Recombinant collagen-containing wrinkle fading and repairing composition as well as preparation method and application thereof

Abstract

The invention relates to a wrinkle fading repairing composition containing recombinant collagen as well as a preparation method and application of the wrinkle fading repairing composition. The wrinkle fading repairing composition comprises acetyl 6 peptide-8, dipeptide diaminobutyryl benzyl amide diacetate, arginine / lysine polypeptide and the recombinant collagen. All the components are matched with one another and have a synergistic effect, so that the generation of wrinkles can be effectively inhibited.

Description

Technical Field

[0001] The present invention relates to the technical field of cosmetics, and in particular to a wrinkle-lightening and repairing composition containing recombinant collagen, and a preparation method and application thereof. Background Art

[0002] Wrinkles refer to the small fine lines and wrinkles formed when the skin is affected by the external environment and forms free radicals. Free radicals destroy collagen and active substances in normal cell membrane tissues and oxidize cells. Facial wrinkles are divided into two types: atrophic wrinkles and hypertrophic wrinkles. Atrophic wrinkles refer to wrinkles that appear on thin, easily broken and dry skin, such as the countless fine wrinkles around the eyes; hypertrophic wrinkles refer to wrinkles that appear on oily skin, which are few in number, with dense and deep textures, such as wrinkles on the forehead, around the lips, and on the chin. There are many reasons for the appearance of wrinkles, such as insufficient water in the body and skin, long-term lack of sleep, excessive exposure to the sun, and improper use of cosmetics. Once the skin shows the above conditions, it will give people a visual sense of aging. Therefore, anti-wrinkle and anti-aging are the eternal themes of skin care.

[0003] Collagen plays a pivotal role in anti-wrinkle of the skin. Collagen is the main component of the extracellular matrix. Located in the dermis of the skin, the content is about 70%, and the main types are I (85%), III and V. The fibrous collagen forms a mesh structure, which provides tension and elasticity to the skin. It is an important biochemical reaction site for the skin. It has physiological functions such as enhancing skin elasticity, enhancing the water storage capacity of the skin tissue cells, and keeping the skin tender and soft. The growth, repair and nutrition of the skin are inseparable from collagen. Fine lines and wrinkles on human skin are formed because of the loss of collagen due to increased external pressure stimulation as people age.

[0004] With the development of cosmetic technology, the quality of various skin care products varies, and cosmetics with anti-aging, moisturizing, whitening, anti-inflammatory and repair functions are emerging in an endless stream. However, although some cosmetics have added more active ingredients and are very effective, they also cause many people to have allergic phenomena such as erythema, swelling and pain, and their safety is questioned. In addition, at this stage, the ingredients such as vitamin C and hormones that play a role in whitening and anti-aging in cosmetics, although they can see obvious effects in a very short time, most of these compounds have the disadvantages of easy accumulation and difficult decomposition, low safety, poor stability, etc., which are toxic to the human body.

[0005] Therefore, how to provide a safe and effective wrinkle lightening and repairing composition has become a problem that needs to be solved urgently. Summary of the invention

[0006] In order to solve the above technical problems, the present invention discloses a wrinkle repairing composition containing recombinant collagen, and a preparation method and application thereof. The composition comprises acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and recombinant collagen. The various components cooperate with each other and synergistically enhance the effect, which can effectively inhibit the formation of wrinkles.

[0007] To achieve this object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a wrinkle repairing composition containing recombinant collagen, wherein the wrinkle repairing composition comprises acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and recombinant collagen.

[0009] The wrinkle repairing composition provided by the present invention can significantly promote the repairing effect of recombinant collagen by adding active ingredients such as acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate and arginine / lysine polypeptide. Compared with the use of a single ingredient in combination with collagen, the anti-wrinkle repairing effect of the product is significantly improved through the synergistic combination of the above active components.

[0010] Among them, acetyl hexapeptide-8 competes for SNAP-25's site in the melt-vesicle complex, thereby affecting the formation of the complex. When the melt-vesicle complex is slightly unstable, the vesicle cannot effectively release neurotransmitters, which leads to weakened muscle contraction and prevents the formation of wrinkles. Dipeptide diaminobutyryl benzylamide diacetate is a synthetic peptide that simulates snake venom serum. Its effect can reach the bottom of the muscle, simulating the characteristics of nerve paralysis and muscle contraction produced after the venom of venom invades the human body, effectively blocking the signal transmission of muscle contraction, quickly calming all kinds of expression lines, static lines and fine lines, and smoothing the skin. Arginine / lysine peptides are highly folded peptides with very strong muscle relaxant effects, which instantly reduce wrinkles and have a rapid and immediate anti-wrinkle effect.

