Multi-PCR detection nucleic acid composition and detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus

Abstract

The invention discloses a multiplex PCR (Polymerase Chain Reaction) detection nucleic acid composition for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus and a detection product, and relates to the technical field of porcine pathogen detection. The detection nucleic acid composition comprises a first nucleic acid combination as shown in SEQ ID NO.1-2 and used for detecting the porcine epidemic diarrhea virus, a second nucleic acid combination as shown in SEQ ID NO.4-5 and used for detecting the porcine group A rotavirus, and a third nucleic acid combination as shown in SEQ ID NO.7-8 and used for detecting the porcine transmissible gastroenteritis virus. The primer probe composition can specifically and simultaneously detect the porcine epidemic diarrhea virus, the porcine group A rotavirus and the porcine transmissible gastroenteritis virus, and has the technical advantages of high sensitivity and good specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of pig pathogen detection, and in particular to a multiplex PCR detection nucleic acid composition and a detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus. Background Art

[0002] Porcine viral diarrhea is a common disease in pigs, among which the most serious pathogens are porcine epidemic diarrhea virus (PEDV), porcine group A rotavirus (PRVA) and porcine transmissible gastroenteritis virus (TGEV). The three pathogens can infect pigs of all ages and can cause symptoms such as vomiting, watery diarrhea and dehydration. The harm to piglets under 10 days old is particularly serious, with high morbidity and mortality rates, which can reach 100%. Therefore, there is an urgent need for a simple and efficient technical product that can detect infection with three pathogens at the same time. The following are two commonly used detection technologies:

[0003] RT-PCR: Reverse transcriptase PCR (RT-PCR) is a variation of the polymerase chain reaction that amplifies the target RNA. The addition of a reverse transcriptase (RT) enzyme prior to PCR makes it possible to amplify and detect the RNA target. The reverse transcriptase transcribes the template RNA and forms complementary DNA (cDNA). The single-stranded cDNA is converted into double-stranded DNA by a DNA polymerase. These DNA molecules can now be used as templates for the polymerase chain reaction.

[0004] RT-qPCR: It is an experimental method used in PCR experiments using RNA as the starting material. In this method, total RNA or messenger RNA (mRNA) is first transcribed into complementary DNA (cDNA) by reverse transcriptase. Subsequently, qPCR (Taqman probe) reaction is carried out using cDNA as a template. Taqman probe is composed of an oligonucleotide sequence labeled with a fluorescent reporter group at the 5' end and a quencher group at the 3' end, and specifically binds to the target gene. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group, and the instrument will not detect the fluorescent signal at this time. During PCR amplification, the template DNA denatures and melts, and the Taqman probe specifically binds to the target gene. The Taq enzyme has 5'-3' nuclease activity, which extends to the probe binding site, hydrolyzes the probe, separates the fluorescent reporter group and the quencher group, and detects the fluorescent signal. The intensity of the fluorescent signal is proportional to the concentration of the amplified DNA product. The fluorescent signal is detected and collected by the instrument to obtain an "amplification curve", and the concentration of the template in the system is reflected by the intensity of the fluorescent signal.

[0005] The existing RT-PCR detection technology has the following defects: its result analysis is relatively rough (agarose gel electrophoresis), and open result analysis is prone to contamination. RT-qPCR detection technology has high specificity, high detection sensitivity, and closed-tube detection can effectively prevent contamination. However, most of the commercialized test kits are PCR amplifications of single viral genes, and cannot simultaneously meet the differential diagnosis of three viruses: porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine transmissible gastroenteritis virus. The clinical symptoms of pigs infected with the three viruses are consistent, and it is impossible to quickly and accurately monitor the occurrence of samples that cause porcine diarrhea viruses.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The object of the present invention is to provide a multiplex PCR detection nucleic acid composition and detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus to solve the above technical problems.

[0008] The present invention is achieved in that:

[0009] In the first aspect, the present invention provides a multiplex PCR detection nucleic acid composition for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, which includes: a first nucleic acid combination for detecting porcine epidemic diarrhea virus as shown in SEQ ID NO.1-2, a second nucleic acid combination for detecting porcine group A rotavirus as shown in SEQ ID NO.4-5, and a third nucleic acid combination for detecting porcine transmissible gastroenteritis virus as shown in SEQ ID NO.7-8.

