Application of ZmRIN4 protein in regulation and control of corn root development

Abstract

The invention discloses application of ZmRIN4 protein in regulation and control of corn root development, and belongs to the technical field of biological breeding. The technical problem to be solved by the invention is how to regulate and control the root development of plants. In order to solve the technical problem, the invention provides application of the ZmRIN4 protein and the coding gene thereof in regulation and control of plant root development, and the ZmRIN4 protein is a protein with an amino acid sequence as shown in SEQ ID No.2. The application discloses the effect of ZmRIN4 in regulation and control of corn root development for the first time; the method can be applied to close-planting-resistant high-yield corn breeding and has a wide market prospect.

Description

Technical Field

[0001] The present application belongs to the field of biological breeding technology and discloses the application of ZmRIN4 protein in regulating corn root development. Background Art

[0002] Plant roots have the potential to improve plant growth and crop productivity. Lateral roots, in particular, are crucial organs for plants to absorb water and nutrients and cope with stress, playing a crucial role in adapting to various environmental conditions. Corn is my country's largest grain crop, leading in both yield and cultivated area, and plays a vital role in ensuring economic and social development. Corn is one of the dryland crops with high water requirements and is particularly sensitive to water stress. Drought is a major abiotic stress that restricts corn yield and threatens food security. Root phenotypic characteristics are an important tool for evaluating corn stress resistance. Root phenotypic traits that have been shown to be associated with stress resistance include root length, root growth angle, root biomass, total root number, number of root branches, and the number, angle, and number of layers of aerial roots. Generally speaking, corn varieties with well-developed root systems have greater resistance to lodging.

[0003] As the only underground organ of a plant, the root system plays a vital role in water and nutrient absorption and lodging resistance. Corn roots are fibrous. Those that grow from underground stem nodes are called underground roots, while those that grow from aboveground stem nodes are called aerial roots or support roots. The corn root system has multiple functions: First, absorption. Different root distributions within the soil result in varying levels of absorption. Strong root systems absorb abundant water and minerals, resulting in relatively high stress tolerance. Furthermore, they are also highly efficient at absorbing organic compounds such as amino acids, amides, and glucose. These substances participate in plant metabolism. Ammonia and nitrate nitrogen absorbed from the soil are converted by the corn roots into organic compounds that contribute to the construction and development of the aboveground parts. Second, corn provides anchoring support. Compared to other crops, corn has a relatively tall plant height, resulting in a more extensive root system. This complex root structure protects against wind and rain, preventing lodging. Aerial roots play a crucial role in anchoring and supporting the corn plant throughout the middle and late stages of growth. A strong root system provides more nutrients for plant growth, thereby increasing yield. At the same time, the above-ground and underground parts of crop growth are closely related. Quantitative analysis and research on crop root systems can also further help us understand the structure and morphology of the above-ground part of corn.

[0004] Significant progress has been made in the discovery of loci associated with maize root traits. Primary root growth in maize depends on flavonoid biosynthesis and auxin signaling, and two candidate genes, rtcs and Zm00001d012781, have been identified. QTL mapping for maize root number, length, orientation, and branching has identified 15 QTLs, with individual QTLs explaining 0.44% to 13.5% of the phenotypic variance. Comparison of transcriptome data from drought-resistant and drought-sensitive varieties identified 343 and 177 differentially expressed genes, respectively, and 10 hub genes involved in two significant correlation modules. A GWAS analysis of maize seedling drought tolerance identified 42 candidate genes. Overexpression of the ZmVPP1 gene, among them, enhances photosynthetic efficiency and promotes root development, thereby improving maize drought tolerance. The genetic architecture of maize root hair length has been elucidated, and 14 SNPs significantly associated with root hairs have been identified.

[0005] Although some QTLs for maize root-related traits have been located, since the root system is a complex quantitative trait regulated by multiple genes, existing studies have only been able to detect limited genetic loci from their respective research populations. Therefore, genetic analysis of maize root-related traits is still needed to deepen the understanding of the molecular mechanisms of maize root trait variation, which is of great theoretical significance for exploring crop resources that are resistant to stress and adapt to future climate change. Summary of the Invention

[0006] The technical problem to be solved by this application is how to regulate the root development of plants.

[0007] To solve the above technical problems, the present application provides an application, which is the application of a protein or a substance that regulates gene expression or a substance that regulates the content of the protein in any of the following items, wherein the gene encodes the protein, and the protein is ZmRIN4 protein;

[0008] A1) Application in regulating the development of plant underground roots;

[0009] A2) Application in the preparation of products for regulating the development of underground root systems of plants;

[0010] A3) Application in regulating the number and / or quantity of aerial root layers of plants;

[0011] A4) Application in the preparation of products for regulating the number and / or quantity of aerial root layers of plants;

[0012] A5) Application in plant breeding or plant-assisted breeding;

[0013] The ZmRIN4 protein may be any of the following proteins:

[0014] a1) The amino acid sequence is the protein shown in SEQ ID No. 2;

[0015] a2) a protein having at least 80% identity with the amino acid sequence shown in a1) obtained by substitution, deletion and / or addition of amino acid residues in the amino acid sequence shown in a1);

[0016] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0017] Furthermore, the evaluation indicators of the underground root development of the plant include main root length, number of root branches, root surface area, main root projected area and / or number of root tips, etc.

[0018] Furthermore, the number and / or quantity of aerial root layers of the plant may be root traits of the plant during its mature stage.

[0019] Furthermore, the root traits in the adult stage also include: root length, root volume and / or root biomass.

[0020] Furthermore, in the method described above, the ZmRIN4 protein may be derived from corn.

[0021] SEQ ID No. 1 consists of 80 amino acid residues.

[0022] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0023] A protein tag is a polypeptide or protein that is fused with a target protein using in vitro DNA recombination techniques to facilitate expression, detection, tracing, and / or purification of the target protein. Examples of protein tags include Flag, His, MBP, HA, myc, GST, and / or SUMO tags.

[0024] Furthermore, the connection described in a3) can be a peptide bond connection formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2), or a peptide bond connection formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0025] Furthermore, in the application, the plant breeding assessment index includes plant root development.

[0026] Furthermore, in the application, the purpose of the plant breeding includes cultivating target plants with improved root development.

[0027] Furthermore, in the application, the target plant with improved development can be used for plant breeding.

[0028] Furthermore, in the application, the purpose of plant breeding includes cultivating plants with reduced root development.

[0029] Furthermore, in the application, the plant with reduced root development can be used to study the mechanism of plant root development.

