the fungal genomic DNA; (1-3) Obtaining the target fragment: Using PI-F upstream primer and PI-R downstream primer, PCR amplification was performed on the fungal genomic DNA sample to obtain the target gene fragment; (1-4) Construction of positive plasmid: Connect the target gene fragment to the linearized plasmid vector, transform it into Escherichia coli for replication, screen and identify, and obtain the positive plasmid; (1-5) Establishment of standard curve: The positive plasmid is measured by UV spectrophotometer and diluted in gradients for fluorescence quantitative PCR amplification; according to the cycle threshold of each concentration gradient, a fluorescence quantitative PCR standard curve is drawn; (2) Fluorescence quantitative PCR detection (2-1) Take the root of the host plant, extract the total DNA, and obtain a DNA sample; (2-2) Using PI-F upstream primer and PI-R downstream primer, perform fluorescence quantitative PCR amplification on the DNA sample obtained in step (2-1) and the negative control ddH20, respectively, and compare the cycle threshold of the DNA sample in step (2-1) with the fluorescence quantitative PCR standard curve in step (1-5) to obtain the copy number of the target gene fragment in the DNA sample in step (2-1), and then obtain the concentration of Indian pear-shaped spore in the DNA sample in step (2-1).
3. The method for detecting Indian pear-shaped spores by fluorescent quantitative PCR according to claim 2, characterized in that: The PCR reaction system in step (1-3) is 50 μL, specifically: Table 1 Steps (1-3) PCR amplification reaction system 。 4. The method for detecting Indian pear-shaped spores by fluorescent quantitative PCR according to claim 3, characterized in that: The PCR reaction program of step (1-3) is: 94°C, 4 min; 94°C, 30 s, 55°C, 30 s, 72°C, 30 s, 34 cycles; 72°C, 10 min.
5. The method for detecting Indian pear-shaped spores by fluorescent quantitative PCR according to claim 2, characterized in that: The fluorescence quantitative PCR reaction system in step (1-5) and step (2-2) is 20 μL, specifically: Table 2 Fluorescence quantitative PCR reaction system in steps (1-5) and step (2-2) 。 6. The method for detecting Indian pear-shaped spores by fluorescent quantitative PCR according to claim 2, characterized in that: The fluorescence quantitative PCR reaction program in step (1-5) and step (2-2) is: 95°C, 30s; 95°C, 5s, 60°C, 34s, 40 cycles.
7. The method for detecting Pyriformis indica by fluorescent quantitative PCR according to claim 1, characterized in that: After the PCR in step (1-5) and step (2-2) is completed, the temperature is adjusted to 0.1℃·S -1 The heating rate was increased from 60°C to 95°C for melting curve analysis to determine the specificity of the fluorescence quantitative PCR reaction.
8. The method for detecting Pyriformis indica by fluorescent quantitative PCR according to claim 1, characterized in that: The target gene fragment in step (1-3) is: CGCTGGAGGA ATTTGAGAAG CCCTCTCGCG ACACGACTCT TCGTATGAAG CACGGAAACT 60 ATGACAAATT AGATGACGAC GGCCTTATCG CACCAGGCAT GAACGTCATT GGTGAAGACA 120 TCATTATCGG GAAGACGG 138.