[0011] The combination of the above three raw materials and recombinant collagen can significantly enhance the anti-wrinkle repair effect.

[0012] Preferably, the repair and anti-aging composition comprises, by weight, 3-5 parts of acetyl hexapeptide-8, 3-5 parts of dipeptide diaminobutyryl benzylamide diacetate, 0.05-0.4 parts of arginine / lysine polypeptide and 0.05-1 parts of recombinant collagen.

[0013] The 3-5 parts may be, for example, 3 parts, 3.5 parts, 4 parts, 4.5 parts or 5 parts, etc. The 0.05-0.4 parts may be, for example, 0.05 parts, 0.1 parts, 0.15 parts, 0.2 parts, 0.25 parts, 0.3 parts, 0.35 parts or 0.4 parts, etc. The 0.05-1 parts may be, for example, 0.05 parts, 0.1 parts, 0.2 parts, 0.3 parts, 0.4 parts, 0.5 parts, 0.6 parts, 0.7 parts, 0.8 parts, 0.9 parts or 1 parts, etc. Other specific point values ​​within the above numerical ranges can be selected, and they will not be repeated here one by one.

[0014] In the present invention, the wrinkle repairing composition can significantly improve the anti-wrinkle repairing effect within the above-mentioned range of parts, and the anti-wrinkle repairing effect will be greatly reduced if the parts are outside the above-mentioned range.

[0015] Preferably, the nucleotide sequence of the recombinant collagen is as shown in SEQ ID No.1.

[0016] SEQ ID No.1:

[0017] GGGCCTCAAGGTATTGCTGGACAGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCTGGTCTTCCTGGCCCCTCTGGTGAACCTGGCAAACAAGGTCCCTCTGGAGCAAGTGGTGAACGTGGTCCCCCTGGTCCCATGGGCCCCCCTGGATTGGCTGGACCCCCTGGTGAATCTGGACGTGAGGGGGCTCCTGGTGCCGAAGGTTCCCCTGGACGAGACGGTTCTCCTGGCGCCAAGGGTGACCGTGGTGAGACCGGCCCCGCTGGACCCCCTGGTGCTCCTGGTGCTCCTGGTGCCCCTGGCCCCGTTGGCCCTGCTGGCAAGAGTGGTGATCGTGGTGAGACTGGTCCTGCTGGTCCCGCCGGAGAACGAGGTGGCCCTGGAGGACCTGGCCCTCAGGGTCCTCCTGGAAAGAATGGTGAAACTGGACCTCAGGGACCCCCAGGGCCTACTGGGCCTGGTGGTGACAAAGGAGACACAGGACCCCCTGGTCCACAAGGATTACAAGGCTTGCCTGGTACAGGTGGTCCTCCAGGAGAAAATGGAAAACCTGGGGAACCAGGTCCAAAGGGTGATGCCGGTGCACCTGGAGCTCCAGGAGGCAAGGGTGATGCTGGTGCCCCTGGTGAACGTGGACCTCCTGGATTGGCAGGGGCCCCAGGACTTAGAGGTGGAGCTGGTCCCCCTGGTCCCGAAGGAGGAAAGGGTGCTGCTGGTCCTCCTGGGCCACCTGGTGCTGCTGGTACTCCTGGTCTGCAAGGAATGCCTGGACCTGGTCCTTGCTGTGGTGGTTAA。

[0018] In the present invention, the recombinant collagen of the present invention is based on the amino acids 950-1075 of type I collagen and the amino acids 594-729 and 1193-1199 of type III collagen as templates for recombinant collagen. The sequence is a specific (Gly-XY) repeating sequence on collagen. The nucleotide sequence of the recombinant human collagen peptide is redesigned and optimized according to the selected amino acid sequence to obtain the recombinant collagen of the present invention. The recombinant collagen of the present invention has the effects of moisturizing, supplementing skin collagen, anti-aging, etc., and has good tissue compatibility, skin permeability, and safety.

[0019] Preferably, the wrinkle repairing composition further comprises palmitoyl pentapeptide-5.