[0030] In the present application, the root system may be a seedling root system. The root system may also be a mature plant root system. In some embodiments of the present application, the mature plant stage is the corn flowering stage and within 21 days after flowering.

[0031] In the present application, the root development assessment indicators include the plant's main root length, number of root branches, root surface area, main root projection area, number of root tips, number of aerial root layers, etc.

[0032] In the present application, the improved root development is manifested as an increase or enhancement in the plant's main root length, number of root branches, root surface area, main root projected area, number of root tips and / or number of aerial root layers (compared to the wild-type control).

[0033] In the present application, the reduced root development is manifested as a decrease or reduction in the plant's main root length, number of root branches, root surface area, main root projected area, number of root tips and / or number of aerial root layers (compared to a decrease or reduction in the wild-type control).

[0034] Furthermore, in the application, the substance regulating gene expression or the substance regulating protein content is a biological material, and the biological material can be any of the following:

[0035] B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the ZmRIN4 protein or inhibits or reduces the content of the ZmRIN4 protein;

[0036] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0037] B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0038] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0039] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0040] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0041] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0042] B8), a nucleic acid molecule encoding the ZmRIN4 protein;

[0043] B9) An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing the nucleic acid molecule described in B8).

[0044] Furthermore, in the application, B1) the nucleic acid molecule may be a gRNA (gRNA gene) targeting the gene or a DNA molecule encoding the gRNA.

[0045] Furthermore, the nucleic acid molecule described in B8) may be a DNA molecule described in any one of g1) to g3) below:

[0046] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0047] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 3;

[0048] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0049] Furthermore, in the above application, the target nucleotide sequence of the gRNA may be positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0050] Furthermore, the expression cassette described in B2) refers to a DNA capable of expressing the gRNA in a host cell, and the DNA may include not only a promoter for initiating transcription of the sgRNA gene, but also a terminator for terminating transcription of the sgRNA gene.

[0051] Furthermore, the recombinant microorganism in B4) can specifically be yeast, bacteria, algae and fungi.

[0052] Furthermore, the plant tissue in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0053] Furthermore, the transgenic plant organ in B7) can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0054] Furthermore, the transgenic plant cell line, transgenic plant tissue and / or transgenic plant organ may or may not include reproductive materials.

[0055] Furthermore, the expression cassette described in B9) refers to a DNA capable of expressing the ZmRIN4 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the ZmRIN4 protein encoding gene, but also a terminator for terminating transcription of the ZmRIN4 protein encoding gene.

[0056] Furthermore, B9) the expression cassette may further comprise an enhancer sequence.

[0057] Furthermore, B9) the recombinant vector may contain the DNA molecule encoding the ZmRIN4 protein as shown in SEQ ID No. 1.

[0058] Furthermore, in the application, the plant is selected from monocotyledonous plants.

[0059] Furthermore, in the application, the monocotyledonous plant is selected from the grass family.

[0060] Furthermore, in the application, the grass plant is selected from the genus Zea mays.

[0061] Furthermore, in the application, the Zea plant is selected from corn (Zea mays L.).

[0062] The present application also provides a method for increasing or improving plant root development, the method comprising steps M1) or M2),

[0063] M1) knocking out the gene encoding the ZmRIN4 protein in the recipient plant by using the CRISPR / Cas system to reduce the expression level of the gene encoding the ZmRIN4 protein and / or the content of the ZmRIN4 protein in the recipient plant; the recipient plant is a plant containing the gene encoding the ZmRIN4 protein;

[0064] M2) Mutating any one, two or three of the following M2-1) to M2-5) in a gene in a recipient plant, wherein the recipient plant is a plant containing a gene encoding the ZmRIN4 protein, and the plant is corn,

[0065] M2-1), deleting the nucleotides AA at positions 2773-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0066] M2-2), deleting nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0067] M2-3), deleting the nucleotide A at position 2773 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0068] M2-4), deleting the nucleotides AAA at positions 2772-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0069] M2-5), replacing nucleotides AAA at positions 2773-2775 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn with AAAA.

[0070] Furthermore, in the method described above, M1) includes the step of introducing a gRNA gene targeting the gene encoding the ZmRIN4 protein and a gene encoding the Cas protein into the recipient corn.

[0071] Furthermore, in the method, the Cas protein may be a Cas9 protein.

[0072] Furthermore, in the method, the target nucleotide sequence of the gRNA gene may be SEQ ID No. 3, positions 2759-2778 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0073] Furthermore, in the method, the plant is selected from monocotyledonous plants.

[0074] Furthermore, in the method, the monocotyledonous plant is selected from the grass family.

[0075] Furthermore, in the method described above, the grass plant is selected from the genus Zea mays.

[0076] Furthermore, in the method described above, the Zea plant is selected from corn (Zea mays L).

[0077] Furthermore, in the method, the coding sequence of the ZmRIN4 protein encoding gene is a DNA molecule whose nucleotide sequence is SEQ ID No. 1. The genomic nucleotide sequence of the ZmRIN4 protein encoding gene is SEQ ID No. 3.

[0078] The method for increasing or improving plant root development provided in the present application and the target plants obtained therefrom can be used for plant density tolerance, lodging resistance breeding and / or auxiliary breeding as well as research on the mechanism of root development.

[0079] The present application also provides a method for reducing plant root development, which includes the steps of upregulating, increasing or promoting the expression of the above-mentioned ZmRIN4 protein encoding gene in the recipient plant or upregulating, increasing or promoting the content of the ZmRIN4 protein in the recipient plant to reduce the root development of the recipient plant (the root development of the obtained target plant is lower than that of the recipient / control plant).

[0080] Furthermore, in the method described above, the upregulation, improvement or promotion of the expression of the ZmRIN4 protein encoding gene in the recipient plant or the upregulation, improvement or promotion of the ZmRIN4 protein content in the recipient plant is achieved by introducing the ZmRIN4 protein encoding gene into the recipient plant.

[0081] Furthermore, in the method described above, the coding gene may be a DNA molecule as shown in any one of g1) to g3) below:

[0082] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0083] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 3;

[0084] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0085] Furthermore, in the method described above, the gene encoding the ZmRIN4 protein is introduced into the recipient plant in the form of a recombinant expression vector.

[0086] In some embodiments of the present application, the recombinant expression vector is pCAMBIA3301-ZmRIN4, and its physical map is as follows: Figure 1 The gene encoding the ZmRIN4 protein is transcribed and expressed by the Ubi promoter.

[0087] Furthermore, in the method, the plant is selected from monocotyledonous plants.

[0088] Furthermore, in the method, the monocotyledonous plant is selected from the grass family.

