Cell for expressing anti-H7 subtype avian influenza virus recombinant monoclonal antibody and screening method thereof

Abstract

The invention belongs to the field of biological pharmacy, and particularly relates to a cell for expressing an anti-avian influenza virus recombinant monoclonal antibody and a screening method of the cell. The CHO-S r1H9-1C3 cell provided by the invention can stably express a recombinant antibody of the HA protein of the H7N9 subtype avian influenza virus, wherein the recombinant monoclonal antibody R1H9-1C3 can be effectively combined with the HA protein of the H7 subtype avian influenza virus. The recombinant antibody provided by the invention has similar biological activity with a parent antibody, and proves that the R1H9-1C3 antibody expressed in vitro can replace the parent antibody in diagnosis or basic research.

Description

Technical Field

[0001] The invention belongs to the field of biopharmaceuticals, and in particular relates to a cell expressing anti-avian influenza virus recombinant monoclonal antibody and a screening method thereof. Background Art

[0002] Avian influenza virus (AIV) belongs to the family of Orthomyxoviridae. Its main feature is its wide host range. Avian influenza virus has a wide range of hosts. Chickens, turkeys, ducks, geese, quails, pheasants, partridges, ostriches, peacocks and other poultry are susceptible. Many wild birds can also be infected and even die. Occasionally, it can also infect mammals such as seals, whales, minks, tigers, foxes, cats and humans. According to the antigenic characteristics of the virus surface glycoprotein hemagglutinin (HA) and neuraminidase (NA), it can be further divided into 16 H subtypes (H1-H16) and 9 N subtypes (N1-N9); there are also new subtypes confirmed from bats (H17 and H18). AIV is divided into highly pathogenic avian influenza virus (HPAIV) and low pathogenic avian influenza virus (LPAIV) according to the different pathogenicity of the virus. So far, HPAIV that cause acute clinical symptoms in chickens, turkeys and other economic poultry are all H5 or H7 subtypes, but not all H5 or H7 subtypes are highly pathogenic. Some H5 and H7 subtype influenza viruses are not highly pathogenic, and these viruses have the risk of becoming highly pathogenic viruses through mutation. The World Organization for Animal Health (WOAH) lists highly pathogenic avian influenza (HPAI) and low pathogenic avian influenza (LPAI) caused by low pathogenic avian influenza viruses whose virulence suddenly increases in poultry or can be naturally transmitted to humans and cause serious consequences as notifiable animal diseases.

[0003] Highly pathogenic H7 subtype avian influenza viruses can cause severe clinical lesions in infected poultry, with high mortality, and have a devastating impact on the poultry industry. According to data reported by the World Organization for Animal Health (OIE-WAHIS), between January 2005 and November 2022, various H7 subtype highly pathogenic avian influenza viruses caused 106 outbreaks worldwide, occurring in 10 countries in Asia, Europe, North America and Oceania, including Australia, Canada, Mexico, the United States, North Korea, China, the United Kingdom, Spain, Italy and Germany, killing more than 33 million poultry. In addition to outbreaks in poultry, causing huge losses to the poultry industry, H7 subtype avian influenza viruses can also cross host boundaries and infect mammals, especially humans, causing severe respiratory diseases and even death.