[0010] The primer probe combination is designed based on the M gene of porcine epidemic diarrhea virus, the VP7 gene of porcine group A rotavirus and the N gene of porcine transmissible gastroenteritis virus. The detection nucleic acid combination has the technical advantages of strong detection specificity and high sensitivity. It can meet the needs of qPCR detection and high-resolution melting curve detection.

[0011] When performing high-resolution melting curve detection, there is no need to set up probes. High-resolution melting curve detection is a technology that combines PCR amplification technology with melting curve analysis technology, relying on high-resolution temperature detection PCR instruments and new saturated fluorescent dyes to achieve gene sequence analysis. The principle is that after the PCR is completed, the high-resolution melting program is directly run on the PCR amplification product, and the fluorescence intensity changes of the saturated fluorescent dye in the amplicon are detected by the instrument to obtain a characteristic melting curve. Finally, the sequence variation is judged based on the position and morphological changes of the melting curve, and the sequence differences of a single base can be distinguished.

[0012] The detection nucleic acid composition of porcine epidemic diarrhea virus (PEDV) M gene includes the following primer probes:

[0013] Porcine epidemic diarrhea virus (PEDV) M gene forward primer: 5' GCTAAATGGTTGCTCGACTGGTACA 3' (SEQ ID NO: 1)

[0014] PEDV M gene reverse primer: 5' ACCTTCACGTCCGTAGACAACTG 3' (SEQ ID NO: 2)

[0015] PEDV M gene probe: 5'TAATCGTCACAGTCGTTCCAAGTCCA 3' (SEQ ID NO: 3)

[0016] PEDV M primers can detect porcine epidemic diarrhea virus infection sensitively and specifically.

[0017] The detection nucleic acid composition of porcine group A rotavirus (PRVA) VP7 gene includes the following primer probes:

[0018] PRVA VP7 gene forward primer: 5' ATCCAGCTTCCGATGTACTTGAC 3' (SEQ ID NO: 4)

[0019] PRVA VP7 gene reverse primer: 5' CCATATTACTCTCGCATCATTTTCT3' (SEQ ID NO: 5)

[0020] PRVA VP7 gene probe: 5' ACGGCTGATCCAAGCACAGCTCGA3' (SEQ ID NO: 6).

[0021] PRVA VP7 primers can sensitively and specifically detect porcine group A rotavirus infection.

[0022] The detection nucleic acid composition of the N gene of porcine transmissible gastroenteritis virus (TGEV) includes the following primer probes:

[0023] TGEV N gene forward primer: 5' CTGACCTCCCTGCCAATCA 3' (SEQ ID NO: 7)

[0024] TGEV N gene reverse primer: 5' ATGTGCTAGACACAGGAACACATTC 3' (SEQ ID NO: 8)

[0025] TGEV N gene probe: 5' AGTGCCAAGACTCATTACCCACAGGC 3' (SEQ ID NO: 9).

[0026] The multiplex PCR detection nucleic acid composition also includes a first probe for detecting porcine epidemic diarrhea virus as shown in SEQ ID NO.3, a second probe for detecting porcine group A rotavirus as shown in SEQ ID NO.6, and a third probe for detecting porcine transmissible gastroenteritis virus as shown in SEQ ID NO.9, and the first probe, the second probe and the third probe all carry a fluorescent reporter group and a fluorescent quencher group.

[0027] In a preferred embodiment of the present invention, the fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670, and the fluorescent quencher group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

[0028] In a preferred embodiment of the present invention, the fluorescent reporter group on the first probe is FAM, and the fluorescent quencher group on the first probe is BHQ1; the fluorescent reporter group on the second probe is ROX, and the fluorescent quencher group on the first probe is BHQ2; the fluorescent reporter group on the third probe is CY5, and the fluorescent quencher group on the first probe is BHQ1.

[0029] In a second aspect, the present invention also provides the use of a multiplex PCR detection nucleic acid composition in the preparation of a multiplex PCR detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, wherein the multiplex PCR detection product is a reagent, a kit, a chip or a detector.

