Molecular marker related to sheep mycoplasmal pneumonia disease resistance and application thereof

Abstract

The invention provides a molecular marker related to sheep mycoplasmal pneumonia lesion resistance and application of the molecular marker. The molecular marker is screened from an FOXF1 gene in lung tissue pathological score GWAS, DNA is extracted from sheep blood, a KASPar primer is used for detecting polymorphic sites of 203 Hu sheep, a least square model is established, correlation analysis is performed on genotypes of the polymorphic sites of the 203 Hu sheep and pneumonia lesion phenotype data, and the genotypes of the polymorphic sites of the 203 Hu sheep and pneumonia lesion phenotype data are analyzed. Finally, it is determined that the FOXF1 gene screened in the invention and the related SNP thereof can be used as the molecular marker related to the sheep mycoplasma pneumonia disease resistance. The molecular marker related to the mycoplasmal pneumonia disease resistance of sheep can be used for screening high-quality mutton sheep with high mycoplasmal pneumonia resistance, provides a genetic engineering means for rapid screening of sheep disease resistance breeding, and has great practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology, and specifically relates to a FOXF1 gene as a molecular marker related to resistance to sheep mycoplasma pneumonia lesions and an application thereof. Background Art

[0002] Pneumonia, as a respiratory disease, is a common disease among large sheep herds in all major sheep producing countries. Studies have reported that the prevalence of severe pneumonia lesions at slaughter ranges from 21-93%. Mycoplasma ovipneumoniae (MO) is an important pathogen causing pneumonia, and evidence of MO colonization is detected in approximately 90% of pneumonia-related clinical procedures. MO was originally isolated and described from Australian sheep herds with a high incidence of pneumonia in lambs. Symptoms caused by MO infection are mainly coughing, wheezing, progressive weight loss and proliferative inflammation of the lung interstitial tissue. In addition, MO is characterized by an unusually wide host range, a high phenotype, strong infectivity and high morbidity, and is prone to secondary or mixed infections with other bacteria. To complicate the situation, MO can be detected in the lungs of lambs in the absence of obvious clinical symptoms or severe endemic pneumonia. Disease resistance and susceptibility are the most commonly targeted disease response traits in farm animal breeding programs because they are natural and unique mechanisms of host response to infectious pathogens. There is well-documented evidence that there are inter-animal differences in the ability of livestock to resist a variety of economically important diseases, including respiratory diseases. Previous studies in sheep and cattle have suggested that there is a potential genetic component in the differences in pneumonia susceptibility observed between animals. More importantly, tools such as genome-wide association studies (GWAS) can identify and locate tens of thousands of high-density single nucleotide polymorphism (SNP) sites in a population and screen for SNPs that affect phenotypic traits. GWAS can identify genomic regions associated with potential causal mutations that affect susceptibility to infectious diseases, and the discovery of these regions and sites may also lead to the establishment of new disease diagnostic tools and alternative therapies. Therefore, the use of molecular biology and molecular genetics techniques to locate molecular markers associated with phenotypes, find disease resistance genes for disease resistance breeding, and improve the genetic disease resistance of livestock and poultry themselves has become an effective supplement to traditional livestock and poultry disease prevention and control methods.

[0003] When faced with chronic or acute ovine pneumonia, it is necessary to consider mortality and subclinical effects, as chronic pneumonia may gradually recover from the disease, while acute pneumonia symptoms are severe and may even lead to death. Detection of chronic non-progressive pneumonia usually requires autopsy or post-slaughter lung examination. MO infection causes major pathological changes, such as pulmonary consolidation, inflammatory cell infiltration and vascular lesions. Based on the individual's tolerance to pathogens, bacterial load cannot fully represent the severity of the lesion, and uneven bacterial colonization also makes it difficult to obtain accurate load data. It is generally believed that intuitive judgment of lesion severity can better understand the response and resistance of sheep to MO infection. Inflammatory lung damage is usually evaluated and quantified by histopathological scoring, which has also been reported in some existing studies. Higher scores indicate more severe lesions and lower individual resistance to pneumonia.