[0089] Furthermore, in the method described above, the grass plant is selected from the genus Zea mays.

[0090] Furthermore, in the method described above, the Zea plant is selected from corn (Zea mays L).

[0091] The method for reducing plant root development and the target plants obtained therefrom provided in the present application can be used for studying the mechanism of plant root development.

[0092] In this application, the above 80% identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 85% identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 90% identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0093] In this application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. Amino acid sequence identity can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, amino acid sequence identity can be calculated using Advanced BLAST 2.1 by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. A search can then be performed to calculate amino acid sequence identity, and the identity value (%) can then be obtained.

[0094] In the present application, the substance that regulates the protein content may be a substance that downregulates, reduces, or knocks out the gene encoding the protein and / or a substance that downregulates or reduces the expression of the gene encoding the protein. The regulating plant root development may be to improve plant root development.

[0095] In the present application, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the cell nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the content or activity of the protein translated from the gene).

[0096] In the present application, the regulating gene expression may be inhibiting or reducing the gene expression, and the inhibiting or reducing the gene expression may be achieved by gene knockout or gene silencing.

[0097] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing its DNA sequence.

[0098] The gene silencing refers to the phenomenon of not expressing or underexpressing a gene without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or underexpressed. Gene silencing can occur at two levels. One is gene silencing at the transcriptional level due to DNA methylation, heterochromatinization and position effects, and the other is post-transcriptional gene silencing, that is, gene inactivation by specifically inhibiting the target RNA at the level after gene transcription, including antisense RNA, co-suppression, gene repression (quelling), RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0099] In the present application, the substance that regulates gene expression may be an agent that inhibits or reduces the expression of the gene. The agent that inhibits or reduces the expression of the gene may be an agent that knocks out the gene, such as an agent that knocks out the gene by homologous recombination, or an agent that knocks out the gene by CRISPR-Cas9. The agent that inhibits or reduces the expression of the gene may comprise a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0100] The beneficial technical effects achieved by this application are as follows:

[0101] 1. This application reveals for the first time the mechanism of action of ZmRIN4 in regulating corn root development, explores the application prospects of ZmRIN4 in corn biological breeding, and provides new genetic resources for breeding high-density tolerant and high-yield corn. It can be applied to breeding high-density tolerant and lodging resistant corn, and has broad market prospects.

[0102] Nutrient absorption is crucial for maize during its growth and development. Plants cannot overcome resource scarcity through foraging alone; instead, they adjust their root morphology, including root volume, surface area, root hair density, diameter, number, and spatial configuration within the soil, to manage overall plant growth and development. Elucidating the genetic basis of maize root architecture and identifying superior alleles for root-related traits are crucial for further improving maize's resistance to environmental stresses, including stress tolerance, plant density, and lodging resistance. These efforts offer new insights into improving maize root morphology and nutrient utilization efficiency. The ZmRIN4 gene, which regulates maize root development, provides genetic resources for designing and cultivating ideal root architectures, and serves as a reference for developing new, stress-tolerant, and high-yield maize varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] Figure 1 This is a map of the recombinant vector pCAMBIA3301-ZmRIN4.

[0104] Figure 2 is the relative expression level of the target gene in the overexpression corn line and the non-transgenic control KN5585.

[0105] Figure 3 is the mutant genotype of the gene knockout strain.

[0106] Figure 4 Statistical results of root development appearance and root length at the seedling stage of ZmRIN4 gene overexpression and knockout corn lines.

[0107] Figure 5 Statistical results of the number of branches at the seedling stage in ZmRIN4 gene overexpression and knockout corn lines.

[0108] Figure 6 Statistical results of root surface area at the seedling stage of ZmRIN4 gene overexpression and knockout corn lines.

[0109] Figure 7 Statistical results of main root projection area of ​​ZmRIN4 gene overexpression and knockout corn lines at the seedling stage.

[0110] Figure 8 Statistical results of the root tip number at the seedling stage of ZmRIN4 gene overexpression and knockout corn lines.

[0111] Figure 9 Root development during flowering in ZmRIN4 overexpression and knockout maize lines.

[0112] Figure 10 This is the appearance of aerial root development during the flowering stage of the ZmRIN4 gene knockout maize line. DETAILED DESCRIPTION

[0113] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0114] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0115] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0116] The data in the following examples were processed using GraphPad Prism statistical software. The experimental results are expressed as mean ± standard deviation and tested using t-test. P < 0.05 (*) indicates a significant difference, and P < 0.001 (***) indicates an extremely significant difference.

[0117] The CRISPR / Cas9 gene editing vector CPB in the following examples was kindly donated by the research group of Researcher Xie Chuanxiao of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and is disclosed in the document "Qi X, et al., Genome Editing Enables Next-Generation Hybrid Seed Production Technology. Molecular Plant, 2020, 13(9): 1262-1269." The public can obtain the above-mentioned biological materials from the applicant. The obtained biological materials are only used to repeat the experiments of this application and cannot be used for other purposes;

[0118] The P-Easy-blunt vector used in the following examples is a product of Beijing Quanshijin Biotechnology Co., Ltd., with the product number CB101-01;

[0119] The Escherichia coli DH5α / EC DH5α in the following examples is a product of Beijing Qingke Biotechnology Co., Ltd., with the product number TSC01;

[0120] The Agrobacterium GV3101 (pSoup) competent cells in the following examples are products of Beijing Bomade Gene Technology Co., Ltd., with the product number C314-01;

[0121] In the following embodiments FastPfu PCR SuperMix is ​​a product of Beijing Quanshijin Biotechnology Co., Ltd., catalog number AS221-11;

[0122] The pCAMBIA3301 vector in the following examples is deposited by the applicant and disclosed in the document "Zhang X, et al., Overexpression of a maize BR transcription factor ZmBZR1in Arabidopsis enlarges organ and seed size of the transgenic plants. Plant Science, 2020, 292, 110378." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used to repeat the experiments of this application and cannot be used for other purposes.

[0123] The present application is further described in detail below in conjunction with specific embodiments. The examples provided are only for the purpose of illustrating the present application and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvements by those skilled in the art and do not in any way limit the present application.

[0124] Example 1. ZmRIN4 protein and its gene

[0125] The present application discloses the use of ZmRIN4 protein and its encoding gene in regulating corn root development. The amino acid sequence of ZmRIN4 protein is SEQ ID No. 2, its encoding gene is Zm00001eb280910 gene, the nucleotide sequence of the coding sequence of Zm00001eb280910 gene is SEQ ID No. 1, and the genomic nucleotide sequence of Zm00001eb280910 gene is SEQ ID No. 3.