[0004] The transmembrane glycoprotein hemagglutinin protein (HA) on the surface of the H7 subtype avian influenza envelope is the main immunogenic antigen of influenza virus. As the main surface antigen of influenza virus, HA protein contains receptor recognition sites and antigenic determinants on the surface. It is the key site for virus to recognize and bind to receptors. It can also induce the body to produce neutralizing antibodies. It is an important target protein for subtype determination and antigen variation research. In the detection process, the high specificity and high sensitivity of monoclonal antibodies are often used to establish flow immunochromatography, immunofluorescence, hemagglutination inhibition (HI), enzyme-linked immunosorbent assay and other methods to perform clinical detection and diagnosis of AIV antigen or antibody samples. Monoclonal antibodies are of great significance in the development of diagnostic reagents. Specific monoclonal antibodies can also be used in basic research on viral transcription, replication, antigen variation mechanism, etc., which is of great significance. However, monoclonal antibodies prepared by classical hybridoma technology need to rely on purification from mouse ascites, the antibody yield is generally low, and there are differences in yield and quality between batches. Therefore, there are many advantages in converting hybridoma monoclonal antibodies into recombinant antibodies through molecular cloning technology. Once the antibody sequence is obtained, it can be produced in a recombinant expression system without the need for host animals, avoiding the use of experimental animals and complying with relevant regulations on animal welfare. The monoclonal antibodies produced have high batch consistency and reproducibility, which can avoid subtle changes in antibody production caused by genetic drift in hybridoma cell lines. Another advantage of recombinant antibodies is the potential for increased reagent versatility. With the primary amino acid sequence, researchers can fuse the gene to other molecules, such as fluorophores, to generate customized tools with multiple functions. Summary of the invention

[0005] The present invention firstly uses the traditional hybridoma technology to obtain the monoclonal antibody hybridoma cell against the HA protein of the H7N9 sub-avian influenza virus, and on this basis, selects a hybridoma cell with good antibody secretion for sequencing, obtains the complete light chain and heavy chain sequences, and clones them into the pCHO-1.0 expression vector. The HC and LC expression plasmids are transfected into CHO-S cells. By adding different concentrations of methotrexate and puromycin for two-phase selection, a stable expression cell line is obtained, and the present invention is completed accordingly.

[0006] In a first aspect, the present invention provides a cell that can stably express a recombinant monoclonal antibody against an antiviral protein. The cell is obtained by detecting the heavy chain and light chain gene sequences of the antiviral monoclonal antibody in hybridoma cells, cloning them into an expression vector, and transfecting them into CHO-S cells to obtain a cell that stably expresses a recombinant monoclonal antibody against an antiviral protein (recombinant monoclonal antibody). The cell is named: CHO-S r1H9-1C3, and the accession number is: CGMCC NO.45828.

[0007] In a second aspect, the present invention provides a method for screening cells that stably express recombinant monoclonal antibodies against avian influenza virus proteins, the screening method comprising the following steps:

[0008] S1. After immunizing mice with purified avian influenza virus protein, the spleen of the immunized mice was fused with myeloma cells, and positive hybridoma cells were screened using the ELISA test method;

[0009] S2. Prepare antibodies using the hybridoma cells obtained in S1, and screen the monoclonal antibody with the highest titer using the HI test method;

[0010] S3. Sequencing the monoclonal antibody obtained in S2, using 5'Race and 3'Race methods to amplify the full-length fragments of the heavy chain and light chain, and sequencing to obtain the complete sequence;

[0011] S4. Codon optimization was performed on the base sequences of the heavy and light chains of the antibody measured in S3, and the optimized synthesized fragments were cloned into the expression vector, transfected into cells, and a cell line expressing the recombinant monoclonal antibody was obtained by two-phase selection by adding different concentrations of methotrexate and puromycin.

[0012] S5. The cell line expressing the recombinant monoclonal antibody is further subcultured, and the expression level of the antibody in the cell supernatant after subculture is detected to screen out the cell line with stable expression.

[0013] Furthermore, in step S1, the avian influenza is an H7 subtype avian influenza virus.

[0014] Furthermore, the H7 subtype avian influenza virus includes various H7 subtype avian influenza viruses that are typed according to HA gene sequences.

[0015] Furthermore, in step S1, the purified protein of the immunized mice is H7 subtype avian influenza virus HA protein.

[0016] Preferably, the purified protein of the immunized mice is the purified HA protein of the H7N9 subtype CK / SD008 strain.