[0004] FOXF1 is a member of the forkhead box (FOX) family of transcription factors. FOXF1 stimulates lung repair and regeneration by regulating key genes for extracellular matrix remodeling, inflammation, and endothelial barrier function. FOXF1 has been identified as an anti-fibrotic factor that regulates key functions of myofibroblasts by preventing CDH2-CDH11 cadherin conversion and reducing lung inflammation during pulmonary fibrosis. In addition, FOXF1 is enriched in lung endothelial cells compared to endothelial cells in other organs such as the liver, pancreas, brain, heart, and kidney. A study reported that lung epithelial progenitor cells (EPCs) are activated by FOXF1-mediated BMP9 / ACVRL1 signaling to promote neonatal pulmonary angiogenesis and alveolarization. In summary, a large number of studies have highlighted the key role of FOXF1 in lung-related functions, but most studies have focused on humans or mice, and there have been no studies on its association with sheep lung diseases. It is unclear whether the FOXF1 gene is related to the pneumonia phenotype, whether there are significant association loci, and whether there are association lines. There are no reports on molecular markers associated with resistance to mycoplasma pneumonia in sheep and their applications. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to the resistance to mycoplasma pneumonia lesions in sheep and its application. The present invention finds the significantly associated sites on the sheep genome and its annotated gene FOXF1 through GWAS of pneumonia lesion phenotype, and further studies show the correlation between the significantly associated sites (chr14:13215150) at 192315bp from the FOXF1 gene, its different genotypes and the mycoplasma pneumonia lesions in sheep, providing a reference basis for sheep disease-resistant breeding, and providing genetic engineering means for the cultivation of mycoplasma pneumonia-resistant sheep varieties, so as to accelerate the disease-resistant breeding process.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A molecular marker associated with resistance to mycoplasma pneumonia in sheep, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, the R at the 188 bp represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker. The site of the molecular marker is 192315 bp downstream of the FOXF1 gene, and the site has an A / G mutation at chr.14:13215150, which leads to the A / G polymorphism of sheep at the associated site.

[0008] As described above, the molecular marker related to the resistance to mycoplasma pneumonia lesions in sheep is used in sheep assisted breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the R at the 188bp position represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker; among which the resistance to mycoplasma pneumonia lesions of individuals carrying the AA genotype is significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

[0009] The KASPar primer pair for detecting the molecular marker associated with resistance to ovine mycoplasma pneumonia lesions as described above is characterized in that it includes nucleotide sequences such as those shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0010] The detection kit for detecting the molecular markers associated with resistance to sheep mycoplasma pneumonia lesions as described above is characterized in that the detection kit comprises a primer pair with nucleotide sequences as shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0011] The method for detecting the molecular markers related to the resistance to mycoplasma pneumonia lesions in sheep as described above is characterized in that it includes providing DNA from the blood of the sheep to be tested for amplification, and identifying the specific site where R is A or G at the 188bp of the nucleotide sequence of the amplified product as shown in SEQ ID NO.1, wherein the resistance to mycoplasma pneumonia lesions of individuals carrying the AA genotype is significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

[0012] Furthermore, the amplification uses a primer pair whose nucleotide sequences are shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0013] Application of the KASPar primer pair, detection kit or method for detecting the molecular markers associated with sheep Mycoplasma pneumonia lesion resistance as described above in screening for detection of high sheep Mycoplasma pneumonia lesion resistance.

[0014] The use of the KASPar primer pair, detection kit or method for detecting the molecular marker related to the resistance to mycoplasma pneumonia lesions in sheep as described above in sheep breeding, further, the breeding is to cultivate a sheep breed with high resistance to mycoplasma pneumonia lesions; when the R at the 188bp of the nucleotide sequence of the molecular marker as shown in SEQ ID NO.1 is an A or G polymorphism, when the resistance to mycoplasma pneumonia lesions in sheep carrying the AA genotype is significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

[0015] The beneficial effects of the present invention are:

[0016] The present invention provides a molecular marker related to the resistance to mycoplasma pneumonia lesions in sheep. The FOXF1 gene is obtained by screening as a gene for screening molecular markers related to the resistance to mycoplasma pneumonia lesions in sheep. The obtained molecular marker is an A / G polymorphic site at 192315 bp downstream of the FOXF1 gene. Sheep individuals with an AA genotype at the site have relatively good resistance to mycoplasma pneumonia, that is, the resistance to mycoplasma pneumonia lesions of sheep individuals carrying the AA genotype is significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

[0017] The present invention also provides the application of a primer pair or a detection kit or a detection method for detecting the molecular marker in the detection of resistance to Mycoplasma ovipneumoniae, and effectively identifies whether the sheep are of the dominant trait type by measuring the polymorphic genotype of the molecular marker, thereby providing an effective detection means for the selection and breeding of sheep resistant to Mycoplasma pneumoniae. The present invention can be used to select AA homozygous sheep as breeding sheep for breeding by detecting the polymorphic sites of the molecular marker, so as to speed up the screening of sheep with better resistance to Mycoplasma pneumoniae, effectively save costs, cultivate high-quality meat sheep resistant to Mycoplasma pneumoniae, and help improve the economic benefits of the sheep breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is a Manhattan plot of the significant associated loci annotated for the sheep FOXF1 gene as a molecular marker; wherein the loci significantly associated with the pneumonia phenotype are located on chromosome 14.

[0019] Figure 2 This is the KASPar SNP typing result of the sheep chr.14:g.13215150A>G mutation site in the present invention; among them, the blue dot near the right side represents the AA genotype, the red dot near the middle represents the AG or GA genotype, and the green dot near the left side represents the GG genotype.

[0020] Figure 3 Schematic diagram of lung tissue pathology scoring.

[0021] Figure 4This is the result of the association analysis between different genotypes of individual sheep mutation sites and FOXF1 gene expression levels in the present invention. DETAILED DESCRIPTION

[0022] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0023] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the examples are of analytical grade or above.

[0024] Example 1 Establishment of Genotyping Detection Method

[0025] (1) Primer sequence design

[0026] The present invention combines 266 lung pathology score phenotype data and GWAS results (such as 23480428 SNP data filtered from 912 sheep) Figure 1 ), and screened genes that affect phenotypic traits. After a large amount of whole genome resequencing data comparison and analysis, a significant association site on the sheep genome was found. The site (chr14:13215150) is 192315bp away from the FOXF1 gene. It is located at the 188th bp of the nucleotide sequence shown in SEQ ID NO.1, where R represents A or G.

[0027] The above SEQ ID NO.1:

[0028] GTTTCTCTCAGTGCTGACCTCCATGGCCTAGGATGTGGGTCAGCACACAGTAGGTGCCTAATAACTACCCAGAGAATGGATGGATTCCCCGTGGTCCCTCCCCTGCCTCTCTCACCCTCATCCTCTGCAAGCTCCAGGAG CCCAGAGGGCACCAGCTGGCGTGACGAGTAACAGCCTGGACAGGCRGACACCAGCCCCTCCCTCCGTAACGTCCTCCTCCTCATCTGTATGCGGTCTCCCTCGCTACGAGTAACCTGGCACCAACCCCGCCATACCTCCA

[0029] A conservative sequence was selected near the A / G polymorphic site at chr.14:13215150, the specific sequence is shown in SEQ ID NO.1, and R at the 188th bp thereof represents A or G. A KASPar primer pair was designed for the polymorphic site where R at the 188th bp of the sequence as shown in SEQ ID NO.1 represents A or G, so as to be used for specific detection of the polymorphic site. The nucleotide sequence of the KASPar primer pair is: Forward primer A1 for detecting AlleleA (SEQ ID NO.2):

[0030] 5′-GAAGGTGACCAAGTTCATGCTGAGTAACAGCCTGGACAGGCA-3′;

[0031] Forward primer A2 for detecting AlleleG (SEQ ID NO.3):

[0032] 5′-GAAGGTCGGAGTCAACGGATTAGTAACAGCCTGGACAGGCG-3′;

[0033] Universal reverse primer C (SEQ ID NO. 4): 5'-GAGGGAGACCGCATACAGATG-3'.