[0126] Example 2. Preparation of overexpression strains

[0127] 2.1 Construction of overexpression vector

[0128] (1) Cloning of target gene

[0129] The reverse transcribed cDNA was used as a template to clone the Zm00001eb280910 gene and PCR amplification was performed using RIN4-FW / RIN4-RV primers. Amplification was performed using FastPfu PCR SuperMix.

[0130] The nucleotide sequences of primers RIN4-FW / RIN4-RV are as follows (5'-3'):

[0131] RIN4-FW: ATGGCGGAGGAATCAGGCC;

[0132] RIN4-RV: TCAGGATTGCGTAGGGCTGG.

[0133] The PCR reaction system was as follows: 1 μL template, 2 μL 2.5 mM dNTPs, 1 μL each of forward and reverse primers (10 μM), 4 μL 5× Fast Pfu Buffer, 2 μL Fast Pfu DNA polymerase, and ddH2O was added to a total volume of 20 μL.

[0134] The PCR reaction program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 10 min.

[0135] After the amplified product was detected by agarose gel electrophoresis, the target band was cut out and the total DNA amount was estimated according to the brightness of the Maker electrophoresis band. An appropriate amount of eluent was added to make the final DNA concentration consistent with subsequent experiments, and the target fragment was recovered using the Tiangen DNA recovery kit.

[0136] (2) Construction of intermediate vector

[0137] The intermediate vector uses the 9zf vector with the ubi promoter and is constructed using the homologous recombination method. First, the 9zf vector is linearized using EcoRV enzyme digestion, and the target fragment for homologous recombination (prepared in step (1)) is amplified using primers 9zf-RIN4-FW / 9zf-RIN4-RV. The homologous sequences on both sides of the vector insertion site are added to the 5' end of the primers. The target gene is connected to the 9zf vector using the principle of homologous recombination to construct the intermediate vector 9zf-ZmRIN4-Tnos. Subsequently, Escherichia coli transformation and positive recombinant identification are carried out. First, 5 μL of the ligation product is added to 50 μL of Trans1-T1 colon competent cells melted on ice, gently mixed, and placed on ice for 30 minutes. Heat shock in a 42°C water bath for 42 seconds, and immediately place on ice for 2 minutes. Add 500 μL of liquid LB medium without antibiotics and culture at 37°C, 200 rpm, and shake for 1 hour. Centrifuge at 3,000g for 2 minutes, discard the supernatant, and gently pipette the cells until fully suspended. Plate the entire suspension onto a solid LB medium plate containing ampicillin and incubate at 37°C overnight. Transfer a single colony of medium size to 5 mL of LB liquid medium containing antibiotics and incubate at 37°C with shaking at 200 rpm for approximately 10-16 hours. Extract the plasmid and perform enzyme digestion, PCR, and sequencing. Sequencing results indicate that the structure of the intermediate vector 9zf-ZmRIN4-Tnos consists of replacing the fragment between the two EcoRV restriction enzyme recognition sites of the 9zf vector with the DNA molecule of SEQ ID No. 1, while maintaining the remaining nucleotide sequence of the 9zf vector unchanged. Correctly sequenced clones are used for subsequent overexpression vector construction.

[0138] The nucleotide sequences of primers 9zf-RIN4-FW / 9zf-RIN4-RV are as follows (5'-3'):

[0139] 9zf-RIN4-FW: GTTACTTCTGCAGGAATTCGATATC ATGGCGGAGGAATCAGGC (homology arms are underlined);

[0140] 9zf-RIN4-RV: TAACGAGCTCTAGAAGCTTGATATC TCAGGATTGCGTAGGGCTGG (homology arms are underlined).

[0141] (3) Construction of overexpression vector

[0142] The overexpression vector was constructed using pCAMBIA3301 and enzyme ligation. Based on the multiple cloning site on the vector, the pCAMBIA3301 vector and the intermediate vector 9zf-ZmRIN4-Tnos were double-digested with the restriction endonucleases BamHI and AflII. The large fragment from pCAMBIA3301 and the small fragment from the intermediate vector 9zf-ZmRIN4-Tnos were recovered and ligated using T4 DNA ligase to construct the overexpression vector pCAMBIA3301-ZmRIN4-Tnos.

[0143] Vector linearization enzyme digestion system (20 μL system): about 5 μg of vector, 0.5 μL of BamHI / AflII, 2 μL of 10×CutSmart, and sterile water to make up to 20 μL.

[0144] Enzyme digestion reaction conditions: 37°C water bath digestion (16h).

[0145] The digested products were detected by 1% agarose gel electrophoresis, and the linearized vector was recovered according to the Tiangen DNA Recovery Kit instructions. The recombination reaction system was designed using the Seamless Assembly Cloning Kit from Sino-US Biotechnology, using 20-60 ng of linearized vector and a DNA fragment-to-vector molar ratio of 3:1.

[0146] The recombination reaction system is as follows (10 μL): 0.5-5 μL of target fragment, 0.5-5 μL of linearized vector, 5 μL of 2×Seamless Master Mix, and ddH2O to make a total volume of 10 μL.

[0147] Recombination reaction conditions: 50°C for 15 min.

[0148] Subsequently, E. coli transformation and positive recombinants were identified. 5 μL of the ligation product was transferred to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and placed on ice for 30 minutes. Heat shock was performed at 42°C for 42 seconds. The cells were immediately placed on ice for 2 minutes. 500 μL of liquid LB medium without antibiotics was added and cultured with shaking at 37°C, 200 rpm, for 1 hour. Centrifugation was performed at 3,000 g for 2 minutes, and the supernatant was discarded. The cells were gently pipetted to fully resuspend. The entire cell suspension was spread onto a solid LB medium plate containing kanamycin (later indicated by antibiotic) and incubated at 37°C overnight. Single colonies of medium size were selected and transferred to 5 mL of liquid LB medium containing antibiotics and cultured with shaking at 37°C, 200 rpm, for approximately 10-16 hours. Plasmids were then extracted and identified by enzyme digestion, PCR, and sequencing. Correctly sequenced clones were used for subsequent genetic transformation. The overexpression vector pCAMBIA3301-ZmRIN4 is 10.749 Kb in size. The nucleotide sequence of the recombinant vector pCAMBIA3301-ZmRIN4 is shown in Table 1. The nucleotide sequence of pCAMBIA3301-ZmRIN4 contains the Ubi promoter sequence at positions 8428-10414, the coding sequence of the Zm00001eb280910 gene (i.e., the gene encoding the ZmRIN4 protein) at positions 10433-10675, and the NOS terminator sequence at positions 1-223. The map of pCAMBIA3301-ZmRIN4 is shown in Figure 1. Figure 1 shown.

