PAT-transMP-Cas9 mediated gene editing system and application thereof in gene editing

Abstract

The invention discloses a pAT-transMP-Cas9 (pAT-transMP-Cas9) mediated gene editing system and an application of the pAT-transMP-Cas9 mediated gene editing system in gene editing. According to the invention, the expression mode of MP in a TMV virus genome is optimized, so that the TMV virus genome is free from regulation and limitation of an original virus genome, and a pAT-transMP vector is established through complementary expression which is connected with a TMV-MP deletion vector in series in a same T-DNA (Transduced Deoxyribose Nucleic Acid) region. According to the invention, high molecular weight protein represented by Cas9 is successfully expressed by using a pAT-transMP expression vector, a pAT-transMP-Cas9 transient gene editing system in which Cas9 and a target gene are driven by a single virus vector to edit a target sequence is further created based on the expression vector, and NbPDS and GFP genes are successfully edited in tobacco. The expression vector established by the invention has a good application prospect in the aspects of high-molecular-weight protein expression and gene editing.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to a pAT- trans MP-Cas9-mediated gene editing system and its application in gene editing. Background Art

[0002] In plant biotechnology, plant viral vectors often use the efficient replication and transcriptional regulation mechanism of viruses in plants to express the desired target molecules / proteins. Due to the advantages of being fast, efficient, and low-cost, plant viral vectors are expected to be widely used in the production of exogenous proteins in plants, such as medical proteins, metabolic-related products, subunit vaccines, etc. In addition, the use of viral vectors to transiently express or knock out target genes is expected to overcome the shortcomings of traditional lethal genes and plant regeneration difficulties and time-consuming, and also provide a favorable tool for the early trait screening of molecular breeding. In the application process of plant viral expression vectors, virus-derived expression vectors often have low expression levels, especially the difficulty in expressing large molecular weight target proteins (such as the approximately 1800bp gene fragment encoding the GUS protein, and target proteins with more than 800 amino acids), thereby limiting the scope of application of viral vectors. For example, large molecular weight key proteins in biological metabolic pathways or enzyme reactions are often difficult to express and can only be partially expressed.

[0003] The development of viral expression vectors also brings opportunities for CRISPR-Cas9-mediated editing systems. However, due to the huge molecular weight of Cas9 protein (more than 150kDa), it is difficult to express in viral vectors, or the expression level is extremely low. Therefore, viral vectors are mostly used only to drive the gRNA expression cassette and are used in conjunction with transgenic plants expressing Cas9 (or Cas9 expression provided by another Agrobacterium plasmid). There are problems such as low efficiency and time-consuming transgenic and co-injection. Although there have been reports on the establishment of CRISPR-Cas9 editing systems through negative-strand RNA rhabdoviruses in the past two years, due to the large viral genome (nearly 15kb) and complex gene regulation, practical operations are difficult, especially in plant bioreactors. In-depth research is still needed. Therefore, it is urgent to discover new efficient viral vectors that can achieve high-level expression of large molecular weight target proteins and simultaneous expression of two target molecules in a single vector, which will have important application value.

[0004] Scientists' in-depth research on molecular replication and virus-encoded proteins related to the TMV genome has laid the foundation for the development of plant virology. Research based on TMV expression vectors also leads the research on plant virus expression vectors, but the expression of large molecular weight proteins is still an obstacle limiting its widespread application. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to express high molecular weight proteins in plants by using TMV plant virus vector.

[0006] In order to solve the above technical problems, the present invention first provides pAT- trans New use of MP vector; the pAT- trans The MP vector is a vector obtained by connecting the expression cassette of the movement protein MP to a plant virus expression vector, and in the plant virus expression vector, the coding gene of the movement protein MP and the coding gene of the high molecular weight protein are driven to express by their respective promoters; the movement protein MP is any one of the following (a1)-(a3):

[0007] (a1) the protein shown in SEQ ID No. 5;

[0008] (a2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.5;

[0009] (a3) a protein having 78% or more identity with SEQ ID No. 5 and having the same function;

[0010] The present invention provides pAT- trans Application of MP vector in expressing large molecular weight protein or preparing products expressing large molecular weight protein.

[0011] In the protein described in (a2) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0012] In the protein described in (a3) ​​above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated.

[0013] In the above application, the expression cassette of the motor protein MP includes a gene encoding the motor protein MP and a promoter for driving the expression of the gene encoding the motor protein MP.