[0030] In a preferred embodiment of the present invention, in the multiplex PCR detection system, the final concentration of the first nucleic acid combination is 0.1 to 0.3 μM, the final concentration of the second nucleic acid combination is 0.1 to 0.3 μM, and the final concentration of the third nucleic acid combination is 0.1 to 0.3 μM;

[0031] Preferably, the final concentration of the first probe is 0.2 μM, the final concentration of the second probe is 0.2 μM, and the final concentration of the third probe is 0.2 μM.

[0032] In a preferred embodiment of the present invention, the multiplex PCR detection system further includes qPCR Mix and reverse transcriptase.

[0033] The reverse transcriptase is present in the form of reverse transcriptase mix, for example. In addition, the multiplex PCR detection system may also include the following enzyme reagents, such as selected from DNA polymerases, preferably hot start DNA polymerases, such as Tth DNA polymerase, Taq DNA polymerase, and the like.

[0034] The qPCR Mix includes buffer system reagents, including but not limited to PB series, Tris series, etc. The qPCR Mix includes lyophilization protective agents, such as but not limited to at least one of mannitol, trehalose, dextran, gelatin, hydrogenated maltose, and sucrose.

[0035] Anti-PCR inhibitor factors are added to the qPCR Mix, such as spermidine, trehalose, betaine, etc., so that the method provided by the present invention is more suitable for the detection of complex animal clinical samples. The final concentration of spermidine added to the multiplex PCR detection system is 0.1mM to 5mM. For example, 0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 1mM, 1.5mM, 2mM, 3mM or 5mM.

[0036] The detection product (such as a kit) provided by the present invention may also optionally include any reagents and / or consumables acceptable in the art for PCR reaction or for preparing a PCR reaction system. Specific examples may include but are not limited to one or more of dNTP, salt or salt solution, negative control, positive control, blank control, calibrator and PCR reaction container.

[0037] Multiplex PCR assay products also include saturation dyes;

[0038] Preferably, the saturation dye is selected from any one of SYBRGreen I, EvaGreen, Sytox Green, EtBr, SYBR GreenII, SYBR Gold, SYBR Safe, LC Green, GelGreen, GelRed, DAPI, Syto 9, Sytox Blue, SytoxRed, Sytox Orange and ThiazoleOrange.

[0039] In a preferred embodiment of the present invention, the procedure of multiplex PCR detection includes: 55℃±0.5℃, 15-16min; 94℃±0.5℃, 30s-35s, 94℃±0.5℃, 5s-8s, 60℃±0.5℃, 30s-34s, cycle 40-45 times, and collect fluorescence.

[0040] The samples that can be tested by this detection product include but are not limited to: pig tissue samples, environmental samples, etc.

[0041] Environmental samples are selected from soil, water, air, pig house, etc. Tissue samples are selected from animal tissue samples.

[0042] In the third aspect, the present invention also provides a multiplex PCR detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, which includes: the above-mentioned multiplex PCR detection nucleic acid composition, the multiplex PCR detection product is a reagent, a kit, a chip or a detector.

[0043] In a preferred embodiment of the present invention, the multiplex PCR detection product further comprises: qPCR Mix and reverse transcriptase, or a saturation dye; the saturation dye is selected from any one of SYBRGreen I, EvaGreen, Sytox Green, EtBr, SYBR GreenII, SYBR Gold, SYBR Safe, LC Green, GelGreen, GelRed, DAPI, Syto 9, Sytox Blue, SytoxRed, Sytox Orange and ThiazoleOrange.

[0044] In a preferred embodiment of the present invention, the multiplex PCR detection product further comprises a positive control and a negative control, wherein the positive control comprises a pseudoviral nucleic acid of at least one of the following viruses;

[0045] Porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus.

[0046] For example, the positive control is a mixture of three pseudovirus nucleic acids including porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus.

[0047] A pseudovirus is a retrovirus that can integrate the envelope glycoprotein of another different type of virus, thereby forming an envelope with an exogenous virus, while the genome retains the characteristics of the retrovirus's own genome.

[0048] The present invention has the following beneficial effects:

[0049] The present invention provides a triple PCR detection primer-probe combination for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, wherein the primer-probe combination is designed based on the M gene of porcine epidemic diarrhea virus, the VP7 gene of porcine group A rotavirus and the N gene of porcine transmissible gastroenteritis virus, respectively. The primer-probe combination can meet the qualitative and quantitative detection requirements of pathogens.

