Application of flufenamic acid in preparation of medicine for treating peripheral nerve adhesion diseases

Abstract

The invention provides an application of flufenamic acid in preparation of a medicine for treating peripheral nerve adhesion diseases, relates to the technical field of biomedicine, and adopts the technical scheme that the application of the flufenamic acid (2-(3-trifluoromethylaniline) benzoic acid) in preparation of the medicine for treating the peripheral nerve adhesion diseases is provided. The peripheral nerve adhesion diseases comprise sciatic nerve adhesion. The invention provides an application of flufenamic acid in preparation of drugs for treating peripheral nerve adhesion diseases, and a specific verification experiment proves that 2-(3-trifluoromethylanilino) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively promote the movement balance ability and nerve conduction rate of mice, promote the recovery of adhered nerves, and can be used for preparing drugs for treating peripheral nerve adhesion diseases. The positive treatment effect on peripheral nerve adhesion diseases is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to application of flufenamic acid in preparing medicines for treating peripheral nerve adhesion diseases. Background Art

[0002] The peripheral nervous system is widely distributed in the body and plays a role in signal transmission between target organs and the central nervous system. Peripheral nerve injury and adhesion are common clinical symptoms, especially in the case of accidental trauma such as traffic accidents, wars, earthquakes, etc., where nerves and muscles at the injured site are adhered to each other, resulting in the inability to transmit nerve impulses.

[0003] In the prior art, treatment options for peripheral nerve injury adhesions include general treatment, drug therapy, physical therapy, surgical treatment, and rehabilitation therapy, which aim to promote nerve repair, reduce adhesions, restore function, and improve the patient's quality of life. Peripheral nerve injury adhesions are serious hazards, and it is necessary to find targeted drugs. Summary of the invention

[0004] The purpose of the present application is to provide a drug for treating adhesions caused by peripheral nerve injury.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The invention discloses an application of flufenamic acid (2-(3-trifluoromethylanilino)benzoic acid) in preparing a medicine for treating peripheral nerve adhesion diseases.

[0007] Preferably, the peripheral nerve adhesion disease includes sciatic nerve adhesion.

[0008] Preferably, the flufenamic acid promotes motor balance ability and nerve conduction rate.

[0009] Preferably, the flufenamic acid is used to reduce nerve adhesion and alleviate muscle atrophy.

[0010] The present application also provides a medicine for treating peripheral nerve adhesion diseases, wherein the medicine contains flufenamic acid.

[0011] Preferably, the drug is one of an injection / powder or a capsule.

[0012] Compared with the prior art, this application has the following beneficial effects:

[0013] The present application provides the use of flufenamic acid in the preparation of a drug for treating peripheral nerve adhesion diseases. The present application proves through specific verification experiments that 2-(3-trifluoromethylanilino)benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively promote the motor balance ability and nerve conduction rate of mice, promote the recovery of adhesion nerves, and have a positive therapeutic effect on peripheral nerve adhesion diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 A comparison photo of the degree of nerve adhesion between the experimental group and the control group in one embodiment of the present invention;

[0015] Figure 2 A comparison photo of muscle atrophy between the experimental group and the control group in one embodiment of the present invention;

[0016] Figure 3 This is a diagram of a rotarod test of an experimental group and a control group in one embodiment of the present invention;

[0017] Figure 4 This is a comparison diagram of electrophysiological detection between the experimental group and the control group in one embodiment of the present invention;

[0018] Figure 5 A comparison chart of the neurological function index between the experimental group and the control group in one embodiment of the present invention;

[0019] Figure 6 A comparison diagram of myelin sheath structures between the experimental group and the control group in one embodiment of the present invention;

[0020] Figure 7 A schematic diagram showing that 2-(3-trifluoromethylanilino)benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) is beneficial to the development and repair of the myelin sheath of the sciatic nerve of mice in one embodiment of the present invention;

[0021] Figure 8 This is a comparison chart of related RNA expression levels in one embodiment of the present invention. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with specific embodiments.

[0023] The invention discloses an application of flufenamic acid (2-(3-trifluoromethylanilino)benzoic acid) in preparing a medicine for treating peripheral nerve adhesion diseases, wherein the peripheral nerve adhesion diseases include sciatic nerve adhesion.

[0024] The chemical formula of flufenamic acid is C 14 H 10 F3NO2, its structural formula is as follows:

[0025]

[0026] In one embodiment, the flufenamic acid promotes motor balance and nerve conduction rate.

