Small interfering RNA for silencing SAP102, recombinant vector, medicine and application of small interfering RNA

Abstract

The invention belongs to the technical field of gene engineering, and provides a small interfering RNA for silencing SAP102. The small interfering RNA is si-RNA-1 of which the sequence is SEQ ID NO: 1 and / or si-RNA-2 of which the sequence is SEQ ID NO: 2. The small interfering RNA for silencing the SAP102 can significantly inhibit the activity of breast cancer cells and avoid the generation of drug resistance, and provides a new potential scheme for clinical tumor treatment.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a small interfering RNA for silencing SAP102, a recombinant vector, a drug and applications thereof. Background Art

[0002] Cancer seriously affects human health and life safety. According to the latest "World Cancer Report 2020" released by the World Health Organization's International Agency for Research on Cancer (IARC), cancer currently ranks among the top two causes of death among residents aged 30-69 in most countries. It is estimated that the number of new cancer cases worldwide will increase from 18 million in 2018 to 27 million in 2040, an increase of 50%, and the cancer burden is still increasing. At present, there are three main means of medical treatment for tumors: chemotherapy, molecular targeted therapy, and immunotherapy. Although these treatment methods have been continuously improved with the development of life and medical sciences, the treatment effect on tumors still does not meet our expectations, and the overall treatment level is not high.

[0003] Tumor is a non-hereditary genetic disease. Under the influence of carcinogenic factors, the genes of normal cells change and lose the normal regulation of their growth, leading to abnormal proliferation. Tumor cells have three significant basic characteristics: immortality, migration and loss of contact inhibition. The core idea of ​​tumor treatment is to kill and eliminate tumor cells. Currently, commonly used tumor treatment methods in clinical practice include chemotherapy, radiotherapy, hormone therapy, etc. However, for almost all drugs, as the patient uses the drug for a long time, cancer cells will develop resistance to the drug, causing the drug to stop acting on cancer cells. This acquired resistance of tumor cells to drug treatment not only severely limits the effectiveness of clinical treatment, but is also the molecular basis for tumor recurrence.

[0004] Therefore, there is an urgent need to develop new treatment methods or optimize existing methods, which can, on the one hand, break drug resistance and enhance anti-tumor effects, and on the other hand, enrich the "arsenal" against tumors and broaden the range of choices for tumor treatment strategies. Summary of the invention

[0005] In order to solve the problem in the prior art that cancer cells develop resistance to drugs, resulting in poor treatment effects, the present invention provides a small interfering RNA for silencing SAP102.

[0006] The small interfering RNA is si-RNA-1 with the sequence of SEQ ID NO: 1 and / or si-RNA-2 with the sequence of SEQ ID NO: 2.

[0007] The invention also provides a recombinant vector.

[0008] The recombinant vector comprises:

[0009] A: a nucleotide sequence identical or corresponding to the si-RNA-1 and / or the si-RNA-2 according to claim 1;

[0010] B: a nucleotide sequence obtained by replacing the nucleotide sequence shown in A or adding one or more amino groups, and having the same or similar functions as the nucleotide sequence shown in A; or

[0011] C: A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in A or B.

[0012] Furthermore, the recombinant vector is a shRNA interference adenoviral vector or a CRISPR / Cas9-based gene editing system delivery lentiviral vector.

[0013] The invention also provides a medicine.

[0014] The drug comprises the small interfering RNA for silencing SAP102 as described above and / or the recombinant vector as described above.

[0015] The present invention also provides a use of the above-mentioned small interfering RNA for silencing SAP102 and / or the above-mentioned recombinant vector in the preparation of a drug for treating tumors.

[0016] The present invention also provides a method for reducing the viability of cancer cells at the cellular level without therapeutic purposes.

[0017] The non-therapeutic method for reducing the viability of cancer cells at the cellular level includes: reducing the expression level of SAP102 in cancer cells.

[0018] Furthermore, the expression level of SAP102 in cancer cells is reduced by the small interfering RNA for silencing SAP102 as claimed in claim 1, the recombinant vector as claimed in claim 2, and the drug as claimed in claim 4.

[0019] The small interfering RNA for silencing SAP102 involved in the present invention can significantly inhibit the activity of breast cancer cells and avoid the generation of drug resistance, providing a new potential solution for clinical tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 To verify the knockdown effect of SAP102;

[0021] Figure 2 Effect of SAP102 knockdown on breast cancer cell viability. DETAILED DESCRIPTION

[0022] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and understandable, the specific implementation modes of the present invention are described in detail below with reference to the accompanying drawings, but they should not be construed as limiting the applicable scope of the present invention.

[0023] RNA interference (RNAi) refers to the phenomenon of highly conserved, highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) in the evolutionary process. Targeting this set of degradation mechanisms of cells, double-stranded RNA (dsRNA) homologous to the target gene mRNA coding region sequence can be introduced to specifically degrade the mRNA, resulting in gene expression silencing. RNAi technology has the characteristics of high specificity, high efficiency and low toxicity. RNAi technology can inhibit the expression of proto-oncogenes and anti-apoptosis related genes, thereby inhibiting the occurrence and development of tumors (Uprichard, Susan L. The therapeutic potential of RNA interference. FEBS Letters, 2005, 597: 5996-6007), showing excellent application potential in tumor treatment.