[0149] 2.2 Construction of overexpression plants

[0150] The genetic transformation of corn was carried out by the corn immature embryo transformation method and was completed by the Life Science and Technology Center of China National Seed Group Corporation (Wuhan). The overexpression transformation receptor was the corn inbred line KN5585. The transgenic T0 generation seedlings were screened for herbicide resistance and positive transgenic plants were identified by PCR. Continuous self-pollination and genotype identification were used to obtain homozygous transgenic (OE-3, OE-4, OE-6 and OE-9) T3 generation seeds in the winter of 2021 for trait determination in Hainan in 2022 and 2023. The T3 generation plants were self-pollinated to obtain the T4 generation, which was used for trait determination in Changji, Xinjiang in the summer of 2023. The T4 generation plants were self-pollinated to obtain the T5 generation, which was used for trait determination in Urumqi, Xinjiang in 2024. The preparation method of T0 transgenic corn is as follows:

[0151] The recombinant vector pCAMBIA3301-ZmRIN4 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens containing the recombinant vector pCAMBIA3301-ZmRIN4.

[0152] Immature embryos of the maize inbred line KN5585 were selected for callus induction to obtain callus tissue of the maize inbred line KN5585. The callus tissue of the maize inbred line KN5585 was infected with recombinant Agrobacterium tumefaciens containing pCAMBIA3301-ZmRIN4 to obtain T0 generation transformant plants. The method for PCR identification of positive transgenic plants in the T0 generation transformant plants is as follows:

[0153] (1) Method

[0154] PCR primers Ubi-Fw / Tnos-Rv were designed based on the gene sequence, and the expected amplified fragment size was 445 bp.

[0155] The nucleotide sequence of primer Ubi-Fw / Tnos-Rv is as follows (5'-3'):

[0156] Ubi-Fw: AGCCCTGCCTTCATACGCTA;

[0157] Tnos-Rv: AATCATCGCAAGACCGGCAA;

[0158] Extract genomic DNA and amplify according to the following PCR parameters:

[0159] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primer, 1.5 U Taq enzyme, and ddH2O supplemented to a total volume of 20 μL.

[0160] Reaction procedure: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 45 sec, for a total of 35 cycles; extension at 72°C for 5 min.

[0161] (2) Results

[0162] PCR detection of transformant plants showed that the size of the target gene amplified fragment of the transformant plants was consistent with the size of the amplified fragment of the positive plasmid control PCR, which was about 445 bp, indicating that the ZmRIN4 gene overexpression cassette had been integrated into the maize genome.

[0163] 2.3 Gene overexpression level

[0164] The T3 generation ZmRIN4 overexpression events OE-3, OE-4, OE-6, and OE-9, and the non-transgenic control KN5585 were sown in Changji City, Xinjiang Uygur Autonomous Region for a field experiment. Three replicates were planted in 6-row plots with 12 plants per row (2023) under normal water and fertilizer management.

[0165] The female ears of the non-transgenic control KN5585 and the T3 overexpression lines OE-3, OE-4, OE-6 and OE-9 on the day of silking were collected from plants with consistent growth in the field. They were quickly placed in liquid nitrogen, RNA was extracted and reversely transcribed into cDNA, and the relative expression level of the ZmRIN4 gene in each line was determined by qPCR.

[0166] ZmActin1-Fw:ACCTCACCGACCACCTAATG;

[0167] ZmActin1-Rv:CTGAACCTTTCTGACCCAAT;

[0168] R4-qPCR-Fw:ATGTCAACGATCCCGGCTTCC;

[0169] R4-qPCR-Rv: AGACTCCACCTCTCCAGTCC;

[0170] The reaction system was: 2×SYBR Mix 10 μL, Forward Primer (10 μM) 0.5 μL, Reverse Primer (10 μM) 0.5 μL, cDNA 7 μL, and ddH2O was added to 20 μL.

[0171] Quantitative analysis was performed using an ABI 7500 fluorescence quantitative PCR instrument. The qPCR reaction procedure was as follows: 95°C, 3 min; (95°C, 5 sec, 60°C, 30 sec) × 40 cycles.

[0172] The results showed that the relative expression levels of ZmRIN4 gene in OE-3, OE-4, OE-6 and OE-9 were increased by 14.2, 45.6 and 19.5 times respectively compared with the non-transgenic control KN5585 ( Figure 2 ).

[0173] Example 3. Preparation of knockout strains

[0174] 3.1 Construction of CRISPR-Cas9 vector

[0175] (1) Design of sgRNA

[0176] sgRNA targeting the genomic sequence of ZmRIN4 protein was designed using the sgRNA design website: http: / / www.rgenome.net / cas-designer / . The nucleotide sequence of the sgRNA target finally screened was as follows:

[0177] sgRNA: GGCCGTCCCTTGCCAAAGTT TGG(The underlined sequence is the PAM sequence, and the rest is the target sequence. The target sequence is positions 16-35 of SEQ ID No. 1 and positions 2759-2778 of SEQ ID No. 3).

[0178] (2) Amplification of U6 promoter

[0179] The U6 promoter was amplified using the plasmid containing the U6 promoter as a template, and the amplification primers were MU61-3F / MU61-1R.

[0180] The PCR reaction system is as follows: Template 1 μL, 2.5 mM dNTPs 2 μL, Forward Primer (10 μM) 0.5 μL, Reverse Primer (10 μM) 0.5 μL, 5×FastPfu Buffer 4 μL, FastPfu DNA polymerase 2 μL, and ddH2O to 20 μL.

[0181] The nucleotide sequence of primers MU61-3F / MU61-1R is as follows (5'-3'):

[0182] MU61-3F: TGCACTGCACAA;

[0183] MU61-1R:AATTCGGTGCTTGCCGGCTC;

[0184] The PCR reaction program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 10 min.

[0185] (3) Fusion of U6 and sgRNA

[0186] Using the PCR product from the previous step and the synthesized sgRNA as templates, primers MUsgR-1F and MUsgR-2R were used to fuse U6 and sgRNA together by overlap PCR to obtain a DNA fragment containing the sgRNA expression cassette. The PCR system and procedure were referred to step (2).