[0034] The above primers were commissioned to Beijing Sangon Biotechnology Co., Ltd. for synthesis. Each set of primers in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C for use.

[0035] (2) DNA quality control

[0036] Blood from sheep was frozen in a -20℃ refrigerator, and DNA was extracted using a kit. The quality of the extracted genomic DNA was then tested by 1% agarose electrophoresis and Nanodrop2100, respectively. The DNA template obtained was required to meet the following requirements: agarose electrophoresis showed a single DNA band without obvious diffusion; Nanodrop2100 detected A260 / 280 between 1.8-2.0, indicating that the DNA sample had no protein contamination; A260 / 230 between 1.8-2.0, indicating that the DNA sample had a low salt ion concentration; and no obvious light absorption at 270nm, indicating that the DNA sample had no phenol contamination. According to the KASP detection technology of LGC, a British company, and the size of the genome, the amount of DNA was calculated to be 10-20ng / sample, and the diluted DNA template concentration was 10-20ng / μL for standby use.

[0037] (3) Genotyping

[0038] First, 1.5 μL of the diluted DNA template to be tested (10-20 ng / μL) and the blank control (No template control, NTC) were added to the 384-well reaction plate using the K-pette dispensing workstation, and dried at 60°C for 30 min (drying oven, LGC company), and the DNA became dry powder for use. Then, 1×Master mix (Part No. KBS-1016-011 for 1536 microplates) and the primer mixture were added to each reaction well using the Meridian sample loading workstation under the Kraken operating system. After the Mix was dispensed, the microplate was immediately placed on the Kube heat sealer and the Fusion laser sealer in turn to seal the film, and the high-throughput water bath PCR amplification was performed using the Hydrocycler. The PCR reaction was carried out in the high-throughput water bath system Hydrocycler, and the specific procedure was as follows:

[0039] Pre-denaturation at 94°C for 15 minutes;

[0040] 94℃, 20 seconds (denaturation) - 61℃-55℃, 1 minute (renaturation & extension), 10 cycles of touch down sequence, decreasing 0.6℃ per cycle;

[0041] Amplification was continued for 26 cycles from 94°C, 20 seconds (denaturation) to 55°C, 60 seconds.

[0042] After amplification, the BMG PHERAstar instrument was used to detect the fluorescence signal and check the typing. The specific results can be seen as follows Figure 2 As shown in the figure, each dot represents a sample to be tested, where the green dot close to the left side indicates that the site is a homozygous genotype "GG"; the blue dot close to the right side indicates that the site is a homozygous genotype "AA"; the red dot close to the middle indicates that the site is a heterozygous genotype "AG" or "GA"; the gray dot indicates typing failure.

[0043] (4) Application of the molecular markers of the present invention in association analysis of marker traits of sheep mycoplasma pneumonia

[0044] The experiment grouped the 203 Hu sheep tested for polymorphism at the loci according to genotype, and established the least squares model described below to conduct an association analysis between genotype and sheep Mycoplasma pneumonia phenotype.

[0045] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0046] Among them, Y ijklis the observed value of the trait, μ is the overall mean, Genotype i is the genotype effect, P j is the batch effect, F k is the paternal effect, M l is the maternal effect, ε ijkl is a random error, assuming that ε ijlmk Independent of each other, subject to N(0,σ 2 )distributed.