[0020] In the present invention, palmitoyl pentapeptide-5 (C 45 H 76 N 6 O 5 ), has clear anti-aging effects, can effectively improve skin roughness, reduce the number of fine lines, reduce the depth and area of ​​wrinkles, etc., and is mild and non-irritating. Used in conjunction with acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine peptides, it can promote the anti-wrinkle repair effect of recombinant collagen.

[0021] Preferably, the wrinkle repairing composition further comprises 0.5-2 parts by weight of palmitoyl pentapeptide-5.

[0022] The 0.5-2 parts can be, for example, 0.5 parts, 0.6 parts, 0.7 parts, 0.8 parts, 0.9 parts, 1 parts, 1.1 parts, 1.2 parts, 1.3 parts, 1.4 parts, 1.5 parts, 1.6 parts, 1.7 parts, 1.8 parts, 1.9 parts or 2 parts. Other specific point values ​​within the above numerical range can be selected, and they will not be repeated here. When the amount of palmitoyl pentapeptide-5 added is within the range defined by the present invention, the coordination effect with other components is better.

[0023] In a second aspect, the present invention provides a method for preparing a wrinkle-lightening and repairing composition containing recombinant collagen according to the first aspect, the preparation method comprising the following steps: mixing acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and recombinant collagen to obtain the wrinkle-lightening and repairing composition.

[0024] The wrinkle lightening and repairing composition containing recombinant collagen prepared by the present invention has a simple preparation method, is easy to industrialize and mass produce, and has excellent practicality.

[0025] Preferably, the preparation method comprises the following steps: mixing acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and palmitoyl pentapeptide-5 for the first time, and then adding recombinant collagen for the second mixing.

[0026] In the present invention, the raw materials except the recombinant collagen are mixed for the first time, and then the recombinant collagen is added again, which can minimize the damage of the mixing operation to the activity of the recombinant collagen, thereby ensuring the anti-wrinkle repair effect of the wrinkle repair composition.

[0027] Preferably, the temperature of the first mixing is 18-20° C., for example, 18° C., 18.2° C., 18.4° C., 18.6° C., 18.8° C., 19° C., 19.2° C., 19.4° C., 19.6° C., 19.8° C. or 20° C. Other specific point values ​​within the above numerical range can be selected, and they will not be described one by one here.

[0028] Preferably, the temperature of the second mixing is 4-6°C, for example, 4°C, 4.2°C, 4.4°C, 4.6°C, 4.8°C, 5°C, 5.2°C, 5.4°C, 5.6°C, 5.8°C or 6°C, etc. Other specific point values ​​within the above numerical range can be selected, which will not be repeated here.

[0029] In the present invention, the mixing temperature has a great influence on the activity of the raw materials. Most of the raw materials are polypeptides and proteins, which are sensitive to temperature. Too high or too low temperature will have a certain influence on the activity of the raw materials, thereby greatly reducing the effect of the prepared recombinant collagen.

[0030] In a third aspect, the present invention provides a use of the wrinkle-lightening and repairing composition containing recombinant collagen according to the first aspect in the preparation of cosmetics.

[0031] Preferably, the cosmetics include essence, lotion, emulsion, cream, facial cleanser or facial mask.

[0032] Preferably, the anti-wrinkle composition containing all-human collagen in the cosmetic has a mass percentage of 0.4-0.6%. The 0.4-0.6% may be, for example, 0.4%, 0.42%, 0.44%, 0.46%, 0.48%, 0.5%, 0.52%, 0.54%, 0.56%, 0.58% or 0.6%, etc. Other specific point values ​​within the above numerical range can be selected, and will not be repeated here.

[0033] Compared with the prior art, the present invention has at least the following beneficial effects:

[0034] 1. The wrinkle repairing composition provided by the present invention improves the anti-wrinkle repairing effect of the product by adding active ingredients such as acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and recombinant collagen through the synergistic cooperation of the above active components.

[0035] 2. The recombinant collagen obtained by redesigning the amino acid sequence and optimizing the nucleotide sequence of the recombinant human collagen peptide in the present invention has the effects of moisturizing, replenishing skin collagen, anti-aging, etc., and has good tissue compatibility, skin permeability and safety.

[0036] 3. The wrinkle repairing composition of the present invention can ensure that it can play a repairing and soothing role while anti-wrinkle repairing by adding palmitoyl pentapeptide-5.

[0037] 4. The preparation method of the anti-wrinkle essence provided by the present invention is simple and easy to operate, easy to industrialize and mass produce, and has excellent practicality. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the cell scratch image of Application Example 1.