[0187] The nucleotide sequences of primers MUsgR-1F and MUsgR-2R are as follows (5'-3'):

[0188] MUsgR-1F:GAGCCGCAAGCACCGAATTGGCCGTCCCTTGCCAAAGTT;

[0189] MUsgR-2R: GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG;

[0190] (4) Finally, the DNA fragment containing the sgRNA expression cassette was fused to the CRISPR-cas9 vector CPB using the principle of homologous recombination to obtain the CRISPR-ZmRIN4 vector. The nucleotide sequence (5′→3′) of the CRISPR-ZmRIN4 vector is the Cas9 encoding gene at positions 435-4535, the U6 promoter at positions 6680-7179, the gRNA gene at positions 7180-7282 (the gRNA target sequence at positions 7180-7199, and the structural sequence of the sgRNA gene (gRNA scaffold) at positions 7200-7282).

[0191] Subsequently, ligation transformation and positive recombinant identification were performed. 5 μL of the ligation product was transferred to 50 μL of Trans1-T1 competent cells thawed on ice, gently mixed, and placed on ice for 30 minutes. Heat shock was performed in a 42°C water bath for 42 seconds. Immediately, the cells were placed on ice for 2 minutes. Then, 500 μL of liquid LB medium without antibiotics was added and cultured with shaking at 37°C, 200 rpm, for 1 hour. Centrifugation was performed at 3,000 g for 2 minutes, and the supernatant was discarded. The cells were gently pipetted to fully resuspend the cells. The entire cell suspension was spread onto a solid LB medium plate containing kanamycin and incubated at 37°C overnight. Single colonies of medium size were selected and transferred to 5 mL of liquid LB medium containing antibiotics and incubated with shaking at 37°C, 200 rpm, for approximately 10-16 hours. Plasmids were then extracted and verified by enzyme digestion, PCR, and sequencing. Correctly sequenced clones were used for subsequent genetic transformation.

[0192] 3.2 Preparation of maize knockout lines

[0193] The genetic transformation of corn was carried out by the corn immature embryo transformation method at the Life Science and Technology Center of China National Seed Group Corporation (Wuhan). The recipient of CRISPR / Cas9 gene editing was the corn inbred line C01. The T0 generation seedlings of CRISPR / Cas9 gene editing were screened for herbicide resistance and positive transgenic plants were identified by PCR. Continuous self-pollination and genotyping were performed to obtain homozygous CRISPR / Cas9 gene-edited (KO-1, KO-2, KO-3, KO-21 and KO+1) T3 generation seeds in the winter of 2021 for trait determination in Hainan in 2022 and 2023. The T3 generation plants were self-pollinated to obtain the T4 generation, which was used for trait determination in Changji, Xinjiang in the summer of 2023. The T4 generation plants were self-pollinated to obtain the T5 generation, which was tested in Urumqi, Xinjiang in 2024. The preparation method of the CRISPR / Cas9 gene-edited corn T0 line is as follows:

[0194] The recombinant vector CRISPR-ZmRIN4 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens containing the recombinant vector CRISPR-ZmRIN4.

[0195] Immature embryos of the maize inbred line C01 were used for callus induction, generating calli from the C01 line. These calli were then infected with recombinant Agrobacterium tumefaciens harboring CRISPR-ZmRIN4 to generate CRISPR / Cas9 gene-edited lines. These CRISPR / Cas9 gene-edited lines were self-pollinated to select homozygous lines, and sequencing confirmed the edited sites and types. The T0 generation knockout lines were self-pollinated to obtain the T1 generation, and further self-pollinated to obtain homozygous knockout lines in the T3 generation. Sequencing confirmed homozygous mutants, including KO-2 and KO-21.

[0196] The sequencing identification method and results are as follows:

[0197] (1) Method

[0198] PCR primers RIN4-Crispr-F / RIN4-Crispr-R were designed based on the gene sequence, and the genomic DNA of the maize inbred line C01 was used as a template. The expected amplified fragment size was 663 bp.

[0199] The nucleotide sequences of primers RIN4-Crispr-F / RIN4-Crispr-R are as follows (5'-3'):

[0200] RIN4-Crispr-F: ATCTGCTTGCAGAAGCCTGT

[0201] RIN4-Crispr-R:GCTGGCTGTCACACAACAAA

[0202] Extract genomic DNA and perform PCR amplification according to the following reaction system:

[0203] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primer, 1.5 U Taq enzyme, and ddH2O to 20 μL.

[0204] The reaction procedure was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 45 sec, for a total of 35 cycles; and extension at 72°C for 5 min.

[0205] (2) Results

[0206] The gene knockout homozygous strain was confirmed by Sanger sequencing. The sequencing results of the knockout homozygous strain were as follows: Figure 3 The mutations of homozygous mutants KO-1, KO-2, KO-3, KO-21 and KO+1 are as follows:

[0207] Homozygous mutant plant KO-2: Compared with the wild-type C01, the target gene in the two homologous chromosomes of the mutant strain KO-2 undergoes the following changes: the nucleotide AA at positions 2773-2774 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn makes it impossible to express the target protein normally, thereby achieving the knockout of the target gene.

[0208] Homozygous mutant plant KO-21: Compared with the wild type C01, the target genes in the two homologous chromosomes of the mutant strain KO-21 underwent the following changes: the nucleotides AAGTTTGGTGAATGGGATGTC at positions 2776-2796 of SEQ ID No.3 were deleted, resulting in a mutation in the target gene, which in turn led to the inability to express the target protein normally, thereby achieving the knockout of the target gene.

[0209] Homozygous mutant plant KO-1: Compared with the wild-type C01, the target gene in the two homologous chromosomes of the mutant strain KO-1 undergoes the following changes: the nucleotide A at position 2773 of SEQ ID No. 3 is deleted, resulting in a frameshift mutation in the target gene, which in turn makes it impossible to express the target protein normally, thereby achieving the knockout of the target gene.

[0210] Homozygous mutant plant KO-3: Compared with the wild type C01, the target gene in the two homologous chromosomes of the mutant strain KO-3 undergoes the following changes: the nucleotide A at positions 2772-2774 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn makes it impossible to express the target protein normally, thereby achieving the knockout of the target gene.

[0211] Homozygous mutant plant KO+1: Compared with the wild-type C01, the target gene in the two homologous chromosomes of the mutant strain KO+1 undergoes the following changes: the nucleotides AAA at positions 2773-2775 of SEQ ID No.3 are replaced by AAAA, resulting in a frameshift mutation in the target gene, which in turn makes it impossible to express the target protein normally, thereby achieving the knockout of the target gene.