[0047] The results of genotype detection showed that among the 203 individuals, there were 116 individuals with AA genotype, 78 individuals with AG genotype, and 9 individuals with GG genotype; the phenotypic characteristics of Hu sheep mycoplasma pneumonia were lung tissue pathology scores, specifically hematoxylin-eosin staining of lung tissue, and the scoring example was as follows Figure 3 As shown, the lesion scores are as follows: +1, mild +2, mild +3, moderate +4, severe; +5, very severe. In the figure, the triangle indicates that some alveoli retain their original structure; the five-pointed star indicates that some bronchial lumens contain a large number of neutrophils and lymphocytes (+1); the green arrow indicates hyperplasia of some peribronchial lymphoid follicles (+1); the blue arrow indicates compensatory expansion of some alveoli (+2); the orange arrow indicates inflammatory cell infiltration at the junction of the pulmonary interstitium and the lung parenchyma (+2); the yellow arrow indicates partial collapse of lung tissue and substantial lesions, mainly filled with monocytes (+2). The higher the score, the more severe the lung damage caused by mycoplasma pneumonia and the lower the ability to resist mycoplasma pneumonia. The results of the genotype-trait association analysis are shown in Tables 1 and Figure 4 shown.

[0048] Table 1 Association analysis between chr.14:13215150 polymorphism and mycoplasma pneumonia in sheep

[0049]

[0050] Note: Data in the same row with different letters in the subscripts indicate significant differences (p<0.05), and data with the same letters in the subscripts indicate no significant differences (p>0.05).

[0051] The chr.14:g.13215150A>G mutation site was significantly correlated with mycoplasma pneumonia lesions in Hu sheep (p<0.05), among which the pathological score of AA genotype individuals was 5.99±0.55, which was significantly lower than the pathological score of AG genotype individuals (8.23±0.81) (P<0.05) and the pathological score of GG genotype individuals (7.22±2). The results showed that the resistance of sheep carrying AA genotype to mycoplasma pneumonia lesions was significantly higher than that of sheep carrying AG genotype, and the difference between the resistance of sheep carrying AG genotype to mycoplasma pneumonia lesions and those carrying GG genotype was not significant, indicating that the AA genotype has a higher resistance to mycoplasma pneumonia lesions.

[0052] In summary, when breeding, consider selecting sheep with AA genotype for seed preservation, which have better resistance to mycoplasma pneumonia lesions. Artificial insemination with semen of rams with AA genotype during breeding can be used to breed high-quality meat sheep resistant to mycoplasma pneumonia, thereby improving production efficiency and being low-carbon and environmentally friendly.

Claims

1. A molecular marker associated with resistance to ovine mycoplasma pneumonia lesions, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, wherein R at the 188th bp is A or G, and the mutation leads to the A / G polymorphism of the molecular marker.

2. Application of molecular markers related to resistance to sheep mycoplasma pneumonia in sheep assisted breeding, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the R at the 188 bp position represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker; the resistance of individuals carrying the AA genotype to mycoplasma pneumoniae lesions is significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

3. A KASPar primer pair for detecting the molecular marker associated with resistance to ovine mycoplasma pneumonia lesions according to claim 1, characterized in that: It includes nucleotide sequences such as those shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.

4.

4. A detection kit for detecting the molecular marker associated with resistance to ovine mycoplasma pneumonia lesions according to claim 1, characterized in that: The detection kit comprises a primer pair having nucleotide sequences as shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.

4.

5. A method for detecting the molecular marker associated with resistance to mycoplasma pneumonia in sheep according to claim 1, comprising providing DNA from the blood of the sheep to be tested for amplification, and identifying the specific site where R is A or G at the 188 bp of the nucleotide sequence of the amplified product as shown in SEQ ID NO.1, wherein: The resistance of individuals carrying the AA genotype to mycoplasma pneumoniae lesions was significantly higher than that of individuals carrying the AG genotype, and higher than that of individuals carrying the GG genotype.

6. The method according to claim 5, characterized in that The amplification uses a primer pair whose nucleotide sequences are shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.

4.

7. The method according to claim 6, characterized in that After amplification, the typing result is determined by detecting the fluorescence signal.

8. Use of the KASPar primer pair according to claim 3, the detection kit according to claim 4, or the method according to any one of claims 5 to 7 in screening for high resistance to Mycoplasma ovis pneumonia lesions.

9. Use of the KASPar primer pair according to claim 3, or the detection kit according to claim 4, or the method according to any one of claims 5 to 7 in sheep breeding.

10. The use according to claim 9, characterized in that The breeding is for cultivating sheep breeds with high resistance to mycoplasma pneumonia lesions.

Images