[0014] The method of connecting the expression cassette of the movement protein MP includes directly inserting the expression cassette of the movement protein MP into the plant expression vector, or replacing part of the DNA fragment in the plant expression vector with the expression cassette of the movement protein MP.

[0015] In the plant expression vector, the promoter used to drive the expression of the gene encoding the motor protein MP and the promoter used to drive the expression of the gene encoding the large molecular weight protein may be the same or different.

[0016] In one embodiment of the present invention, the pAT- trans The MP vector is a vector obtained by deleting the gene encoding the movement protein MP that regulates expression in the viral genome of the plant viral expression vector, and connecting the expression cassette of the movement protein MP upstream or downstream of the viral genome in the same T-DNA region of the plant viral expression vector.

[0017] In a specific embodiment of the present invention, the pAT- trans The MP vector is a vector obtained by deleting the gene encoding the movement protein MP that regulates expression in the viral genome of the plant viral expression vector, and connecting the expression cassette of the movement protein MP downstream of the viral genome in the same T-DNA region of the plant viral expression vector.

[0018] In one embodiment of the present invention, the expression cassette of the motor protein MP comprises a promoter for initiating the expression of the gene encoding the motor protein MP, the gene encoding the motor protein MP, and a terminator for terminating the expression of the gene encoding the motor protein MP.

[0019] In a specific embodiment of the present invention, the promoter is a DNA molecule shown in positions 7-313 of SEQ ID No.4.

[0020] The gene encoding the motor protein MP is a DNA molecule as described in any one of the following (A1) or (A2): (A1) a DNA molecule shown in SEQ ID No.6; (A2) a DNA molecule encoding the motor protein MP having a sequence similarity of 70% or more to SEQ ID No.6. The identity refers to sequence similarity with a natural nucleic acid sequence, including a nucleotide sequence having a sequence similarity of 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more to a nucleotide sequence encoding a protein composed of an amino acid sequence shown in SEQ ID No.5 of the present invention.

[0021] The terminator is the DNA molecule shown in positions 2312-2575 of SEQ ID No.4.

[0022] In one embodiment of the present invention, the plant virus expression vector includes a plant virus expression vector of the genus Tobamovirus, a plant virus expression vector of the genus Tobravirus and a plant virus expression vector of the genus Potexvirus.

[0023] The Tobamovirus plant virus expression vector is preferably a tobacco mosaic virus expression vector.

[0024] The Tobravirus plant virus expression vector is preferably a tobacco rattle virus expression vector.

[0025] The Potexvirus plant virus expression vector is preferably a potato virus X expression vector.

[0026] In a specific embodiment of the present invention, the tobacco mosaic virus expression vector is a pAT vector, which includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, GFP reporter gene, 3'UTR segment of TMV, and 35S terminator.

[0027] In order to solve the above technical problems, the present invention also provides a vector for plant gene editing.

[0028] The vector for plant gene editing provided by the present invention is in the above-mentioned pAT- trans The MP vector is a vector obtained by ligating the Cas9 nuclease encoding gene into the viral genome.

[0029] In one embodiment of the present invention, the vector for plant gene editing is in the above-mentioned pAT-trans The MP vector is a vector obtained by ligating the Cas9 nuclease encoding gene between the Asc I and Xho I restriction sites in the viral genome.

[0030] In a specific embodiment of the present invention, the vector for plant gene editing is in the above-mentioned pAT- trans The MP vector is obtained by ligating the DNA molecule shown in SEQ ID No. 7 between the Asc I and Xho I restriction sites in the viral genome.

[0031] In one embodiment of the present invention, the vector further comprises an sgRNA expression cassette targeting a target gene. The sgRNA expression cassette targeting a target gene sequentially comprises a promoter for initiating expression of the sgRNA and a gene encoding the sgRNA.

[0032] In a specific embodiment of the present invention, the nucleotide sequence of the sgRNA expression cassette targeting the target gene is shown as SEQ ID No.9.

[0033] In another specific embodiment of the present invention, the nucleotide sequence of the sgRNA expression cassette targeting the target gene is shown as SEQ ID No.10.

[0034] In a preferred embodiment of the present invention, the vector for plant gene editing is in the above-mentioned pAT- trans The DNA molecule shown in SEQ ID No.7 was connected between the Asc I and Xho I restriction sites in the viral genome of the MP vector, and trans The vector obtained by connecting the sgRNA expression cassette targeting the target gene to the Kpn I restriction site of the MP vector.