[0212] Example 4, property determination

[0213] 4.1 Root development in the seedling stage

[0214] Seedling stage experimental methods: KO-21 and KO-2 were selected as ZmRIN4 knockout materials, C01 was wild-type, OE-3, OE-6, and OE-9 were selected as ZmRIN4 overexpression events, and KN5585 was used as a non-transgenic control. 100 plump, uniformly sized seeds were selected from each seedling, removed of impurities, and repeatedly rinsed with clean water followed by distilled water. The seeds were then soaked in 10% H₂O₂ for half an hour. After rinsing, the rinsed seeds were neatly arranged on moistened germination paper. Germination was allowed to proceed using germination paper. When the seeds reached the one-leaf, one-heart stage, half of the seedlings were wrapped in germination paper and placed in a 15% PEG6000 aqueous solution to simulate drought stress. The other half, as a control, were also wrapped in germination paper and placed in water. The climate chamber was set at a day / night temperature of 28 / 23°C, a relative humidity of 60%, and a photoperiod of 14 hours. One week later, root changes in the overexpression and knockout materials were observed under normal conditions and drought stress. Roots were scanned using a root scanner (EPSON Perfection V800 Photo), and images were analyzed using WinRHIZO software to determine traits such as total root length, branch number, root surface area, taproot projected area, and number of root tips. Phenotypic data were analyzed using Student's t-test in Excel (Excel 2013, Microsoft) (*: P < 0.05, **: P < 0.01, ***: P < 0.001).

[0215] 4.1.1 Root length:

[0216] Under normal conditions, the root length of ZmRIN4-overexpressing plants became shorter, ranging from 64.57 to 86.33 cm, which was 23.87%-43.06% lower than that of the non-transgenic control KN5585 (mean root length 113.40 cm); the root length of gene-edited plants (KO-2, KO-21) became longer, ranging from 124.35 to 125.07 cm, which was 73.90%-74.91% higher than that of the wild-type C01 (mean root length 71.50 cm). Under drought stress, the root length of ZmRIN4 overexpressing plants shortened, ranging from 52.37 to 61.26 cm, which was 20.31% to 31.88% lower than that of the non-transgenic control KN5585 (mean root length 76.88 cm); the root length of gene-edited plants (KO-2, KO-21) lengthened, ranging from 73.00 to 117.03 cm, which was 31.74% to 79.68% higher than that of wild-type C01 (mean root length 55.41 cm). Figure 4 ).

[0217] 4.1.2, Number of root branches:

[0218] Under normal conditions, the number of branches in ZmRIN4-overexpressing plants decreased, ranging from 157 to 205, a decrease of 41.04% to 55.01% compared to the non-transgenic control KN5585 (mean number of branches, 349). The number of branches in gene-edited plants (KO-2 and KO-21) increased, ranging from 322 to 373, a 72.35% to 99.78% increase compared to the wild-type C01 (mean number of branches, 186). Under drought stress, the number of branches in ZmRIN4-overexpressing plants decreased, ranging from 67 to 124, a 48.00% to 71.99% decrease compared to the non-transgenic control KN5585 (mean number of branches, 238). The number of branches in gene-edited plants (KO-2 and KO-21) increased, ranging from 175 to 188, a 97.51% to 112.59% increase compared to the wild-type C01 (mean number of branches, 86). Figure 5 ).

[0219] 4.1.3 Root surface area

[0220] Under normal conditions, the root surface area of ​​ZmRIN4-overexpressing plants was reduced, ranging from 12.73 to 18.27 cm 2 Compared with the non-transgenic control KN5585 (mean root surface area 23.27cm 2 ) decreased by 21.47%-45.27%, and the root surface area of ​​gene-edited plants (KO-2, KO-21) increased, with a root surface area of ​​21.27-21.83 cm 2 Compared with wild type C01 (mean root surface area 16.83cm 2 ) increased by 32.83%-34.20%. Under drought stress, the root surface area of ​​ZmRIN4 overexpressing plants decreased, with the root surface area ranging from 8.68 to 9.10 cm 2 Compared with the non-transgenic control KN5585 (mean root surface area 11.17cm 2 ) decreased by 21.47%-45.27%, and the root surface area of ​​gene-edited plants (KO-2, KO-21) increased, with a root surface area of ​​16.38-18.96cm 2 Compared with wild type C01 (mean root surface area 10.17cm 2 ) increased by 61.11%-86.51% ( Figure 6 ).

[0221] 4.1.4 Main root projected area:

[0222] Under normal conditions, the projected area of ​​the main root of ZmRIN4-overexpressing plants was reduced, ranging from 4.05 to 5.82 cm. 2 Compared with the non-transgenic control KN5585 (the average projected area of ​​the main root was 7.41cm 2) decreased by 21.47%-45.27%; the projected area of ​​the main root of the gene-edited plants (KO-2, KO-21) increased, with a projected area of ​​6.55-6.71 cm 2 Compared with wild type C01 (the average projected area of ​​main root was 5.18cm 2 ) increased by 26.39%-29.50%. Under drought stress, the projected area of ​​the main root of the ZmRIN4 overexpressing plants was reduced to 3.06-3.24 cm 2 Compared with the non-transgenic control KN5585 (the average projected area of ​​the main root was 3.90 cm 2 ) decreased by 16.82%-21.48%; the projected area of ​​the main root of the gene-edited plants (KO-2, KO-21) increased, with a projected area of ​​5.21-6.03 cm 2 Compared with wild type C01 (the average projected area of ​​main root is 3.50cm 2 ) increased by 48.97%-72.45% ( Figure 7 ).

[0223] 4.1.5 Number of root tips:

[0224] Under normal conditions, the number of root tips in ZmRIN4-overexpressing plants was reduced, ranging from 319 to 324, which was 6.74%-7.73% lower than that in the non-transgenic control KN5585 (mean number of root tips was 346); the number of root tips in gene-edited plants (KO-2, KO-21) was increased, ranging from 648 to 818, which was 73.67%-119.33% higher than that in the wild-type C01 (mean number of root tips was 373). Under drought stress, the number of root tips in ZmRIN4 overexpressing plants decreased, ranging from 439 to 454, which was 3.08%-6.27% lower than that in the non-transgenic control KN5585 (mean number of root tips was 468). The number of root tips in gene-edited plants (KO-2 and KO-21) increased, ranging from 492 to 578, which was 52.53%-79.16% higher than that in wild-type C01 (mean number of root tips was 322). Figure 8 ).