[0050] The inventor prepared the primer-probe combination into a kit, which can specifically detect porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus at the same time, with a sensitivity of 10 copies / reaction. In addition, the present invention also established a fluorescent PCR detection method, which can quickly and accurately identify porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, and has no cross reaction with swine fever virus and porcine reproductive and respiratory syndrome virus, and has good specificity. The proposal of the present invention is helpful to realize the detection and prevention of common and frequently occurring diseases of pigs as soon as possible. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0052] Figure 1 The sensitivity test results of three pseudoviruses diluted to 10 copies / μL are shown;

[0053] Figure 2 The figure shows the sensitivity test results of three pseudoviruses diluted to 5 copies / μL. DETAILED DESCRIPTION

[0054] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0055] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0056] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0057] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0058] Example 1

[0059] The embodiment provides a triple real-time fluorescent RT-PCR detection kit, reaction system and detection method for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus.

[0060] (1) Based on the M gene sequence of porcine epidemic diarrhea virus, the VP7 gene sequence of porcine group A rotavirus, and the N gene sequence of porcine transmissible gastroenteritis virus on Genbank, specific TagMan probes and primers were designed using Primer 5.0 software. The primers and probes are shown in Table 1.

[0061] Table 1 Primer sequences

[0062]

[0063] (2) Construction of pseudovirus and preparation of positive control

[0064] At Shanghai Sangon Biotechnology, pseudoviruses of the M gene of porcine epidemic diarrhea virus, pseudoviruses of the VP7 gene of porcine group A rotavirus, and pseudoviruses of the N gene of porcine transmissible gastroenteritis virus were packaged.

[0065] Pseudovirus nucleic acid extraction:

[0066] The operation steps of the column-type viral RNA extraction and purification kit (Sangon Biotechnology Product No.: B518667) are as follows:

[0067] a. Add 0.2 mL of liquid pseudovirus into a 1.5 mL centrifuge tube.

[0068] b. Add 0.6 mL of Buffer Rlysis-VG to the 0.2 mL sample obtained in the first step, shake for 30 seconds to mix, and place at room temperature for 10 minutes.

[0069] c. Add 0.6 mL of anhydrous ethanol, cover the tube and vortex for 15 seconds.

[0070] d. After a brief centrifugation, transfer 650 μl of the solution to a centrifugal adsorption column and place at room temperature for 2 minutes.

[0071] e. Centrifuge at 12,000 rpm for 1 min at room temperature, discard the permeate, and put the adsorption column back into the collection tube.

[0072] f. After brief centrifugation, transfer all of the remaining solution to the centrifugal adsorption column in step 4 and leave it at room temperature for 2 minutes.

[0073] g. Centrifuge at 12,000 rpm for 1 min at room temperature, discard the penetration solution, and put the centrifugal adsorption column back into the collection tube.

[0074] h. Add 500 μl RPE Solution to the centrifugal adsorption column, centrifuge at 12,000 rpm for 1 min at room temperature, discard the permeate, and put the centrifugal adsorption column back into the collection tube.

[0075] i. Repeat step h once

[0076] j. Centrifuge at 12,000 rpm for 2 min at room temperature and discard the centrifuge tube containing the penetration solution.

[0077] k. Place the centrifugal adsorption column into a new RNase-free 1.5 mL centrifuge tube, add 30-100 μl DEPC-treated ddH2O to the middle of the filter membrane of the centrifugal adsorption column, and then leave it at room temperature for 2 minutes.

[0078] 1. Centrifuge at 12,000 rpm for 2 minutes at room temperature. The sample in the collection tube is the viral RNA.

[0079] (3) Amplification reaction

[0080] 2×qPCR SuperMix for qPCR 10μl, 10μmol / L PEDV MF / PEDV MR / PEDV MP 0.4μl each, 10μmol / L PRVA VP7-F / PRVA VP7-R / PRVA VP7-P 0.4μl each, 10μmol / L TGEV NF / TGEVN R / TGEV NP 0.4μl each, RT Enzyme Mix 0.5μl, positive control is 2μl of extracted pseudovirus nucleic acid (the nucleic acids extracted from the three pseudoviruses are mixed in a volume ratio of 1:1:1, and 2μL of the mixture is taken as the positive control for amplification detection), negative control is 2μl of nuclease-free water, and 3.9μl of sterile water is added to make the PCR system 20μl.