[0035] In order to solve the above technical problems, the present invention also provides a new use of the above vector for plant gene editing.

[0036] The present invention provides the use of the above-mentioned vector for plant gene editing in any of the following 1)-5):

[0037] 1) Gene Editing:

[0038] 2) Preparation of gene-edited products;

[0039] 3) Preparation of plant mutants;

[0040] 4) Study plant protein or gene function;

[0041] 5) Products that study plant proteins or gene functions.

[0042] In order to solve the above technical problems, the present invention finally provides any one of the following methods b1) or b2):

[0043] b1) A method for expressing a high molecular weight protein, comprising the following steps: expressing a gene encoding a high molecular weight protein through the pAT- trans The MP vector is introduced into the host cells to achieve the expression of large molecular weight proteins;

[0044] b2) A method for plant gene editing, comprising the following steps: introducing the above-mentioned vector for plant gene editing into a plant to achieve plant gene editing.

[0045] Any of the above host cells can be plant cells. The plant can be tobacco, and the tobacco can specifically be Nicotiana benthamiana or 16c transgenic material of Nicotiana benthamiana.

[0046] Any of the above-mentioned expressions may be transient expressions.

[0047] Any of the above-mentioned high molecular weight proteins may be proteins with a molecular weight greater than 150 kDa, including but not limited to medical-related proteins, plant functional proteins, molecular metabolic enzyme engineering products, etc. In a specific embodiment of the present invention, the high molecular weight protein is a Cas9 protein with a molecular weight of 162 kDa.

[0048] Any of the above-mentioned genes may be any gene located in the plant genome, such as the NbPDS gene, or may be any gene introduced into the plant, such as the GFP gene.

[0049] The present invention optimizes the MP expression mode in the TMV viral genome to free it from the regulatory restrictions of the original viral genome, and establishes pAT- trans MP expression vector. The present invention utilizes pAT- trans MP expression vector successfully expressed large molecular weight proteins represented by Cas9, and further based on pAT- trans MP expression vectors create pAT- trans The MP-Cas9 transient gene editing system successfully edited the NbPDS and GFP genes in tobacco.

[0050] The beneficial effects of the present invention are as follows:

[0051] 1. The present invention optimizes the expression vector based on the plant tobacco mosaic virus (TMV) genome, dissociates the TMV movement protein (MP) from the expression regulation of the TMV genome through trans expression, and establishes pAT- trans MP expression vector can effectively express large molecular weight proteins (CRISPR gene editing Cas9 protein greater than 150 kDa), indicating that the pAT- trans The MP system has obvious advantages in expressing large molecular target proteins, breaking the limitations of viral expression vectors on exogenous protein molecules.

[0052] 2. pAT- trans The MP-Cas9 gene editing system enables CRISPR-Cas9-mediated gene editing with a single viral vector, which is highly efficient and fast, broadens the application scope of TMV viral vectors, is conducive to the study of gene function, metabolic pathways, etc., and provides an effective tool for rapid screening of early traits in molecular breeding. It has important theoretical significance and application potential.

[0053] 3. The vector constructed based on the TMV genome of the present invention lacks the viral CP protein, eliminating the potential safety hazards of the traditional viral vector system and the ecological risks associated with release into the environment. Therefore, the pAT- trans The MP-Cas9 efficient expression vector will have potential application value and social significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Schematic diagram of constructing vector. Among them, pAT vector: the CP gene in the TMV genome is replaced with the GFP gene, and the CaMV 35S promoter (P 35S ) driven by GFP in plants; pAT-ΔMP: an expression vector after the MP gene in the pAT vector is deleted; pAT- trans MP: The MP expression cassette is supplemented in the pAT-ΔMP vector by trans expression, where “P NOS -MP-T NOS ” is the MP expression frame.