[0225] 4.2 Root development during flowering

[0226] The T3 generation ZmRIN4 gene knockout materials KO-21, KO-2 and wild type C01, the T3 generation ZmRIN4 overexpression events OE-3, OE-6, OE-9 and the non-transgenic control KN5585 (a total of 7 lines) were selected and sown in the Hainan experimental field in the winter of 2022 and 2023, respectively. According to the randomized block experiment design, three replicates were planted for each line, and each replicate was set up with 2 rows, with 12 plants in each row.

[0227] The T4 generation ZmRIN4 gene knockout materials KO-21, KO-2 and wild type C01, the T4 generation ZmRIN4 overexpression events OE-3, OE-6, OE-9 and the non-transgenic control KN5585 (a total of 7 lines) were selected and sown in the experimental field in Changji City, Xinjiang Uygur Autonomous Region in the summer of 2023. According to the randomized block experimental design, three replicates were planted for each line, and each replicate was set with 6 rows and 12 plants per row.

[0228] Eight lines (T5-generation ZmRIN4 knockout lines, including KO-21, KO-2, and wild-type C01) were selected, along with eight T5-generation ZmRIN4 overexpression lines, OE-3, OE-6, and OE-9, and a non-transgenic control, KN5585. These lines were sown in the summer of 2024 in an experimental field in Urumqi, Xinjiang Uygur Autonomous Region. A randomized block design was used with two treatments: watering and drought stress. Drought stress treatment began with water withdrawal at the jointing stage and continued until normal watering was resumed 14 days after silking. Each line was planted in triplicate, with each replicate consisting of six rows of 12 plants per row.

[0229] Experimental method for root development during flowering period: KO-21 and KO-2 were selected as ZmRIN4 gene knockout materials, C01 was selected as wild type, OE-3, OE-6, and OE-9 were selected as ZmRIN4 overexpression events, and KN5585 was selected as non-transgenic control. Full and uniformly sized seeds were selected and sown in Hainan (2022 and 2023) and Xinjiang (2023), respectively. Roots were dug out during flowering period, rinsed clean, and photographed to observe the root development under different ecological environments. The results showed that under five natural environments, namely 2022 Hainan (A), 2023 Xinjiang (B), 2023 Hainan (C) and 2024 Xinjiang (D normal watering, E drought treatment), overexpression of the ZmRIN4 gene significantly inhibited root development. Compared with the non-transgenic control KN5585, the root length, root volume and root biomass of OE-3, OE-6 and OE-9 were shortened; knockout of the ZmRIN4 gene promoted root development. Compared with the wild type C01, the root length, root volume and root biomass of the knockout lines KO-21 and KO-2 were increased, and the aerial roots were more developed ( Figure 9 These results indicate that the ZmRIN4 gene may be involved in regulating maize root development under natural and drought stress conditions.

[0230] Experimental method for the number of aerial root layers: 8 plants with consistent growth were selected from each row. The number of aerial root layers of each plant was investigated and photos were taken to observe the root development under different ecological environments. Statistics showed that in the natural environment of Xinjiang in 2024, the knockout of the ZmRIN4 gene promoted root development, and the number of aerial root layers increased significantly, which was more developed than the control ( Figure 10The aerial root nodes in the vertical axis of the figure represent the number of nodes above the aerial roots, that is, the number of aerial root layers. The above results indicate that the ZmRIN4 gene is involved in regulating the development of maize roots in field environments.

[0231] Table 1: Main sequences in this application

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. An application, characterized in that: The application is the application of a protein or a substance regulating gene expression or a substance regulating the protein content in any of the following items, wherein the gene encodes the protein, and the protein is ZmRIN4 protein; A1) Application in regulating the development of underground root system of plants; A2) Application in the preparation of products for regulating the development of underground root systems of plants; A3) Application in regulating the number and / or quantity of aerial root layers of plants; A4) Application in the preparation of products for regulating the number and / or quantity of aerial root layers of plants; A5) Application in plant breeding or plant assisted breeding; The ZmRIN4 protein is any of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID No.2; a2) a protein having more than 80% identity with the amino acid sequence shown in a1) and having the same function as the amino acid sequence shown in a1) obtained by substitution and / or deletion and / or addition of amino acid residues; a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The use according to claim 1, characterized in that: The substance regulating gene expression or the substance regulating protein content is a biological material, and the biological material is any one of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the ZmRIN4 protein or inhibits or reduces the content of the ZmRIN4 protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), a nucleic acid molecule encoding the ZmRIN4 protein; B9), an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in B8).

3. The use according to claim 2, characterized in that: B1) the nucleic acid molecule is a gRNA targeting the gene or a DNA molecule encoding the gRNA; B8) The nucleic acid molecule is a DNA molecule as described in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 3; g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

4. The use according to claim 3, characterized in that: B1) The nucleotide sequence of the target of the gRNA is positions 2759-2778 of SEQ ID No.

3.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is selected from monocotyledonous plants.

6. A method for increasing or improving the root development of a plant, the method comprising step M1) or M2), M1) knocking out the gene encoding the ZmRIN4 protein of claim 1 in the recipient plant by using the CRISPR / Cas system to reduce the expression amount of the gene encoding the ZmRIN4 protein and / or the content of the ZmRIN4 protein in the recipient plant; the recipient plant is a plant containing the gene encoding the ZmRIN4 protein; M2) subjecting a gene in a recipient plant to any one, two or three mutations of the following M2-1) to M2-5), wherein the recipient plant is a plant containing a gene encoding the ZmRIN4 protein, and the plant is corn, M2-1), deleting the nucleotide AA at positions 2773-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M2-2), deleting nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M2-3), deleting the nucleotide A at position 2773 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M2-4), deleting the nucleotides AAA at positions 2772-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M2-5), replacing the nucleotides AAA at positions 2773-2775 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn with AAAA.

7. The method according to claim 6, characterized in that The M1) includes introducing a gRNA gene targeting the gene encoding the ZmRIN4 protein and a gene encoding the Cas protein into the recipient corn.

8. A method for reducing plant root development, characterized in that: The method comprises the step of reducing the root development of the recipient plant by up-regulating, increasing or promoting the expression of the gene encoding the ZmRIN4 protein in the recipient plant or up-regulating, increasing or promoting the content of the ZmRIN4 protein in the recipient plant.

9. The method according to claim 8, characterized in that The up-regulation, improvement or promotion of the expression of the gene encoding the ZmRIN4 protein in the recipient plant or the up-regulation, improvement or promotion of the content of the ZmRIN4 protein in the recipient plant is achieved by introducing the gene encoding the ZmRIN4 protein into the recipient plant.

10. The method according to claim 9, characterized in that The ZmRIN4 protein encoding gene is a DNA molecule shown in any one of g1) to g3) below: g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 3; g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

Images