[0017] Further, in step S3, the monoclonal antibody heavy chain variable region germline is IGHV3, including three complementary determining regions (CDR1, CDR2, CDR3), and its amino acid sequence is shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; the monoclonal antibody light chain variable region germline is IGKV15, including three complementary determining regions (CDR1, CDR2, CDR3), and its amino acid sequence is shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0018] Further, in step S4, the expression vector is a eukaryotic expression vector, and the transfected cell is a eukaryotic cell.

[0019] Preferably, the eukaryotic expression vector is pCHO-1.0, and the eukaryotic cell is Chinese hamster ovary cell CHO-S.

[0020] Furthermore, in step S5, the method for detecting the expression level of the antibody includes ELISA and HI.

[0021] The stably expressed cell CHO-S r1H9-1C3 in the present invention has been provided with a biological deposit to the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The name of the deposit is: Chinese hamster ovary cell stable expression cell line (Mesocricetusauratus), CHO-S r1H9-1C3, deposit number: CGMCC NO.45828, and the deposit date is March 20, 2024.

[0022] Beneficial Effects

[0023] 1. The CHO-S r1H9-1C3 cell line provided by the present invention can stably express recombinant antibodies against the HA protein of the H7N9 sub-avian influenza virus, and the heavy chain and light chain and gene sequences of the antibody are obtained by sequencing active hybridoma cells.

[0024] 2. The recombinant monoclonal antibody R1H9-1C3 of the present invention can effectively bind to the HA protein of the H7 subtype avian influenza virus.

[0025] 3. The recombinant antibody of the present invention has similar biological activity to the parent antibody, which proves that the R1H9-1C3 antibody expressed in vitro can replace the parent antibody in diagnosis or basic research. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a schematic diagram of the structure or process flow of the present invention.

[0027] Figure 2 This is a stability test for the CHO-S r1H9-1C3 cell line.

[0028] Figure 3 This is the SDS-PAGE experiment of the purified recombinant antibody R1H9-1C3.

[0029] Figure 4 This is a hemagglutination inhibition experiment of the recombinant monoclonal antibody R1H9-1C3 expressed by CHO-S r1H9-1C3.

[0030] Figure 5 This is an immunoblotting experiment of recombinant monoclonal antibody R1H9-1C3 expressed by CHO-S r1H9-1C3. (Note: Lane M: protein marker)

[0031] Figure 6 Confocal microscopy experiment of CHO-S r1H9-1C3 expressing recombinant monoclonal antibody R1H9-1C3.

[0032] Figure 7 This is an SPR experiment of recombinant monoclonal antibody R1H9-1C3 expressed in CHO-S r1H9-1C3.

[0033] Figure 8 The biological activity of the recombinant monoclonal antibody R1H9-1C3 expressed by CHO-S r1H9-1C3 in ELISA. DETAILED DESCRIPTION

[0034] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0036] Explanation of terms

[0037] Hemagglutinin (HA) protein: It is a type I glycoprotein and the most abundant antigen protein on the AIV capsule. It includes four domains: signal peptide, cytoplasmic domain, transmembrane domain and extracellular domain. It can specifically bind to the receptors on the surface of the virus and induce the body to produce neutralizing antibodies.

[0038] Neuraminidase (NA): It is a type II glycoprotein, second only to HA in abundance on the AIV envelope. It is another major antigenic protein on the surface of the viral envelope. It has sialidase activity and is an important protein for viral infection of cells. M1 is the main structural protein of AIV, plays a vital role in maintaining the structure of the virus, and is the main target protein recognized by host T cells during viral infection.

[0039] Immunogenicity: It is an important evaluation parameter for vaccine candidate strains. Inducing the body to produce high-titer specific neutralizing antibodies is an important indicator for the vaccine to play a preventive and protective role.

[0040] Freund's Adjuvant Complete: An oil-in-water emulsion that is very effective in inducing high titer antibodies. Freund's Adjuvant Complete contains cell wall components of Mycobacterium tuberculosis that enhance the antibody response to the antigen. The adjuvant activity comes from the sustained release of the immunogen in the oil droplets, which stimulates the local immune response.