[0027] The flufenamic acid is used to reduce nerve adhesion and alleviate muscle atrophy.

[0028] Based on the application of flufenamic acid, the present application also provides a medicine for treating peripheral nerve adhesion diseases, wherein the medicine contains flufenamic acid and is an injection or a powder.

[0029] The above contents are explained below in combination with specific verification experiments.

[0030] Since the sciatic nerve is the most important and intuitive material for studying peripheral nerve adhesion, the sciatic nerve was used in the subsequent experiments in this application.

[0031] Experimental Materials:

[0032] 2-(3-Trifluoromethylanilino)benzoic acid (flufenamic acid, FFA, CAS: 530-78-9), bovine serum albumin, glutaraldehyde, and DMSO were purchased from Sigma, real-time quantitative PCR dye was purchased from Roche Biotechnology, and primers were from Shanghai Sangon Biotechnology Co., Ltd.

[0033] Example 1: Construction of sciatic nerve adhesion model:

[0034] The mice used in this application were 8-week-old ICR mice purchased from the Animal Center of Nanjing University. The model was constructed as follows:

[0035] The mice were anesthetized by subcutaneous injection of 3% sodium pentobarbital (1 mL / kg). The skin below the buttocks was incised, and the muscles were bluntly dissected with fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh.

[0036] 20 μL of adhesion agent (45% bovine serum albumin + 12% glutaraldehyde) was dropped between the sciatic nerve and the muscle to construct the sciatic nerve adhesion model.

[0037] Drug experimental group: intraperitoneal injection of 12.5 μg / g flufenamic acid (FFA) for 7 consecutive days;

[0038] Control group: 20 μL DMSO was injected intraperitoneally for 7 consecutive days.

[0039] All animal experimental protocols were approved by the Animal Care and Utilization Committee of Nantong University and the Animal Protection and Ethics Committee of Jiangsu Province. The establishment of the mouse sciatic nerve adhesion model was performed in accordance with the approved guidelines.

[0040] Example 2: Observation of adhesion and muscle atrophy in mice:

[0041] Six weeks after the model was established, the adhesion and muscle atrophy of the sciatic nerve of the control group mice and the drug experimental group mice were compared to clarify the effect of flufenamic acid (FFA) on nerve adhesion in mice. 3% sodium pentobarbital (1 ml / kg) was injected subcutaneously for anesthesia. The skin below the buttocks was cut, the skin and muscle tissue were separated, and the phenotypic differences between the two groups of mice were directly observed.

[0042] See also Figure 1 and Figure 2 , 2-(3-trifluoromethylanilino)benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively reduce the degree of nerve adhesion and alleviate muscle atrophy

[0043] Example 3: Animal behavior testing:

[0044] In order to clarify the effect of FFA on motor recovery in mice with sciatic nerve adhesion, we performed rotarod test, electrophysiological experiment and gait test.

[0045] The specific experimental steps are as follows:

[0046] Rotarod test: An accelerating rotarod apparatus (model LE8500, Pan Laboratory) was used. Before the test, mice were habituated to the test room for 30 minutes. The mice were gently placed on the rotarod by gently shaking them, and trained on the rotarod in an accelerating mode (4-40 rpm) at intervals of 3 and 5 minutes for 3 days. The training was repeated at a constant speed (16 rpm) until the mice were able to stay on the rod for at least 300 seconds. For the formal test, the mice were placed on a rotating drum and the rotarod was set to an accelerating mode, i.e., accelerating at a speed of 4 to 40 rpm within 5 minutes. The time spent moving on the rotarod was recorded before the fall was measured.

[0047] Gait experiment: The gait dynamics of quadrupeds were evaluated by footprint analysis of mice using the Digigait imaging system, and the stride length of the hind limbs was assessed at a speed of 8 cm / s. The footprints were analyzed by the following four measurements: distance to the contralateral foot, footprint length, maximum toe extension between the first and fifth toes, and paw extension between the center of the second and fourth toes.

[0048] Electrophysiological experiments: In this study, mice were anesthetized with a combined anesthetic. Then, the conduction velocity (NCV) was measured using an electromyographic device (NeuropackS1 MEB-9402, Nihon-Kohden, Tokyo, Japan). A needle electrode was inserted into the gastrocnemius muscle of the mouse, and the ground electrode was clamped on the exposed skin. The stimulus intensity was gradually increased from 0.1 mA to 3.0 mA to trigger the waveform. Stimulation was performed at a frequency of 1 Hz for 1 ms. The corresponding data were recorded for further analysis. The body temperature of the mice was maintained at 37 °C ± 0.5 °C using a heating lamp throughout the experiment.

