Klebsiella engineering bacterium as well as preparation method and application thereof

Abstract

The invention provides a Klebsiella engineering bacterium as well as a preparation method and application thereof. The Klebsiella engineering bacterium is a Klebsiella bacterium of which a D-lactic dehydrogenase gene is inactivated. The engineering bacterium provided by the invention is obtained by inactivating the D-lactic dehydrogenase gene of the Klebsiella bacteria, and when the engineering bacterium is subjected to anaerobic fermentation, compared with wild Klebsiella bacteria, the hydrogen production rate is improved. When the engineering bacteria provided by the invention are used for preparing hydrogen, the hydrogen production efficiency can be effectively improved; when the D-lactic dehydrogenase gene and the acetolactate synthase gene are knocked out at the same time, the hydrogen production rate of the Klebsiella engineering bacteria is further improved, meanwhile, main metabolites of the Klebsiella engineering bacteria are common chemical products acetic acid and ethyl alcohol, and the Klebsiella engineering bacteria have good application value and economic benefits.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to an engineered bacterium of the genus Klebsiella and a preparation method and application thereof. Background Art

[0002] Hydrogen is a clean energy source that is non-toxic and odorless. It is a green renewable energy source. Its calorific value and energy conversion efficiency are also much higher than fossil fuels such as gasoline, diesel and natural gas. In addition to being used as a fuel, hydrogen can be used as a strong reducing agent in many chemical reactions due to its special chemical properties. Hydrogen is generally produced by water electrolysis, coal gasification and biological methods. The biological method uses the metabolic process of specific microorganisms or algae to produce hydrogen. This method is in the research stage and has not yet been widely used in industrial production, but this method is expected to become an environmentally friendly way to produce hydrogen in the future.

[0003] The synthesis pathways of biohydrogen production currently include photosynthetic biohydrogen production, photocatalytic hydrogen production, electrochemical hydrogen production, dark fermentation hydrogen production, etc. Among them, dark fermentation hydrogen production can use biomass waste as a carbon source substrate to produce clean hydrogen, while realizing the resource utilization of biomass. Microorganisms that can produce hydrogen by dark fermentation usually include Enterobacter and Klebsiella, which mainly use the formate hydrogen cracking pathway, and Clostridium, which ferments butyrate.

[0004] Among them, Klebsiella bacteria have many advantages, such as being able to utilize a variety of waste carbon sources, including straw hydrolyzate, molasses, food processing wastewater, etc., and being resistant to a variety of anti-nutritional factors such as sulfate and furfural. However, it is not common to use Klebsiella bacteria as chassis cells to produce hydrogen. Summary of the invention

[0005] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide an engineered bacterium of the genus Klebsiella and a preparation method and use thereof, so as to solve the problems in the prior art.

[0006] To achieve the above objectives and other related objectives, the present invention is achieved through the following technical solutions.

[0007] A first aspect of the present invention provides an engineered bacterium of the genus Klebsiella, wherein the engineered bacterium is a Klebsiella bacterium in which a D-lactate dehydrogenase gene is inactivated.

[0008] The second aspect of the present invention provides a method for constructing the Klebsiella engineered bacteria as described above, comprising the following steps:

[0009] Knocking out the D-lactate dehydrogenase gene in Klebsiella bacteria; also includes knocking out the acetolactate synthase gene in Klebsiella bacteria.

[0010] The third aspect of the present invention provides a use of the engineered Klebsiella bacteria as described above in improving the hydrogen production efficiency of Klebsiella bacteria or producing hydrogen in the field of biological hydrogen production.

[0011] A fourth aspect of the present invention provides a method for producing hydrogen, comprising fermentation using the engineered Klebsiella bacteria as described above.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] 1) The engineered bacteria provided by the present invention are obtained by knocking out the D-lactate dehydrogenase gene in Klebsiella bacteria. During anaerobic fermentation, the engineered bacteria can increase the production of hydrogen compared with wild-type Klebsiella bacteria.

[0014] 2) The engineered bacteria provided by the present invention further inactivate the acetolactate synthase gene on the basis of inactivating the D-lactate dehydrogenase gene, and the resulting engineered bacteria can further increase the production of hydrogen, and its main metabolites are acetic acid and ethanol, which are commonly used substances in industry. In addition, the engineered bacteria can also effectively utilize a variety of waste carbon sources, such as molasses, to achieve green recycling of waste carbon sources. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Shown is a graph showing the hydrogen production rate results in Examples 7 to 11 of the present invention. DETAILED DESCRIPTION

[0016] A first aspect of the present invention provides an engineered bacterium of the genus Klebsiella, wherein the engineered bacterium is a Klebsiella bacterium in which a D-lactate dehydrogenase gene is inactivated.

[0017] In the present invention, the inactivation is to inhibit the expression or activity of the gene. Inhibiting gene activity means reducing the activity of the gene and reducing the biological function of the gene. Preferably, the activity of the gene is reduced by at least 10% compared to before inhibition, for example, by at least 30%, 50%, 70%, 90% or 100%. Inhibiting gene expression may be inhibiting the transcription or translation of the gene, specifically, it may mean: preventing the gene from being transcribed, or reducing the transcriptional activity of the gene, or preventing the gene from being translated, or reducing the translation level of the gene.

[0018] Those skilled in the art can use conventional methods to regulate gene expression, such as one or more of gene knockout, homologous recombination or interfering RNA.