[0039] Figure 2 This is the cell scratch image of comparative application example 1. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0041] The sources of raw materials used in the following examples are:

[0042] Acetyl hexa-peptide-8: Shengnuo Biotechnology;

[0043] Dipeptide diaminobutyryl benzylamide diacetate: Shengnuo Biotechnology;

[0044] Arginine / lysine peptides: Shengnuo Biotechnology;

[0045] Palmitoyl Pentapeptide-5: Shengnuo Biotechnology;

[0046] Animal source collagen: Chuanger Bio.

[0047] Example 1

[0048] This embodiment provides a wrinkle repairing composition containing recombinant collagen, which includes 4 parts of acetyl hexapeptide-8, 4 parts of dipeptide diaminobutyryl benzylamide diacetate, 0.2 parts of arginine / lysine polypeptide, 1 part of recombinant collagen and 1 part of palmitoyl pentapeptide-5.

[0049] Example 2

[0050] The present embodiment provides a wrinkle repairing composition containing recombinant collagen, which includes 3 parts of acetyl hexapeptide-8, 5 parts of dipeptide diaminobutyryl benzylamide diacetate, 0.05 parts of arginine / lysine polypeptide, 0.05 parts of recombinant collagen and 0.5 parts of palmitoyl pentapeptide-5.

[0051] Example 3

[0052] This embodiment provides a wrinkle repairing composition containing recombinant collagen, which includes 5 parts of acetyl hexapeptide-8, 3 parts of dipeptide diaminobutyryl benzylamide diacetate, 0.4 parts of arginine / lysine polypeptide, 0.5 parts of recombinant collagen and 2 parts of palmitoyl pentapeptide-5.

[0053] Example 4

[0054] This embodiment provides a wrinkle repairing composition containing recombinant collagen, which is different from Example 1 only in that it does not contain palmitoyl pentapeptide-5, and is consistent with Example 1 in other aspects.

[0055] Example 5

[0056] This embodiment provides a wrinkle repairing composition containing recombinant collagen, which differs from Example 1 in that the added portions of raw materials are different. It includes 2 parts of acetyl hexapeptide-8, 6 parts of dipeptide diaminobutyryl benzylamide diacetate, 0.01 parts of arginine / lysine polypeptide, 4 parts of recombinant collagen and 0.1 parts of palmitoyl pentapeptide-5, and the rest is consistent with Example 1.

[0057] Example 6

[0058] This embodiment provides a wrinkle repairing composition containing recombinant collagen, which differs from Example 1 in that the added portions of raw materials are different. It includes 5.5 parts of acetyl hexapeptide-8, 1 part of dipeptide diaminobutyryl benzylamide diacetate, 0.6 parts of arginine / lysine polypeptide, 0.01 parts of recombinant collagen and 6 parts of palmitoyl pentapeptide-5, and the rest is consistent with Example 1.

[0059] Example 7

[0060] This embodiment provides a wrinkle repairing composition containing recombinant collagen. The difference between this embodiment and embodiment 1 is that the collagen used is animal-derived collagen, and the rest is the same as embodiment 1.

[0061] Comparative Example 1

[0062] This comparative example provides a wrinkle repairing composition containing recombinant collagen, which differs from Example 1 in that it does not contain dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and palmitoyl pentapeptide-5, and the added amounts of the above raw materials are proportionally distributed to acetyl hexa-peptide and collagen, and the rest is consistent with Example 1.

[0063] Comparative Example 2

[0064] This comparative example provides a wrinkle repairing composition containing recombinant collagen. The difference from the other examples 1 is that it does not contain acetyl hexa-peptide, arginine / lysine polypeptide and palmitoyl pentapeptide-5, and the added amounts of the above raw materials are proportionally distributed to dipeptide diaminobutyryl benzylamide diacetate and collagen, and the rest is consistent with example 1.

[0065] Comparative Example 3

[0066] This comparative example provides a wrinkle repairing composition containing recombinant collagen. The difference from the other examples 1 is that it does not contain acetyl hexa-peptide, dipeptide diaminobutyryl benzylamide diacetate and palmitoyl pentapeptide-5, and the added amounts of the above raw materials are proportionally distributed to the arginine / lysine polypeptide and collagen, and the rest is consistent with the examples 1.

[0067] Comparative Example 4

[0068] This comparative example provides a wrinkle repairing composition containing recombinant collagen. The difference from the other examples 1 is that it does not contain acetyl hexa-peptide, dipeptide diaminobutyryl benzylamide diacetate and arginine / lysine polypeptide, and the added amounts of the above raw materials are proportionally distributed to palmitoyl pentapeptide-5 and collagen, and the rest is consistent with example 1.