[0041] Heavy Chain: The type of heavy chain defines the class of antibody. There are five types of mammalian Ig heavy chains, represented by the Greek letters: α, δ, ε, γ, and μ. These heavy chains are found in IgA, IgD, IgE, IgG, and IgM antibodies. The size and composition of heavy chains vary, with α and γ containing approximately 450 amino acids, and μ and ε containing approximately 550 amino acids. Each heavy chain has two regions: a constant region and a variable region.

[0042] Heavy chain antibody variable region: (variable domain of heavy chain of heavy-chainantibody, VHH) is derived from the heavy chain antibodies naturally present in camelids and sharks. It is the smallest naturally present antibody fragment with antigen binding function found so far, with a relative molecular mass of only 15ku, which is 1 / 10 of the traditional antibody. Since VHH is ellipsoidal, with a height of only 4.8nm and a diameter of only 2.2nm, it is also called nanoantibodies (Nbs). The heavy chain variable regions of antibodies produced by different B cells are different, but the variable regions of all antibodies produced by the same B cell or B cell clone are the same. The variable region of each heavy chain is approximately 110 amino acids long and consists of a single Ig domain.

[0043] Light chain: There are only two types of light chains in mammals, λ and κ. Light chains have two consecutive domains: a constant domain and a variable domain. The length of a light chain is about 211-217 amino acids. The two light chains contained in each antibody are usually identical.

[0044] Hypervariable region: (HVR) In the variable region of immunoglobulin heavy chain and light chain, there are three specific segments in which the amino acid composition and arrangement order are highly variable, called hypervariable regions, represented by HVR1, HVR2 and HVR3. Usually, HVR3 has a higher degree of variation. They are located at amino acids 29-31, 49-58, 95-102 in VH, and amino acids 28-30, 49-59, 92-103 in VL.

[0045] Complementarity determining region: (complementarity determining region, CDR) The three hypervariable regions in VH and VL together constitute the antigen binding site of Ig, which can complementarily bind to the corresponding antigen epitope, so HVR is also called the complementarity determining region, which is represented by CDR1, CDR2 and CDR3 respectively. When the TCR of different cloned T cells is rearranged, the VDJ gene fragments are rearranged and randomly inserted with nucleotides to form a highly variable region called CDR3, which is the region where TCR specifically recognizes antigens. The differences in CDR3 length and base sequence form a variety of TCR CDR3 gene spectra on the surface of T cells.

[0046] Example 1 Preparation of hybridoma cells secreting monoclonal antibodies against HA protein of H7 subtype CK / SD008 strain avian influenza virus

[0047] For the first immunization, 100 μg / mouse of purified whole virus antigen of CK / SD008 strain was emulsified with an equal amount of Freund's complete adjuvant to immunize 6-8 week-old BALB / C SPF mice. Two weeks after the first immunization, the same antigen and adjuvant were used for the second and third immunizations. Two weeks after the last immunization, blood and serum were collected to determine the titer, and the mouse with the highest titer was killed by cervical dislocation.

[0048] Place the sacrificed mice in alcohol for several minutes, fix the mice, remove the spleen and place it in a grinder, grind the spleen thoroughly in 1640 basal culture medium, centrifuge at 1000rpm for 8min, discard the supernatant, blow it apart with 1640 basal culture medium, and place it in a 5% CO2, 37°C incubator.

[0049] By counting 2×10 7SP2 / 0 cells, centrifuged at 1000rpm, 10mL DMEM was blown off and mixed with the separated spleen cells, centrifuged at 1000rpm for 8min, and the supernatant was discarded; 1mL 50% PEG was dripped in 1min, let stand for 40s, and 1640 culture medium was added. Let stand at 37℃ for 5min, centrifuged at 1000rpm for 3min, and the supernatant was discarded; HAT culture medium (containing feeder cell substitute) was mixed with the fused cells and dripped into a 96-well cell plate, 200μL / well, and cultured in a 5% CO2, 37℃ incubator.