[0049] The results of motor behavior analysis showed that the motor balance ability and nerve conduction velocity of mice treated with FFA were better restored and the nerve conduction velocity was faster ( Figure 3-5 ).

[0050] Example 4: Electron microscopic observation of sciatic nerve tissue

[0051] In order to further clarify the protective effect of FFA on sciatic nerve tissue, the sciatic nerve myelin tissue of mice in different groups was observed by transmission electron microscopy in this application. The specific steps are as follows:

[0052] Three mice with sciatic nerve adhesion for 6 weeks were randomly selected from different groups (FFA treatment group and control group). Under deep anesthesia, the sciatic nerve tissue at the adhesion site was taken and cut into electron microscope specimen size (1.2mm x1 mmx1 mm), immersed in 4% glutaraldehyde solution for fixation, and fixed with 1% osmium acid for secondary fixation, uranyl acetate staining, gradient ethanol dehydration, epoxy resin embedding, semi-thin section positioning, ultra-thin section counterstained with lead citrate, and transmission electron microscope selection for observation. The obtained photos were used to measure the myelinated nerve diameter and axon diameter on the instrument's built-in image analysis system, and the axon diameter / myelinated nerve diameter value (g-ratio) was used to measure the myelin sheath thickness, thereby deriving the protective effect of FFA on damaged nerves.

[0053] See also Figure 6 and Figure 7 After drug treatment, the structure of the adhesion nerve myelin sheath is more orderly and the new nerve myelin sheath is thicker.

[0054] Example 5: Detection of immune factor expression:

[0055] Long-term neuroinflammation is an important factor affecting the recovery of nerve adhesions. In order to confirm the biological mechanism of FFA in regulating sciatic nerve adhesions, this application analyzed the effect of FFA on the expression of inflammatory factors.

[0056] The specific steps are as follows:

[0057] Total RNA from sciatic nerve tissue was extracted using Invitrogen's Trizol reagent, and the first-strand cDNA was synthesized using Roche's reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix, and the instrument was Bio-Rad's iQ5 Multicolor Real-Time PCR Detection System. The analysis results were analyzed using 2 -△△Ct mRNA levels were calculated using the 18S housekeeping gene. The primer sequences used were as follows:

[0058] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

[0059] 18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

[0060] IL1α forward primer: GTGTTGCTGAAGGAGTTG

[0061] IL1α negative primer: ATCTGGAAGTCTGTCATAGAG

[0062] IL12α forward primer: TTCTCCCATCACATCTCATC

[0063] IL12α negative primer: TGCTCTTCTGCTAACACAT

[0064] TNFα forward primer: GCTTTCAACAACTACTCAGAA

[0065] TNFα negative primer: GATCTTATCCAGCCTCATTCT

[0066] The results are as follows Figure 8 As shown, FFA can effectively inhibit the expression of pro-inflammatory factors, significantly inhibit the occurrence and development of inflammation, maintain the immune microenvironment, and facilitate nerve recovery.

[0067] In summary, the present application provides the use of flufenamic acid in the preparation of drugs for treating peripheral nerve adhesion diseases. The present application proves through specific verification experiments that 2-(3-trifluoromethylanilino)benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively promote the motor balance ability and nerve conduction rate of mice, promote the recovery of adhesion nerves, and have a positive therapeutic effect on peripheral nerve adhesion diseases.

Claims

1. The application of flufenamic acid (2-(3-trifluoromethylanilino)benzoic acid) in the preparation of drugs for treating peripheral nerve adhesion diseases.

2. The use of flufenamic acid according to claim 1 in the preparation of a medicament for treating peripheral nerve adhesion diseases, characterized in that: The peripheral nerve adhesion diseases include sciatic nerve adhesion.

3. The use of flufenamic acid according to claim 1 in the preparation of a medicament for treating peripheral nerve adhesion diseases, characterized in that: The flufenamic acid promotes motor balance and nerve conduction rate.

4. The use of flufenamic acid according to claim 1 in the preparation of a medicament for treating peripheral nerve adhesion diseases, characterized in that: The flufenamic acid is used to reduce nerve adhesion and alleviate muscle atrophy.

5. A drug for treating peripheral nerve adhesion diseases, characterized in that: The medicine contains flufenamic acid.

6. A drug for treating peripheral nerve adhesion diseases according to claim 5, characterized in that: The medicine is one of injection / powder or capsule.

Images