[0069] Comparative Example 5

[0070] This comparative example provides a wrinkle repairing composition containing recombinant collagen, which differs from Example 1 in that it does not contain dipeptide diaminobutyryl benzylamide diacetate and palmitoyl pentapeptide-5, and the added amounts of the above raw materials are proportionally distributed to acetyl hexa-peptide, arginine / lysine polypeptide and collagen, and the rest is consistent with Example 1.

[0071] Comparative Example 6

[0072] This comparative example provides a wrinkle repairing composition containing recombinant collagen, which is different from Example 1 in that it only contains dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and collagen, and the rest is consistent with Example 1.

[0073] Application Example 1

[0074] This application example provides a method for preparing a wrinkle repair composition containing recombinant collagen

[0075] The acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and palmitoyl pentapeptide-5 in Example 1 were mixed for the first time at a temperature of 19° C. Recombinant collagen was then added and mixed for the second time at a temperature of 5° C. to obtain a wrinkle repairing composition.

[0076] Application Example 2

[0077] This application example provides a method for preparing a wrinkle repair composition containing recombinant collagen

[0078] The acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and palmitoyl pentapeptide-5 in Example 2 were mixed for the first time at a temperature of 18° C. Recombinant collagen was then added and mixed for the second time at a temperature of 6° C. to obtain a wrinkle repairing composition.

[0079] Application Example 3

[0080] This application example provides a method for preparing a wrinkle repair composition containing recombinant collagen

[0081] The acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and palmitoyl pentapeptide-5 in Example 3 were mixed for the first time at a temperature of 20° C. Recombinant collagen was then added and mixed for the second time at a temperature of 4° C. to obtain a wrinkle repairing composition.

[0082] Application Example 4-7

[0083] This application example provides a method for preparing a wrinkle repairing composition containing recombinant collagen. The only difference between this method and application example 1 is that the wrinkle repairing composition used is Example 4-7, and the rest is the same as application example 1.

[0084] Application Example 8

[0085] This application example provides a method for preparing a wrinkle repairing composition containing recombinant collagen. The only difference between this method and application example 1 is that the temperature of the first mixing is 23° C., and the rest is the same as application example 1.

[0086] Application Example 9

[0087] This application example provides a method for preparing a wrinkle repairing composition containing recombinant collagen. The only difference between this method and application example 1 is that the temperature of the second mixing is 2° C., and the rest is the same as application example 1.

[0088] Application Example 10

[0089] This application example provides a method for preparing a wrinkle repairing composition containing recombinant collagen, which differs from Application Example 1 only in that acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide, palmitoyl pentapeptide-5 and recombinant collagen are mixed for the first time, and no second mixing is performed, and the rest is consistent with Application Example 1.

[0090] Comparative Application Examples 1-6

[0091] This comparative application example provides a method for preparing a wrinkle repairing composition containing recombinant collagen, which differs from Application Example 1 only in that the wrinkle repairing composition used is Comparative Example 1-6, and the rest is consistent with Application Example 1.

[0092] Test Example 1

[0093] This test case is used to test the effect of lightening wrinkles

[0094] In this test example, the wrinkle repair composition containing recombinant collagen prepared in the above application examples and comparative application examples was tested at a concentration of 1%.

[0095] (1) Cultivation and synchronization of Caenorhabditis elegans

[0096] Place Caenorhabditis elegans on nematode growth medium (NGM) coated with Escherichia coli OP50 and culture in a biochemical incubator at 20°C and 50% relative humidity. Use sodium perchlorate lysis method to synchronize Caenorhabditis elegans. Rinse the young adults on the NGM plate with 0.5mL of M9 buffer solution, transfer to a 2mL sterile EP tube, add 0.5mL of freshly prepared lysis solution, shake thoroughly for 4min, centrifuge at 3000r / min for 1min on a low-speed centrifuge, discard the supernatant, rinse the nematodes with 1mL of M9 buffer and centrifuge twice under the same conditions, discard the supernatant, and mix the buffer and eggs with 0.35mL left. Use a pipette to absorb the liquid at the bottom of the EP tube and drop it on the sterile area at the edge of the NGM plate, then slightly tilt the plate and rotate it for one week. After about 48h, the fertilized eggs of the nematodes basically develop into L4 larvae, completing synchronization.