[0055] Figure 2 For the pAT- trans The MP system efficiently expresses CRISPR-Cas9 protein and effectively edits NbPDS and GFP genes. AB is the expression of Cas9 protein detected by Western blot. A is a comparison of pAT- transThe expression level of Cas9 in MP-Cas9 vector. The results show that the sample at 3dpi has high expression. B is the comparison of pAT- trans The expression of Cas9 in the MP system and the pAT control vector showed that no Cas9 expression was detected in the samples in the pAT-Cas9 control vector when the VSRs silencing suppressor was added or not (with the addition of P130 empty vector as negative control), while the pAT- trans MP-Cas9 vectors all produced significantly enhanced Cas9 signals. C is the gene editing vector pAT- trans MP-Cas9-pds360 and pAT- trans Schematic diagram of the structure of MP-Cas9-gfp, which is driven by a single vector to edit the target sequence of Cas9 and the target gene. D is pAT- trans The leaf phenotype after MP-Cas9-pds360 vector edited the NbPDS gene. E is the agarose gel electrophoresis detection and sequencing results after ApeKI digested the PCR product with DNA as template. F is the pAT- trans Leaf phenotype after MP-Cas9-gfp vector edited GFP gene. G is the agarose gel electrophoresis detection and sequencing results after Bst BI digested the PCR product with DNA as template. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0057] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0058] The construction method of the TMV virus expression vector pAT in the following embodiment is as follows:

[0059] (1) Artificially synthesizing a double-stranded DNA molecule shown in SEQ ID No. 1; in the double-stranded DNA molecule, nucleotides 3-8 constitute an Xho I restriction enzyme recognition sequence, nucleotides 24-227 constitute a 3'UTR segment of TMV, and nucleotides 228-233 constitute a Kpn I restriction enzyme recognition sequence.

[0060] (2) Double-digest the double-stranded DNA molecules obtained in step (1) with restriction endonucleases Xho I and Kpn I, and recover the digestion products.

[0061] (3) The p35S-30B plasmid was double-digested with restriction endonucleases Xho I and Kpn I to recover the vector backbone with a size of 13605 bp.

[0062] (4) Connect the digestion product obtained in step (2) and the vector backbone obtained in step (3) to obtain the pAT0 vector. The pAT0 vector includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, multiple cloning site sequence, 3'UTR segment of TMV, and 35S terminator.

[0063] (5) Insert the GFP reporter gene shown in SEQ ID No. 2 between the Pac I and Xho I restriction sites of the pAT0 vector to obtain the pAT vector. The pAT vector includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, GFP reporter gene, 3'UTR segment of TMV, and 35S terminator.

[0064] The above-mentioned p35S-30B plasmid (plasmid p35S-30B) is described in the following document: Jia HG, Pang YQ and Fang RX (2003) Agroinoculation as a simple way to deliver a Tobacco mosaicvirus-based expression vector. Acta Botanica Sinica, 45 (7): 770-773. The specific construction method is as follows: firstly, a functional segment (including the RdRp gene of TMV, the MP gene of TMV and the CP gene of TMGMV) is obtained from the 30B vector, and then the functional segment is inserted between the 35S promoter and the 35S terminator of the pCassKS vector through the multiple cloning site to obtain a vector containing the functional segment expression cassette, and then an expression cassette having the 35S promoter, the functional segment and the 35S terminator is obtained from the vector containing the functional segment expression cassette, and finally the expression cassette is cloned into the pCAMBIA1300 vector to obtain the p35S-30B plasmid. Among them, the 30B vector is recorded in the following literature: Shivprasad, S., Pogue, GP, Lewandowski, DJ, Hidalgo, J., Donson, J., Grill, LK, and Dawson, WO (1999) Heterologous sequences greatly affect foreign gene expression in Tobacco mosaic virus-based vectors. Virology, 255: 312-323.

[0065] The 16c transgenic material of Nicotiana benthamiana in the following examples is described in the document “Ruiz, MT, Voinnet, O. and Baulcombe, DC (1998) Initiation and maintenance of virus-induced gene silencing. Plant Cell 10, 937-946.”

[0066] The vector pGD-VSRs of the VSRs silencing suppressor in the following examples is described in the document “Gao, Q., Xu, WY, Yan, T., Fang, XD, Cao, Q., Zhang, ZJ, Ding, ZH, Wang, Y., and Wang, XB (2019). Rescue of a plant cytorhabdovirus as versatile expression platforms for planthopper and cereal genomic studies. New Phytol 223(4): 2120-2133.”.