[0081] (4) Reaction parameters

[0082] Reverse transcription was performed at 55°C for 15 min; pre-denaturation at 94°C for 30 s, 94°C for 5 s, and 60°C for 34 s (fluorescence was collected in this step, and fluorescence values ​​of three channels, FAM, ROX and Cy5, were collected at the same time), for a total of 40 cycles.

[0083] (5) Result determination

[0084] A. Validity determination: The positive control should show a specific amplification curve and the Ct value should be less than 30, and the negative control should have no Ct value; otherwise the test results are invalid.

[0085] B. Samples with a Ct value of ≤40 in the FAM channel and No Ct in the ROX channel and CY5 channel were determined to be positive for porcine epidemic diarrhea virus;

[0086] C. Samples with Ct values ​​≤40 in ROX channel and No Ct in FAM channel and CY5 channel were determined to be positive for porcine group A rotavirus;

[0087] D. Samples with a Ct value of ≤40 in the CY5 channel and No Ct in the ROX channel and FAM channel were determined to be positive for porcine transmissible gastroenteritis virus.

[0088] Example 2

[0089] The triple real-time fluorescence RT-PCR detection kit for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus provided in Example 1 was specifically verified.

[0090] The inactivated swine fever virus vaccine "recombinant baculovirus inactivated vaccine of swine fever virus E2 protein (Rb-03 strain)" was purchased from Tiankang Biological Co., Ltd.; the porcine reproductive and respiratory syndrome live vaccine (CH-1R strain) was purchased from Harbin Pharmaceutical Group Biological Vaccine Company. The corresponding nucleic acid was extracted using a viral DNA / RNA extraction kit as a template, and nucleic acids extracted from porcine epidemic diarrhea pseudovirus, porcine group A rotavirus and porcine transmissible gastroenteritis pseudovirus were used as positive controls, and nuclease-free water was used as a negative control. The kit provided in Example 1 of the present invention was used for amplification, and the results are shown in Table 2.

[0091] Table 2 Detection results of the kit of the present invention for different viruses

[0092]

[0093] The results showed that the kit of the present invention had no cross reaction with classical swine fever virus and porcine reproductive and respiratory syndrome virus, and had good specificity.

[0094] Example 3

[0095] The sensitivity of the triple real-time fluorescence RT-PCR detection kit for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus provided in Example 1 was verified.

[0096] The three extracted pseudovirus nucleic acids were diluted with nuclease-free water, and the concentrations of the dilutions were quantified using a digital PCR instrument (Zhenzhun Biotech). The three pseudoviruses were diluted to quantitative concentrations of 1000 copies / μL, 50 copies / μL, 10 copies / μL, and 5 copies / μL, respectively, for sensitivity testing, with each test repeated 5 times.

[0097] The results of fluorescence quantitative detection of 10 copies / μL and 5 copies / μL are shown in Figure 1 and Figure 2As shown, the blue amplification curve refers to porcine epidemic diarrhea virus, the red amplification curve refers to porcine group A rotavirus, and the green amplification curve refers to porcine transmissible gastroenteritis virus. The detection sensitivity of porcine epidemic diarrhea virus is 10 copies / reaction, the detection sensitivity of porcine group A rotavirus is 5 copies / reaction, and the detection sensitivity of porcine transmissible gastroenteritis virus is 5 copies / reaction.

[0098] Example 4

[0099] The triple real-time fluorescent RT-PCR detection reagent for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus in Example 1 is added with the anti-PCR inhibitor factor spermidine to tolerate different inhibitor conditions.

[0100] Using nucleic acids extracted from porcine epidemic diarrhea pseudovirus, porcine group A rotavirus and porcine transmissible gastroenteritis pseudovirus as templates, common animal clinical sample PCR inhibitors such as heme, urea and choline acid were added to the nucleic acids extracted from porcine epidemic diarrhea pseudovirus, porcine group A rotavirus and porcine transmissible gastroenteritis pseudovirus at certain concentrations (see Table 3 for added concentrations), and fluorescence quantitative PCR detection was performed using amplification reagents containing spermidine and those not containing spermidine, respectively. The final concentration of spermidine was 2mM, and the negative control was water. The results are as follows:

[0101] Table 3 Test results of the kit of the present invention for different types of PCR inhibitor tolerance

[0102]

[0103] The results show that the anti-PCR inhibitor factor spermidine added to the kit of the present invention has good tolerance to heme, urea and choline acid, and is more suitable for the detection of animal clinical samples.