[0097] (2) Experimental groups and drug treatment

[0098] For the blank group, 95 μL of E. coli OP50 bacterial solution and 5 μL of M9 buffer solution were mixed and evenly applied. The NGM plate coated with bacteria was sealed after drying in the dark and stored at 4°C for later use. Preparation of drug NGM: 90 μL of E. coli OP50 bacterial solution was mixed evenly with 10 μL of the light wrinkle repair composition containing recombinant collagen prepared in the above application examples 1-10 and comparative application examples 1-6. Use a pipette to draw 120 μL of bacterial solution and gently apply it to the center of each NGM plate.

[0099] (3) Determination of the head shaking frequency of nematodes under excitation

[0100] After 3 days of sample intervention, the nematodes were collected in a 2 mL centrifuge tube to obtain 1 mL of nematode water suspension with 3000 nematodes / mL. 1 mL of neostigmine methylsulfate at a concentration of 0.5 mg / mL was added to the nematode water suspension. After 4 hours of neostigmine methylsulfate treatment, the nematode solution was placed in an NGM plate without food. After the nematodes resumed movement for 1 minute, the number of head swings of each nematode within 30 seconds was observed under a stereomicroscope and recorded. 15 nematodes were selected for each plate for recording, and one maximum and one minimum value were removed from each plate.

[0101] (4) Data processing

[0102] The experiments were carried out in parallel for 3 times, and the data were expressed as mean ± standard deviation. Graph PadPrism 5 software was used for drawing and data processing. The differences between different treatment groups were analyzed by t-test. P < 0.05 indicated significant differences.

[0103] The specific results are shown in Table 1

[0104] Table 1

[0105]

[0106]

[0107] The neural cell system of Caenorhabditis elegans is fully functional, and the genes that control the production, metabolism and transmission of neurotransmitters are highly conserved. The head swing frequency of nematodes is often used as an indicator to analyze their movement behavior. Neostigmine methylsulfate is an anticholinesterase drug that can replace acetylcholine and bind to acetylcholinesterase, thereby causing the accumulation of neurotransmitters and producing neural excitation. After being treated with neostigmine methylsulfate, the movement activity of nematodes is enhanced, showing characteristics such as increased head swing frequency.

[0108] As can be seen from Table 1, the wrinkle repairing composition containing recombinant collagen in Application Examples 1-3 prepared by the present invention can inhibit the head swinging frequency of nematodes by 25.92%-29.19%. Therefore, it can be concluded that the recombinant collagen prepared by the present invention has a certain ability to block nerve impulses between nerves and muscles and resist nerve impulses between nematode nerves and muscles under excitatory stimulation, so that the muscles can relax, thereby achieving the effect of wrinkle reduction.

[0109] Test Example 2

[0110] This test case is used to determine the acetylcholinesterase in nematodes

[0111] Pick synchronized L4 nematodes to the culture medium of each group of blank group, application examples 1-10 and comparative application examples 1-6, and the sample addition amount of each group is 5%. There are about 30 in each plate, and 3 parallels are set in each group. Collect the nematodes after 3 days of drug intervention, collect the nematodes on the plate into a 2mL centrifuge tube with sterile PBS, and centrifuge at low speed to remove the supernatant. Repeat three times and adjust the volume to 1mL, and perform ultrasonic disruption in an ice water bath (ultrasound 3s, interval 3s, working time 3min). Centrifuge at low temperature (4℃, 12 000r / min, 15min), collect the supernatant and place it at 4℃ for testing. The determination of enzyme activity was carried out according to the instructions of the Solebao acetylcholinesterase (AchE) kit of Nanjing Jiancheng Bioengineering Institute.

[0112] Table 2

[0113]

[0114]

[0115] There are neuromuscular synapses in the dorsal and ventral nerve cords of nematodes, and muscle activity is regulated by the excitatory neurotransmitter acetylcholine (Ach). Acetylcholinesterase (AchE) is a key enzyme that can degrade acetylcholine between cholinergic synapses and terminate the excitatory effect of neurotransmitters on the postsynaptic membrane, thereby ensuring the normal transmission of nerve signals in the body. When the activity of the nematode AchE enzyme is inhibited, the Ach accumulated in the nematode cannot be broken down into choline and recycled to the front end of the synapse in time, causing the acetylcholine transmission chain to be blocked, thereby hindering the nematode's movement behavior, reducing the frequency of muscle contraction, achieving muscle relaxation, and achieving anti-wrinkle and line lightening effects.