[0050] One week after fusion, the medium was replaced with HAT complete medium. Positive hybridoma cells were screened by ELISA and HI test methods. The screened positive well cells were subcloned and tested for at least three rounds until all test wells were positive or determined to be a single cell line.

[0051] Six hybridoma cell lines were screened out, namely: 1H9, 2B3, 4F2, 1G4, 1H3 and 4G4.

[0052] Example 2 Antibody Ascites Preparation and HI Test

[0053] Balb / c mice were intraperitoneally injected with 0.5mL of Freund's incomplete adjuvant. Seven days later, the six hybridoma cells selected above were injected into the mouse peritoneum. The mouse abdomen began to swell 7-10 days later. The mice were killed by dislocating the cervical vertebrae, soaked and disinfected in 75% alcohol for 5 minutes, and the ascites was drawn with a 5mL syringe. Centrifuged at 8000rpm for 10 minutes, and the colorless and transparent middle layer of ascites was drawn. The hemagglutination inhibition test was performed according to the WOAH manual. 25μL of each sample was diluted twice in a 96-well microtiter plate with PBS (pH 7.4). Then 25μL of CK / SD0084HA unit antigen was added and incubated at room temperature. After 30 minutes, 25μL of 1% chicken red blood cells were added to all wells and incubated at room temperature for 40 minutes. The reciprocal of the highest antibody dilution is the HI titer, and the results are shown in Table 1.

[0054] Table 1 HI titer of ascites

[0055]

[0056]

[0057] The results showed that the HI titer of the ascites of the 1H9 monoclonal antibody was the highest, and this monoclonal antibody was selected for subsequent sequencing and recombinant expression.

[0058] Example 3 Sequencing of monoclonal antibody against HA protein 1H9 of CK / SD008 strain of avian influenza virus

[0059] The total RNA of the hybridoma cell 1H9 strain obtained in Example 1 was extracted using a kit and reverse transcribed according to the following reaction system and procedure.

[0060]

[0061] After reverse transcription, PCR amplification was performed, and the reaction system was as follows:

[0062]

[0063] The sequences of the monoclonal antibody heavy chain and light chain primers are shown in Table 2-5:

[0064] Table 2 Monoclonal antibody heavy chain upstream primer sequence SEQ ID No: 7

[0065]

[0066]

[0067] Table 3 Monoclonal antibody light chain upstream primer sequence SEQ ID No: 8

[0068]

[0069] Table 4 Monoclonal antibody light chain downstream primer sequence SEQ ID No: 9

[0070] 18RTCγ CAGGGATCCAKAGTTC

[0071] 17RTCμGATGACTTCAGTGTTGT

[0072] Table 5 Monoclonal antibody light chain downstream primer sequence SEQ ID No: 10

[0073] RTck TCAAGAAGCACACGAC

[0074] The reaction conditions were 98°C for 5 min; 98°C for 30 s, 55°C for 15 min, 72°C for 20 s, 30 cycles; 72°C for 5 min, and insulation at 4°C.

[0075] After amplifying the partial fragments, the 5'Race and 3'Race methods were used to amplify the full-length fragments of the heavy chain and light chain, and the complete sequences were sequenced. (The sequence was analyzed on the https: / / www.ncbi.nlm.nih.gov / igblast / webpage to obtain the rearrangement of the variable regions of the 1H9 heavy chain and light chain antibodies). The germline of the 1H9 monoclonal antibody heavy chain variable region is IGHV3, including three complementary determining regions (CDR1, CDR2, CDR3), and its amino acid sequence is shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; the germline of the 1H9 monoclonal antibody light chain variable region is IGKV15, including three complementary determining regions (CDR1, CDR2, CDR3), and its amino acid sequence is shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0076] SEQ ID NO: 1CDR1GGCTACTCAATCACCAGTGATTATACC