[0067] The Western blot detection method in the following examples is as follows: the tobacco leaf sample is fully ground into powder in a mortar precooled with liquid nitrogen, 2 ml of protein extraction buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 10% glycerol, 1.0% Triton X-100, 5 mM β-mercaptoethanol, 20 mM Imidazole, 1× complete protease inhibitor cocktail] is added per gram of leaf, and the mixture is fully mixed and incubated at 4°C for 30 min. Then, the mixture is centrifuged at 4°C and 13,000 rpm for 15 min, the supernatant is collected, and the centrifugation is repeated 2-3 times. Finally, add an equal volume of 2×SDS loading buffer [100mM Tris-Cl (pH 6.8), 4% (w / v) SDS, 0.2% (w / v) bromophenol blue, 20% (v / v) glycerol, 200mM DTT (dithiothreitol)] to the supernatant, mix thoroughly, boil in water for 15min, and centrifuge at 4℃ for 3min. Take the supernatant sample and separate the protein by SDS-PAGE and transfer to PVDF membrane for immunoblotting reaction. After blocking with skimmed milk powder, the primary antibody [anti-Cas9 (Merck Millipore, Cat no.MAC133, Massachusetts, USA) diluted 1:5000; Anti-His Antibody, TIANGEN, Beijing, Cat no.AB102-02] was added and incubated at room temperature for 2 hours, the membrane was washed 3 times, 10 minutes each time, and the secondary antibody (rabbit secondary antibody, Promega, Madison, WI USA, Cat no.W4028; mouse secondary antibody: Anti-Mouse IgG (H+L), HRP Conjugate, Promega, Madison, WI USA, Cat no.W4021) was added and incubated at room temperature for 1 hour, then the membrane was washed 3 times, and finally the color developing solution (Thermo ScientificTM, Rockford, USA, Cat no.34075) was added for reaction, and the signal was detected using the Azure c600 instrument.

[0068] The method for transient expression using Agrobacterium in tobacco (N. benthamiana) in the following example is as follows: Agrobacterium GV3101 carrying the target vector was cultured overnight at 28°C in 4 ml LB liquid medium containing 25 mg / L kanamycin (Kanamycin, Kan) and 25 mg / L rifampin (Rif) and then reactivated and cultured in 20 ml LB liquid medium at a 1% (V / V) inoculum amount until OD600 =1.2, the bacteria were collected after centrifugation at 7000 rpm for 15 min and fully suspended in MMA solution (10 mM MgCl2, 10 mM MES pH 5.6, 100 μM acetosyringone) (OD 600 =0.8) and then allowed to stand at room temperature for 1 h. The mixture was injected into 5-6-leaf-old tobacco (N. benthamiana) leaves using a needleless syringe. Three fully expanded leaves were injected into each tobacco plant. The injected tobacco was continued to be cultured in a greenhouse (22°C, 16 h light / 8 h dark) (protein expression: 3-7 days; gene editing 7-15 days).

[0069] Example 1, pAT- trans Construction of MP-Cas9-mediated gene editing system and detection of Cas9 protein expression level

[0070] 1. pAT- trans Construction of MP vector

[0071] 1. The TMV viral expression vector pAT was double-digested with ZraⅠ and AscⅠ to obtain a pAT vector with a size of 13 kp.

[0072] 2. Using the puc57-ZrAsBq plasmid (synthesized by Beijing Qingke Biotechnology Co., Ltd., China) containing the DNA molecule shown in SEQ ID No. 3 (optimized ZrAsBq) as a template, PCR amplification was performed using primers DMZR-F and DMZR-R to obtain PCR products. The primer sequences are as follows:

[0073] DMZR-F: 5'-AGAAAGAGCGGGGACGTCACGACGTTCATTGGA-3';

[0074] DMZR-R: 5'-ACCATTAATGGCGCGCCGGATTGGAAGTAGAGG-3'.

[0075] 3. Using recombinant enzyme (Trelief TM SoSoo Cloning Kit Ver.2, Cat no.TSV-S2, Beijing Qingke Biotechnology Co., Ltd., China) The PCR product in step 2 was recombined into the pAT vector after restriction digestion in step 1 to obtain the recombinant vector pAT-ΔMP for MP deletion expression.