[0024] DLG3 / synapse-associated protein 102 (SAP102) is essential for the organization and adaptability of synapses in the central nervous system (CNS). It plays a key role in the assembly and mobilization of key components involved in learning and memory processes. Mutations in the DLG3 gene, which result in a truncated form of SAP102, are associated with a range of neurological disorders, including X-linked intellectual disability (XLID), autism spectrum disorder (ASD), and schizophrenia, which disrupt synaptic structure and cognitive function. In addition, abnormal levels of SAP102 expression have been linked to a variety of psychiatric and neurodegenerative disorders, such as bipolar disorder, major depressive disorder, and Alzheimer's disease, which negatively impact synaptic integrity and cognition.

[0025] Example 1

[0026] 1.1 siRNA transfection and effect verification

[0027] (1) Cell processing

[0028] 1) Breast cancer cell lines MCF7 or MDA-MB-231 were cultured at 1.5×10 5 Cells / well were seeded in 12-well plates at a density of;

[0029] 2) After overnight culture, SAP102 siRNAs (si-RNA-1 or si-RNA-2) and control siRNAs (NC) were transfected, respectively. The sequences of siRNAs are shown in Table 1:

[0030] Table 1

[0031] sense(5'-3') antisense(5'-3') si-RNA-1 UGUAUCUUCGAUUCAAAGCGA UCGCUUUGAAUCGAAGAUACA si-RNA-2 AUGUAUCUUCGAUUCAAAGCG CGCUUUGAAUCGAAGAUACAU NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

[0032] 3) After 48 h, cells were collected, total RNA was extracted and reverse transcribed into cDNA;

[0033] (2) Real-time fluorescence quantitative PCR was used to detect the expression level of SAP102. The PCR primers used are shown in Table 2:

[0034] Table 2

[0035] Forward(5'-3') Reverse(5'-3') SAP102 AAGAGGTCCTTGTATGTCAGGG CACCGATCTGCTCACTTTCTC

[0036] (3) Results

[0037] The results are as follows Figure 1 As shown, both siRNA-1 and siRNA-2 could significantly reduce the expression level of SAP102 in MCF7 or MDA-MB-231 cells.

[0038] 1.2 MTT assay to detect the effect of SAP102 knockdown on breast cancer cell viability

[0039] (1) Cell processing

[0040] 1) Breast cancer cell lines were cultured at 5×10 5 The cells / well were seeded in 6-well plates at a density of;

[0041] 2) After overnight culture, SAP102 siRNAs or control siRNAs were transfected;

[0042] 3) After 48 hours, the cells were collected, resuspended, counted, and inoculated into 96-well plates, with 3-5×10 cells per well. 3 cells;

[0043] (2) MTT assay

[0044] 1) After 48-72 hours, add 10 μl of MTT solution to each well and incubate for 4 hours at 37°C and 5% CO2;

[0045] 2) Remove the supernatant, add 100 μL DMSO to each well, and after the formazan product is fully dissolved, measure the OD value at 550 nm using a microplate reader;

[0046] (3) Result analysis

[0047] 1) Calculate the relative cell viability according to the following formula:

[0048] Cell activity % = (knockdown cell group OD - blank group OD) / (NC cell group OD - blank group OD) * 100%

[0049] 3) Results: Figure 2 As shown, SAP102 knockdown significantly inhibited breast cancer cell viability.

[0050] Sequence Listing:

[0051] SEQ ID NO: 1 (si-RNA-1):

[0052] sense(5'-3'):UGUAUCUUCGAUUCAAAGCGA;

[0053] antisense(5'-3'):UCGCUUUGAAUCGAAGAUACA.

[0054] SEQ ID NO: 2 (si-RNA-2):

[0055] sense(5'-3'):AUGUAUCUUCGAUUCAAAGCG;

[0056] antisense(5'-3'):CGCUUUGAAUCGAAGAUACAU.

[0057] SEQ ID NO: 3 (NC):

[0058] sense(5'-3'):UUCUCCGAACGUGUCACGUTT;

[0059] antisense(5'-3'):ACGUGACACGUUCGGAGAATT.

[0060] SEQ ID NO: 4 (SAP102):

[0061] Forward(5'-3'):AAGAGGTCCTTGTATGTCAGGG;

[0062] Reverse(5'-3'): CACCGATCTGCTCACTTTCTC.

Claims

1. A small interfering RNA for silencing SAP102, characterized in that: The small interfering RNA is si-RNA-1 with the sequence of SEQ ID NO: 1 and / or si-RNA-2 with the sequence of SEQ ID NO:

2.

2. A recombinant vector, characterized in that: include: A: a nucleotide sequence identical or corresponding to the si-RNA-1 and / or the si-RNA-2 according to claim 1; B: a nucleotide sequence obtained by replacing the nucleotide sequence shown in A or adding one or more amino groups, and having the same or similar functions as the nucleotide sequence shown in A; or C: A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in A or B.

3. The recombinant vector according to claim 2, characterized in that The recombinant vector is a shRNA interference adenoviral vector or a CRISPR / Cas9-based gene editing system delivery lentiviral vector.

4. A drug, characterized in that It comprises the small interfering RNA for silencing SAP102 as claimed in claim 1 and / or the recombinant vector as claimed in claim 2.

5. Use of the small interfering RNA for silencing SAP102 as claimed in claim 1 and / or the recombinant vector as claimed in claim 2 in the preparation of a drug for treating tumors.

6. A method for reducing the viability of cancer cells at the cellular level for non-therapeutic purposes, characterized in that: include: Reduce the expression level of SAP102 in cancer cells.

7. The method for reducing the viability of cancer cells at the cellular level for non-therapeutic purposes as claimed in claim 6, characterized in that: The expression level of SAP102 in cancer cells is reduced by the small interfering RNA for silencing SAP102 according to claim 1, the recombinant vector according to claim 2, and the drug according to claim 4.

Images