[0104] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A multiplex PCR detection nucleic acid composition for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, characterized in that: It includes: The first nucleic acid combination for detecting porcine epidemic diarrhea virus as shown in SEQ ID NO.1-2, the second nucleic acid combination for detecting porcine group A rotavirus as shown in SEQ ID NO.4-5, and the third nucleic acid combination for detecting porcine transmissible gastroenteritis virus as shown in SEQ ID NO.7-8.

2. The multiplex PCR detection nucleic acid composition according to claim 1, characterized in that: The multiplex PCR detection nucleic acid composition also includes a first probe for detecting porcine epidemic diarrhea virus as shown in SEQ ID NO.3, a second probe for detecting porcine group A rotavirus as shown in SEQ ID NO.6, and a third probe for detecting porcine transmissible gastroenteritis virus as shown in SEQ ID NO.9, and the first probe, the second probe and the third probe all carry a fluorescent reporter group and a fluorescent quencher group.

3. The multiplex PCR detection nucleic acid composition according to claim 2, characterized in that: The fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670, and the fluorescent quencher group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

4. The multiplex PCR detection nucleic acid composition according to claim 3, characterized in that: The fluorescent reporter group on the first probe is FAM, and the fluorescent quencher group on the first probe is BHQ1; the fluorescent reporter group on the second probe is ROX, and the fluorescent quencher group on the first probe is BHQ2; the fluorescent reporter group on the third probe is CY5, and the fluorescent quencher group on the first probe is BHQ1.

5. Use of the multiplex PCR detection nucleic acid composition according to any one of claims 1 to 4 in preparing a multiplex PCR detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, characterized in that: The multiplex PCR detection product is a reagent, a test kit, a chip or a detector.

6. The use according to claim 5, characterized in that: In the multiplex PCR detection system, the final concentration of the first nucleic acid combination is 0.1 to 0.3 μM, the final concentration of the second nucleic acid combination is 0.1 to 0.3 μM, and the final concentration of the third nucleic acid combination is 0.1 to 0.3 μM; Preferably, the final concentration of the first probe is 0.2 μM, the final concentration of the second probe is 0.2 μM, and the final concentration of the third probe is 0.2 μM; Preferably, the multiplex PCR detection product further comprises a saturation dye; Preferably, the saturated dye is selected from any one of SYBRGreen I, EvaGreen, Sytox Green, EtBr, SYBR GreenII, SYBR Gold, SYBR Safe, LC Green, GelGreen, GelRed, DAPI, Syto 9, Sytox Blue, SytoxRed, Sytox Orange and ThiazoleOrange.

7. The use according to claim 5, characterized in that: The multiplex PCR detection system also includes qPCR Mix and reverse transcriptase; Preferably, the qPCR Mix includes an anti-PCR inhibitor factor, and the anti-PCR inhibitor factor is selected from spermidine, trehalose or betaine; Preferably, the final concentration of spermidine added to the multiplex PCR detection system is 0.1 mM to 5 mM.

8. The use according to claim 5, characterized in that: The procedure of the multiplex PCR detection includes: 55°C±0.5°C, 15-16 min; 94°C±0.5°C, 30s-35s, 94°C±0.5°C, 5s-8s, 60°C±0.5°C, 30s-34s, 40-45 cycles, and collecting fluorescence.

9. A multiplex PCR detection product for porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus, characterized in that: It includes: The multiplex PCR detection nucleic acid composition according to any one of claims 1 to 4, wherein the multiplex PCR detection product is a reagent, a kit, a chip or a detector.

10. The multiplex PCR detection product according to claim 9, characterized in that: The multiplex PCR detection product further comprises: qPCR Mix and reverse transcriptase, or saturation dye; Preferably, the multiplex PCR detection product further comprises a positive control and a negative control, wherein the positive control comprises a pseudoviral nucleic acid of at least one of the following viruses; Porcine epidemic diarrhea virus, porcine group A rotavirus and porcine transmissible gastroenteritis virus.

Images