[0076] 4. A polypeptide containing "P" shown in SEQ ID No.4 NOS Promoter-Luc gene (including intron)-T NOS terminator expression cassette (P NOSThe nucleotide sequence of the promoter is shown in SEQ ID No. 4, positions 7-313. NOS The nucleotide sequence of the terminator is shown in SEQ ID No. 4, positions 2312-2575) as a T-LucINT plasmid as a template, and primers Pnos-ΔM-F and ΔM-pnos-R were used for PCR amplification to obtain P NOS promoter fragment; then, using the T-LucINT plasmid as a template, PCR amplification was performed using primers ΔM-pnos-F and NOS-ΔM-R to obtain T NOS terminator fragment; then, using the pAT vector as a template, PCR amplification was performed on TMV-mp-F and TMV-mp-R using primers to obtain the MP-ORF gene fragment (the gene encoding the movement protein MP). The gene encoding the movement protein MP is shown in SEQ ID No.6, and the amino acid sequence of the movement protein MP encoded by it is shown in SEQ ID No.5. The primer sequences are as follows:

[0077] Pnos-ΔM-F: 5'-ttcctttaacaactagagccatggatccagatccggtgcaga-3';

[0078] ΔM-pnos-R: 5'-ctgtcaaacactgatagtttgaaccgcaacgttgaaggag-3';

[0079] ΔM-pnos-F: 5'- tcgtttcccgccttcagttt ccgatctagtaacatagatg-3';

[0080] NOS-ΔM-R: 5'- cgccgaatcggattcgttttaa gaatttccccgatcgttcaa-3';

[0081] TMV-mp-F: 5'-ttaaaacgaatccgattcggcg-3';

[0082] TMV-mp-R: 5'-atggctctagttgttaaaggaa-3'.

[0083] 5. Using recombinant enzyme (Trelief TM SoSoo Cloning Kit Ver.2, Cat no.TSV-S2, Beijing Qingke Biotechnology Co., Ltd., China) was used to clone the three fragments obtained in step 4. NOS Promoter fragment, T NOS The terminator fragment and MP-ORF gene fragment were integrated into the Pme I site of the recombinant vector pAT-ΔMP to obtain the recombinant vector pAT-trans MP. Recombinant vector pAT- trans MP is a vector obtained by trans-expressing MP in the TMV viral expression vector pAT, that is, transferring the MP reading frame regulating expression in the TMV genome of the TMV viral expression vector pAT to the P located downstream of the TMV genome. NOS Promoter and T NOS terminator, forming an independent MP expression cassette. NOS -MP-T NOS expression cassette) includes P NOS promoter (shown in positions 7-313 of SEQ ID No.4), the gene encoding the motor protein MP (shown in SEQ ID No.6) and T NOS Terminator (shown in positions 2312-2575 of SEQ ID No. 4).

[0084] 2. pAT- trans Construction of MP-Cas9-mediated gene editing system and detection of Cas9 protein expression level

[0085] The pAT- trans The gene encoding the Cas9-6xHis fusion protein was linked to the TMV genome on the MP vector to obtain pAT- trans MP-Cas9-mediated gene editing system, and the expression level of CRISPR associated protein9 (Cas9) protein (162kDa) was analyzed.

[0086] 1. pAT- trans Construction of MP-Cas9-mediated gene editing system

[0087] 1) Using the TKC plasmid containing the CRISPR-Cas9 gene as a template, primers pAmT-NLS-Cas9-PKC-F and pAmT-CsAS9-R were used for PCR amplification to obtain a 4,177 bp gene fragment encoding the Cas9-6xHis fusion protein (the nucleotide sequence of the gene fragment is shown in SEQ ID No. 7). The primer sequences are as follows:

[0088] pAmT-NLS-Cas9-PKC-F: 5'-gcgagaacctctacttccaatccggcatgctcaccctgttgtttgg-3'; pAmT-Cas9-R: 5'-acctcaagttgcaggaccctcgagttagtgatggtgatggtgatgatcgccgccgagttgtgtgaga-3'.

[0089] 2) Insert the 4177 bp gene fragment encoding Cas9-6xHis fusion protein in step 1) into pAT- trans MP vector Asc I and Xho I restriction sites to obtain the recombinant vector pAT- trans MP-Cas9, the recombinant vector pAT- trans MP-Cas9 expresses the Cas9-6xHis fusion protein (162 kDa) shown in SEQ ID No.8.

[0090] 2. The recombinant vector pAT- trans MP-Cas9 was transferred into Agrobacterium GV3101, and the exogenous protein Cas9 was expressed by the Agrobacterium transient expression system in Nicotiana benthamiana leaves, and the expression level of the exogenous protein Cas9 was compared and analyzed by Western blot. trans Leaves with MP empty vector served as negative control.