[0077] SEQ ID NO: 2CDR2TGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTAC

[0078] SEQ ID NO: 3CDR3GCAAGATCCGATGGCTGGTACGGTTTTGCTTAC

[0079] SEQ ID NO: 4CDR1CAGAACATTAATGTTTGG

[0080] SEQ ID NO: 5CDR2AAGGCTTTC

[0081] SEQ ID NO: 6CDR3CAACAGGGTCAAACTTATCCGTTCACG

[0082] Example 4 Establishment of a stable expression cell line of the recombinant antibody r1H9 and purification of the recombinant monoclonal antibody R1H9-1C3

[0083] The measured base sequences of the heavy and light chains of the antibody were codon optimized, including GC content, codon usage frequency and RNAse splicing sites. The optimized synthesized fragments were cloned into the pCHO-1.0 expression vector, electroporated and transfected into CHO-S cells, and a negative control was set up. The cells were screened for 7 days in a medium containing 10 μg / mL and 20 μg / mL puromycin. Then, 100nM, 200nM, 300nM, 400nM, 500nM, 600nM, 700nM, 800nM, 900nM, and 1000nM of methotrexate were used for pressure screening, and the cells were treated with different concentrations of drugs for 7 days. Fresh culture medium was replaced every three days during the screening period. After the pressure screening, the cell population was inoculated into a 96-well plate at a concentration of 1 cell per well and expanded after 14 days. A cell line expressing recombinant antibodies was obtained and named CHO-S r1H9-1C3. The cell line CHO-S r1H9-1C3 was subcultured to the 3rd, 5th, 7th, 9th, 11th, 13th, and 15th generations. The suspension culture supernatant was taken for indirect ELISA experiment. The antigen coating amount was 5 μg / mL to detect the expression level of antibodies in the cell supernatant. Positive cells were inoculated into a concentration of 5×10 5 cells / mL of culture medium, glucose was controlled at 6 g / L. Suspended for 10 days. The cell culture supernatant was purified on the AKTA system using HiTrap Protein G HP antibody purification column, and the purified cells were detected by WB. The expressed recombinant monoclonal antibody was named R1H9-1C3.

[0084] like Figure 2 As shown, the OD value of the indirect ELISA experiment of the cell supernatant was between 2.1 and 2.5 when the cells were passaged to passage 15, and the antibody expression level was still maintained, proving that the cell line CHO-S r1H9-1C3 is a stable expression cell line.

[0085] like Figure 3 As shown, the SDS-PAGE results showed that the recombinant monoclonal antibody R1H9-1C3 was successfully expressed.

[0086] Example 5 Detection of hemagglutination inhibition activity of recombinant monoclonal antibody R1H9-1C3 against CK / SD008HA protein

[0087] Hemagglutination inhibition test was performed according to the WOAH manual (WOAH 2021). 25 μL of each R1H9-1C3 antibody and 1H9 antibody were diluted twice with PBS (pH 7.4) in a 96-well microtiter plate. Then 25 μL of CK / SD0084 HA unit antigen was added and incubated. After 30 min, 25 μL of 1% chicken red blood cells were added to all wells and incubated for 40 min. The reciprocal of the highest antibody dilution was the HI titer.

[0088] like Figure 4 As shown, the HI titer of the 1H9-1C3 recombinant antibody at an initial concentration of 0.5 mg / ml against the H7 subtype avian influenza antigen was 2 7 , indicating that the expressed recombinant monoclonal antibody has good hemagglutination inhibition activity.