[0116] From the test results in Table 2, we can see that:

[0117] (1) It can be seen from the comparison between application examples 1-3 and the blank group that the activity of acetylcholinesterase in application examples 1-3 is significantly reduced compared with the blank group, indicating that the wrinkle repairing composition containing recombinant collagen prepared by the present invention can hinder the movement of nematodes, reduce the frequency of muscle contraction, achieve muscle relaxation, and achieve the effect of anti-wrinkle and wrinkle lightening.

[0118] (2) By comparing Application Example 1 with Application Example 4, it can be seen that the lack of palmitoyl pentapeptide-5 will reduce the inhibition of acetylcholinesterase activity.

[0119] (3) By comparing Application Example 1 with Application Examples 5-6, it can be seen that outside the scope of the present invention, the synergistic effect between the components will be reduced, thereby reducing the inhibition of acetylcholinesterase activity.

[0120] (4) It can be seen from the comparison between Application Example 1 and Application Example 7 that the use of other collagens cannot achieve the good inhibitory effect of the present invention.

[0121] (5) By comparing Application Example 1 with Application Examples 8-10, it can be seen that using a temperature outside the range specified by the present invention and using one-time mixing will reduce the activity of each raw material, thereby reducing the synergistic effect.

[0122] (6) By comparing Application Example 1 with Comparative Application Examples 1-6, it can be seen that the acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide, recombinant collagen and palmitoyl pentapeptide-5 in the present invention have a very obvious synergistic effect. The lack of any one of the components or the use of only some of the components will greatly reduce the effect.

[0123] Test Example 3

[0124] This test case performs a cell scratch test

[0125] The wrinkle repair compositions containing recombinant collagen prepared in Application Examples 1-10 and Comparative Application Examples 1-6 were diluted into 5% concentration solutions with a culture medium containing 2% serum. The blank control group was a culture medium containing 2% serum, and the positive control group was a culture medium containing 10% serum.

[0126] BJ cells in the logarithmic growth phase were seeded into 24-well plates at a seeding density of 2.5 × 10 5 / well. Place in a 37℃ carbon dioxide incubator and culture for 24h. When the cells are basically full, use the tip of the pipette to draw a cross in the 24-well plate, then wash once with PBS, add the diluted samples to the wells, add 500μL to each well, and place in a 37℃ carbon dioxide incubator to culture until the observation time set in the experiment. At the set time, observe and measure the width of the scratch with a microscope and take pictures. The specific results are shown in Table 3.

[0127] The calculation formula of scratch healing rate is as follows:

[0128]

[0129] Table 3

[0130]

[0131]

[0132] The results are shown in the figure. Figure 1 This is the scratch image of Application Example 1. Figure 2 This is a scratch image of comparative application example 1. It can be seen that in application example 1, most of the cells healed, while after the cells were treated in comparative application examples 1-6, the healing was poor, and obvious scratches were still seen after 24 hours, proving that the wrinkle repair composition containing recombinant collagen of the present invention can significantly promote cell growth.

[0133] Test Example 4

[0134] This test case is a skin wrinkle improvement test

[0135] The specific test method is:

[0136] 160 women with aging skin aged 30-40 years old were selected and randomly divided into 16 groups, with 10 people in each group. The wrinkle repairing compositions containing recombinant collagen of Application Examples 1-10 and Comparative Application Examples 1-6 were used respectively, with a concentration of 0.5%. The subjects were required to use it continuously, applying it on the face twice a day in the morning and evening, for 90 consecutive days. A return visit was required on the 30th day (D30) and the 90th day (D90) of the trial, and the number and length of facial wrinkles were counted by the same subject and the same measurement personnel, and the improvement of skin wrinkles was counted according to the evaluation criteria.

[0137] Evaluation criteria:

[0138] 10 points, no wrinkles;

[0139] 7-9 points, 2-3 wrinkles, less than 1.5cm in length;

[0140] 4-6 points, 3-6 wrinkles, less than 3cm in length;

[0141] 1-3 points: there are several main wrinkles, the length of which is greater than 4 cm, accompanied by shallow wrinkles.

[0142] Table 4

[0143]

[0144]

[0145]

[0146] The results are shown in Table 4. The wrinkle repairing composition containing recombinant collagen prepared by the present invention can effectively reduce fine lines and reduce the occurrence of wrinkles.