[0091] Western blot results showed that the pAT- trans The protein sample obtained by MP-Cas9 vector has obvious Cas9-specific expression product at about 160kDa ( Figure 2 AB), and from the empty vector (pAT- trans MP) and the protein samples obtained from the vector pAT-Cas9 before transformation had no expression product signal, so the Cas9 protein was expressed in pAT- trans The expression was successfully achieved in MP vector.

[0092] Example 2, pAT- trans Application of MP-Cas9-mediated gene editing system in gene editing

[0093] 1. pAT- trans Construction of MP-Cas9-sgRNA recombinant vector

[0094] In order to verify the biological activity of the expressed Cas9 product, the present invention is based on the pAT- trans MP-Cas9-mediated gene editing system, in the recombinant vector pAT- trans The expression cassette of the sgRNA targeting the target gene is connected to MP-Cas9, so that the Cas9-6xHis fusion protein expressed by TMV virus replication and the sgRNA carrying the target gene are expressed in tandem in T-DNA to obtain the recombinant vector pAT- transMP-Cas9-sgRNA. The specific steps are as follows:

[0095] 1. Recombinant vector pAT- trans Construction of MP-Cas9-pds360

[0096] According to the NbPDS gene sequence, the following sgRNA target sequence pds 360 targeting NbPDS was designed: 5'-gctgcatggaaagatgatgatgg-3'. The sgRNA coding sequence shown in SEQ ID No.9 was artificially synthesized and linked into pAT- trans The Kpn I restriction site of the MP vector was used to obtain the recombinant vector pAT- trans MP-Cas9-pds360. Recombinant vector pAT- trans The schematic diagram of the structure of MP-Cas9-pds360 is shown in Figure 2 As shown in C.

[0097] 2. Recombinant vector pAT- trans Construction of MP-Cas9-GFP

[0098] According to the GFP gene sequence, the following sgRNA target sequence targeting GFP was designed: 5'-cgcgctgaagtcaagttcgaagg-3'. The sgRNA coding sequence shown in SEQ ID No.10 was artificially synthesized and connected to pAT- trans The Kpn I restriction site of MP vector was used to obtain the recombinant vector pAT- trans MP-Cas9-gfp. Recombinant vector pAT- trans The schematic diagram of the structure of MP-Cas9-gfp is shown in Figure 2 As shown in C.

[0099] 2. pAT- trans Application of MP-Cas9-sgRNA recombinant vector in editing target genes

[0100] The recombinant vector pAT- trans MP-Cas9-pds360 and the vector pGD-VSRs of VSRs silencing suppressor were introduced into Agrobacterium GV3101 to obtain the recombinant bacteria pAT- transMP-Cas9-pds360 / GV3101 and pGD-VSRs / GV3101. The two recombinant bacteria were then mixed in a volume ratio of 1:1 and co-injected into Nicotiana benthamiana leaves, and MMA buffer was injected as a negative control (mock). Three tobacco plants were injected, three leaves were injected into each plant, and only one vector was injected into each leaf. After injection, the phenotype of tobacco leaves was observed and DNA samples of leaves with a drifting color and a shrunken phenotype were extracted after transient expression in tobacco for 7-14 days for gene editing detection. The primer sequences for detecting the PDS gene editing target sequence are as follows:

[0101] nbpds-check-f:5'-TTTTAAACTGAGTCAATTTTAACCG-3';

[0102] nbpds-check-r: 5'-TATGAGTCACCATACGAGGTTAGCAG-3'.

[0103] The recombinant vector pAT- trans MP-Cas9-gfp and the vector pGD-VSRs of VSRs silencing suppressor were introduced into Agrobacterium GV3101 to obtain the recombinant bacteria pAT- trans MP-Cas9-gfp / GV3101 and pGD-VSRs / GV3101. The two recombinant bacteria were then mixed in a volume ratio of 1:1 and co-injected into the leaves of 16c transgenic material of Nicotiana benthamiana. trans MP-Cas9 and pGD-VSRs were used as negative controls. Three tobacco plants were injected, three leaves were injected in each plant, and only one vector was injected in each leaf. The phenotype of tobacco leaves was observed after injection, and DNA samples of leaves with GFP fluorescence quenching phenotype were extracted after 7-14 days of transient expression in tobacco for gene editing detection. The primer sequences for detecting the GFP gene editing target sequence are as follows:

[0104] GFP-F: 5'-ATGAGTAAAGGAGAAGAACTTTTC-3';

[0105] GFP-R: 5'-TTTGTATAGTTCATCCATGC-3'.