[0089] Example 6 Western blotting test to detect the binding ability of recombinant monoclonal antibody R1H9-1C3 and CK / SD008HA protein

[0090] The purified CK / SD008 protein was treated with RIPA lysis buffer, mixed with 4× Protein Native PAGE Loading buffer, separated by polyacrylamide gel electrophoresis, and then analyzed by eBlot. TM L1 was transferred to a nitrocellulose (NC) membrane. ExpressPlusTM PAGE gel was selected for polyacrylamide gel. After blocking, the NC membrane was blocked with 5% skim milk at 37°C for 1 h and incubated with purified 1H9 and R1H9-1C3 antibodies at 4°C overnight. 800CW goat anti-mouse IgG was incubated at room temperature for 1 h and scanned and analyzed using the Odyssey C LX infrared imaging system.

[0091] The results showed that the recombinantly expressed antibodies, like the antibodies produced by hybridomas, could bind to the non-denatured H7 subtype influenza virus HA protein, such as Figure 5 shown.

[0092] Example 7 Detection of the binding ability of recombinant monoclonal antibody R1H9-1C3 with CK / SD008HA protein using confocal microscopy

[0093] HEK-293T cells in culture dishes were transfected with PCAGGS-CK / SD008-HA-Flag plasmid (1.5 μg) and PCAGGS empty vector. After 36 h of transfection, cells were fixed with 4% tissue fixative at 4 °C overnight and then permeabilized with 0.1% Triton X-100 for 30 min at room temperature. Cells were blocked with 5% BSA in PBS for 1 h and then incubated with 1 μg / mL 1H9, RH9-1C3 antibodies for 1 h at room temperature, while each group of cells was incubated with rabbit monoclonal antibodies against the Flag tag. Cells were washed 3 times with PBS and incubated with Alexa Fluor 488 goat anti-mouse IgG (H+L), Alexa Fluor 633 goat anti-rabbit IgG (H+L) for 1 h at room temperature. After washing three times, cells were incubated with DAPI (4′, 6-diamino-2-phenylindole); (overtime) 15 min to stain the nuclei. Finally, images were captured using a LSM880 confocal microscope.

[0094] like Figure 6 As shown, when the excitation wavelength is 633nm, the positive cells expressing HA protein after transfection show red fluorescence, and when the excitation wavelength is 488nm, the positive cells show green fluorescence, and the red fluorescent cells and green fluorescent cells overlap, indicating that the recombinant antibody R1H9-1C3 can effectively bind to HA protein in the immunostaining experiment, proving that the recombinant antibody R1H9-1C3 can be used in immunostaining experiments.

[0095] Example 8 Surface Plasmon Resonance (SPR) Exploration of the Binding Dissociation Constant of Recombinant Monoclonal Antibodies and Antigens

[0096] SPR analysis was performed on the Biacore 8K platform and sensor chip NTA. The HA protein of CK / SD008 was obtained from the Expi293 expression system, purified by Ni-NTA, and captured on different channels of the NTA chip using the NTAreagent Kit at a density of approximately 300 relative units [RU]. At a flow rate of 30 μl / min, R1H9-1C3 and 1H9 antibodies at concentrations of 0.03125, 0.0625, 0.125, 0.25, and 0.5 μM were flowed for 6 cycles, and the binding kinetics lasted for 180 s. The buffer was then run at a speed of 30 μL / min for 600 s to measure the kinetic constants. After each binding cycle, the same protocol was run. KD values ​​were calculated for all antibodies containing CK / SD008-HA protein on the evaluation software. The smaller the binding force KD value (dissociation constant) of the protein interaction, the stronger the affinity.

[0097] The results showed that the KD values ​​of hybridoma antibody 1H9 and recombinant antibody R1H9-1C3 binding to CK / SD008HA were 12.1 and 9.52, respectively. This proved that the affinity of 1H9 and R1H9-1C3 to HA protein was at the same order of magnitude, and the affinity of recombinant antibody and original antibody was consistent. In addition, the affinity of R1H9-1C3 to HA protein was slightly greater than that of 1H9 antibody to HA protein. Figure 7 shown.