[0147] Test Example 5

[0148] This test case performs security testing

[0149] The specific evaluation method is: to conduct the test in accordance with the human skin patch test method in Chapter 7 Human Safety Test Methods in the "Technical Specifications for Safety of Cosmetics 2015 Edition". (1) Female volunteers aged 18-60 years who met the experimental requirements were selected. Exclusion criteria: (a) those who used antihistamines in the past week or immunosuppressants in the past month; (b) those who used any anti-inflammatory drugs on the test site in the past two months; (c) those who had inflammatory skin diseases that had not been cured clinically; (d) those with insulin-dependent diabetes; (e) those who were receiving treatment for asthma or other chronic respiratory diseases; (f) those who had received anti-cancer chemotherapy in the past 6 months; (g) those with immunodeficiency or autoimmune diseases; (h) breastfeeding or pregnant women; (i) those who had bilateral mastectomy and bilateral axillary lymph node resection; (n) those whose skin scars, pigmentation, atrophy, port wine stains or other blemishes on the test site affected the determination of the test results; (o) those who participated in other clinical trial researchers; (p) those with highly sensitive constitutions; (q) those who were not volunteers or could not complete the required content according to the experimental requirements.

[0150] (2) Each example corresponds to a group of 8 volunteers; the selected area does not exceed 40mm 2 , a qualified spot test device with a depth of about 1.2mm. Add the composition prepared in each embodiment to the small chamber of the spot tester, with an amount of about 0.1g. The control well is blank without any substance. Apply the spot tester with the test substance to the back or forearm of the subject with a low-allergenic tape, and press it lightly with the palm of your hand to evenly apply it to the skin for 24 hours. (3) Observe the skin reaction according to the standards in Table 7 30 minutes (after the indentation disappears), 24 hours and 48 hours after removing the spot tester of the test substance. And evaluate according to the standards in Table 4.

[0151] Table 4

[0152]

[0153]

[0154] The results show that the composition prepared by the present invention is safe for human use and is not likely to cause allergic reactions such as erythema and herpes.

[0155] In summary, the present invention provides a wrinkle repairing composition containing recombinant collagen, which includes acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide, palmitoyl pentapeptide-5 and recombinant collagen. The various ingredients cooperate with each other and synergistically enhance the effect, which can effectively inhibit the formation of wrinkles.

[0156] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A wrinkle repairing composition containing recombinant collagen, characterized in that: The wrinkle lightening and repairing composition comprises acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and recombinant collagen.

2. The wrinkle lightening repair composition according to claim 1, characterized in that: The repair and anti-aging composition comprises, by weight, 3-5 parts of acetyl hexapeptide-8, 3-5 parts of dipeptide diaminobutyryl benzylamide diacetate, 0.05-0.4 parts of arginine / lysine polypeptide and 0.05-1 parts of recombinant collagen.

3. The wrinkle repairing composition according to any one of claims 1 or 2, characterized in that: The nucleic acid sequence of the recombinant collagen is shown as SEQ ID No.

1.

4. The wrinkle lightening repairing composition according to any one of claims 1 to 5, characterized in that: The wrinkle repairing composition further comprises palmitoyl pentapeptide-5.

5. The wrinkle lightening repairing composition according to claim 4, characterized in that: The wrinkle lightening and repairing composition further comprises 0.5-2 parts by weight of palmitoyl pentapeptide-5.

6. A method for preparing a wrinkle-lightening and repairing composition containing recombinant collagen according to any one of claims 1 to 5, characterized in that: The preparation method comprises the following steps: mixing acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and recombinant collagen to obtain the wrinkle lightening and repairing composition.

7. The method for preparing the wrinkle lightening and repairing composition containing recombinant collagen according to claim 6, characterized in that: The preparation method comprises the following steps: mixing acetyl hexapeptide-8, dipeptide diaminobutyryl benzylamide diacetate, arginine / lysine polypeptide and palmitoyl pentapeptide-5 for the first time, and then adding recombinant collagen for the second mixing.

8. The preparation method according to claim 7, characterized in that: The temperature of the first mixing is 18-20°C; Preferably, the temperature of the second mixing is 4-6°C.

9. Use of the wrinkle-lightening and repairing composition containing recombinant collagen according to any one of claims 1 to 5 in the preparation of cosmetics.

10. The use according to claim 9, characterized in that: The cosmetics include essence, lotion, emulsion, cream, cleanser or mask; Preferably, the mass percentage of the anti-wrinkle composition containing full human collagen in the cosmetic is 0.4-0.6%.

Images