[0106] The results showed that compared with the normal growth of negative control plant leaves, the pAT- trans The leaves of Nicotiana benthamiana grown with MP-Cas9-pds360 showed the classic phenotype of PDS gene mutation, which was bleached and shrunken. Figure 2D) The results of ApeK I digestion and sequencing of PCR products of leaf DNA samples showed that only after injection of pAT- trans The target gene NbPDS in the leaf samples of MP-Cas9-pds360 editing vector was base edited ( Figure 2 E), this result shows that the Cas9 expressed by the single vector constructed by the present invention successfully edited the NbPDS target gene. trans MP-Cas9-gfp was found in tobacco 16c leaves to have successfully edited GFP gene, thus quenching the green fluorescence expression of GFP ( Figure 2 FG).

[0107] The above results show that pAT- trans The MP vector can effectively express large Cas9 proteins up to 162kDa. The single vector created can simultaneously express Cas9 protein expression and the target RNA sequence of the corresponding target gene, and obtain the ideal editing effect on the target gene, which has broad application potential in gene editing.

[0108] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. pAT- trans Use of MP vectors in expressing large molecular weight proteins or preparing products expressing large molecular weight proteins; The pAT- trans The MP vector is a vector obtained by connecting the expression cassette of the movement protein MP to a plant virus expression vector, and in the plant virus expression vector, the coding gene of the movement protein MP and the coding gene of the high molecular weight protein are driven to express by their respective promoters; the movement protein MP is any one of the following (a1)-(a3): (a1) the protein shown in SEQ ID No. 5; (a2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.5; (a3) A protein having 78% or more identity with SEQ ID No. 5 and having the same function.

2. The use according to claim 1, characterized in that: The pAT- trans The MP vector is a vector obtained by deleting the gene encoding the movement protein MP that regulates expression in the viral genome of the plant viral expression vector, and connecting the expression cassette of the movement protein MP upstream or downstream of the viral genome in the same T-DNA region of the plant viral expression vector.

3. The use according to claim 1 or 2, characterized in that: The expression cassette of the motor protein MP comprises a promoter for initiating the expression of the gene encoding the motor protein MP, the gene encoding the motor protein MP, and a terminator for terminating the expression of the gene encoding the motor protein MP.

4. The use according to claim 3, characterized in that: The promoter is the DNA molecule shown in positions 7-313 of SEQ ID No.4; The gene encoding the motor protein MP is a DNA molecule as described in any one of the following (A1) or (A2): (A1) DNA molecule shown in SEQ ID No.6; (A2) a DNA molecule having more than 70% identity with SEQ ID No. 6 and encoding the motor protein MP; The terminator is the DNA molecule shown in positions 2312-2575 of SEQ ID No.

4.

5. The use according to any one of claims 1 to 4, characterized in that: The plant virus expression vectors include Tobamovirus plant virus expression vectors, Tobravirus plant virus expression vectors and Potexvirus plant virus expression vectors.

6. The use according to claim 5, characterized in that: The Tobamovirus plant virus expression vector includes a tobacco mosaic virus expression vector; Or, the Tobravirus plant virus expression vector includes a tobacco rattle virus expression vector; Alternatively, the Potexvirus plant virus expression vector comprises a potato virus X expression vector.

7. A vector for plant gene editing, the vector being any one of the pAT- trans The MP vector is a vector obtained by ligating the Cas9 nuclease encoding gene into the viral genome.

8. The carrier according to claim 7, characterized in that: The vector also includes an sgRNA expression cassette targeting the target gene.

9. Use of the vector according to claim 7 or 8 in any of the following 1)-5): 1) Gene Editing: 2) Preparation of gene-edited products; 3) Preparation of plant mutants; 4) Study plant protein or gene function; 5) Products that study plant proteins or gene functions.

10. Any of the following methods b1) or b2): b1) A method for expressing a high molecular weight protein, comprising the following steps: expressing a gene encoding a high molecular weight protein through the pAT- trans The MP vector is introduced into the host cell to achieve the expression or preparation of high molecular weight proteins; b2) A method for plant gene editing, comprising the following steps: introducing the vector described in claim 7 or 8 into a plant to achieve plant gene editing.

Images