[0098] Example 9 Application of recombinant monoclonal antibody R1H9-1C3 in ELISA

[0099] The recombinant monoclonal antibody was labeled with horseradish peroxidase (HRP) with sodium periodate and set aside. The inactivated purified recombinant avian influenza virus H7N9 subtype CK / SD008 strain whole virus protein was diluted to 5 μg / ml with carbonate buffer (0.05 mol / L, pH 9.6), added to a 96-well enzyme-linked reaction plate, and coated overnight at 4°C. Blocked. The coated plate was incubated with a double gradient of 1 / 100 to 1 / 6400 HRP-labeled R1H9-1C3 (initial concentration of 1 mg / mL) and incubated for 1 hour. After washing three times, tetramethylbenzidine (TMB) substrate was added, incubated in a dark box at 37°C for 10 minutes, and the reaction was terminated with 0.25% HF. OD was read at a wavelength of 630 nm. 630 nm value (the reading should be completed within 5 minutes after adding the stop solution) to test the biological activity of the recombinant antibody in ELISA.

[0100] The results showed that when HRP-R1H9-1C3 was diluted to 1 / 800, the OD655nm value was still greater than 1.0, and the recombinant antibody reacted well in ELISA. Figure 8 The results confirmed that the antibody R1H9-1C3 can be used to establish the ELISA detection method.

Claims

1. A cell that can stably express a recombinant monoclonal antibody against an antiviral protein, wherein the heavy chain and light chain gene sequences of the antiviral monoclonal antibody are detected in hybridoma cells, cloned into an expression vector, and transfected into cells to obtain a cell that stably expresses an antiviral recombinant monoclonal antibody (recombinant monoclonal antibody). The cell is named: CHO-Sr1H9-1C3, and the accession number is: CGMCC NO.45828.

2. A method for screening cells that stably express recombinant monoclonal antibodies against avian influenza virus proteins, the screening method comprising the following steps: S1. After immunizing mice with purified avian influenza virus protein, the spleen of the immunized mice was fused with myeloma cells, and positive hybridoma cells were screened using the ELISA test method; S2. Prepare antibodies using the hybridoma cells obtained in S1, and screen the monoclonal antibody with the highest titer using the HI test method; S3. Sequencing the monoclonal antibody obtained in S2, using 5'Race and 3'Race methods to amplify the full-length fragments of the heavy chain and light chain, and sequencing to obtain the complete sequence; S4. Codon optimization was performed on the base sequences of the heavy chain and light chain of the antibody measured in S3, and the optimized synthesized fragments were cloned into the expression vector, transfected into cells, and a cell line expressing the recombinant monoclonal antibody was obtained by two-phase selection by adding different concentrations of methotrexate and puromycin; S5. The cell line expressing the recombinant monoclonal antibody is further subcultured, and the expression level of the antibody in the cell supernatant after subculture is detected to screen out the cell line with stable expression.

3. The method according to claim 2, wherein in step S1, the avian influenza virus comprises various H7 subtype avian influenza viruses that are typed according to HA gene sequences.

4. The method according to claim 2, wherein in step S1, the purified protein of the immunized mice is the purified HA protein of the H7N9 subtype CK / SD008 strain.

5. The method of claim 2, wherein in step S3, the antibody heavy chain variable region germline is IGHV3, comprising three complementarity determining regions (CDR1, CDR2, CDR3), and its amino acid sequence is shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

6. The method of claim 2, wherein in step S3, the antibody light chain variable region germline is IGKV15, comprising three complementary determining regions (CDR1, CDR2, CDR3) whose amino acid sequences are shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO:

6.

7. The method according to claim 2, wherein in step S4, the expression vector is a eukaryotic expression vector; and the transfected cells are eukaryotic cells.

8. The method according to claim 2, wherein in step S4, the eukaryotic expression vector is pCHO-1.0, and the eukaryotic cell is Chinese Hamster Ovary cell CHO-S.

9. The method according to claim 2, wherein in step S5, the method for detecting the expression level of the antibody comprises ELISA and HI.

Images