[0019] In some embodiments, the Klebsiella bacteria include species of the genus Klebsiella, as defined in Bergey's Manual of Determinative Bacteriology, 9th edition.

[0020] In some specific embodiments, the Klebsiella bacterium is selected from Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variicola, Klebsiella michiganensis, Klebsiella quasipneumoniae, Klebsiella aerogenes, Klebsiella quasivariicola, Klebsiella huaxiensis, Klebsiella africana, Klebsiella pasteurii or Klebsiella grimontii.

[0021] In some embodiments, the Klebsiella bacterium is selected from Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variegata, and Klebsiella michiganensis.

[0022] In some specific embodiments, the engineered Klebsiella bacteria are Klebsiella bacteria in which both the D-lactate dehydrogenase gene and the acetolactate synthase gene are inactivated.

[0023] In some specific embodiments, the D-lactate dehydrogenase gene is an ldhA gene. In some specific embodiments, the wild-type nucleotide sequence of the ldhA gene in Klebsiella pneumoniae (Kp) CGMCC 1.6366 is shown in SEQ ID No.1.

[0024] In the present application, the D-lactate dehydrogenase refers to an enzyme that catalyzes pyruvate to generate L-lactate, and the name of its encoding gene is ldhA, and the gene reading frame of the ldhA can be queried through an existing database (such as NCBI) or obtained by sequencing. Its gene reading frame in Klebsiella pneumoniae 573 (genome sequence GenBank GCA_000240185.2) is shown in SEQ ID NO.1.

[0025] The present application found that the D-lactate dehydrogenase-inactivated Klebsiella engineered bacteria can increase the hydrogen production rate. Under anaerobic conditions, the average hydrogen production rate is increased by 87% to 92% compared with the wild-type Klebsiella bacteria.

[0026] In some specific embodiments, the acetolactate synthase gene is a budB gene.

[0027] In some specific embodiments, the wild-type nucleotide sequence of the budB gene in Klebsiella pneumoniae (Kp) CGMCC 1.6366 is shown in SEQ ID No.2.

[0028] In the present application, the acetolactate synthase refers to an enzyme that catalyzes phosphoenolpyruvate to generate acetolactate, and the name of its encoding gene is budB. The gene reading frame of budB can be queried through existing databases (such as NCBI) or obtained through sequencing. Its gene reading frame in Klebsiella pneumoniae 573 (genome sequence GenBank GCA_000240185.2) is shown in SEQ ID NO.2.

[0029] The present invention also provides a method for preparing the Klebsiella engineered bacteria as described above, comprising the following steps: knocking out the D-lactate dehydrogenase gene in the Klebsiella bacteria.

[0030] In some embodiments, the acetolactate synthase gene is also knocked out.

[0031] In some specific embodiments, the D-lactate dehydrogenase gene is the ldhA gene.

[0032] In some more specific embodiments, the wild-type nucleotide sequence of the ldhA gene is shown as SEQ ID No.1.

[0033] In some specific embodiments, the acetolactate synthase gene is a budB gene.

[0034] In some more specific embodiments, the wild-type nucleotide sequence of the budB gene is shown as SEQ ID No.2.

[0035] Those skilled in the art can use conventional methods to regulate the expression of ldhA gene and budB gene, such as gene knockout, single base editing, interfering RNA and other technologies.

[0036] In some embodiments, the preparation method comprises the following steps:

[0037] A) PCR amplification of the upstream and downstream sequences of the partial sequence of the D-lactate dehydrogenase gene;

[0038] B) connecting the upstream and downstream sequences of the partial gene sequence obtained in step A) with the resistance gene to form a resistance box with a resistance element in the middle and upstream and downstream sequences of the partial gene sequence at both ends;

[0039] C) Introducing the resistance cassette obtained in step B) into Klebsiella bacteria, and performing resistance screening and PCR verification to obtain the strain that is the engineered Klebsiella bacteria as described above.

[0040] In some specific embodiments, the resistance element is selected from one or more of a gentamicin resistance expression element, a tetracycline resistance expression element, a kanamycin resistance expression element, a neomycin resistance expression element, a bleomycin resistance expression element, a chloramphenicol resistance expression element, an erythromycin resistance expression element, a streptomycin resistance expression element, an apramycin resistance expression element, and a polymyxin B resistance expression element.

[0041] The present invention also provides the use of the Klebsiella engineered bacteria as described above in improving the hydrogen production efficiency of Klebsiella bacteria or producing hydrogen in the field of biological hydrogen production.

[0042] The present invention also provides a method for producing hydrogen, comprising fermentation using the engineered bacteria of the genus Klebsiella as described above.

[0043] In some embodiments, the engineered Klebsiella bacteria described above are inoculated into a fermentation medium for fermentation.

[0044] In some specific embodiments, the components of the fermentation medium include: 10-40 g / L of carbon source, 10-15 g / L of nitrogen source, and 6-20 g / L of inorganic salt. For example, the content of the carbon source can be 10-25.9 g / L, 25.9-40 g / L; the content of the nitrogen source can be 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, 15 g / L; the content of the inorganic salt can be 6-14.83 g / L, 14.83-20 ​​g / L.

[0045] In some more specific embodiments, the carbon source is selected from one or more of glucose, xylose and molasses.

[0046] In some more specific embodiments, the nitrogen source is selected from one or more of beef extract, beef powder and peptone.

[0047] In some more specific embodiments, the inorganic salt is selected from one or more of sodium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate and magnesium sulfate heptahydrate.

[0048] In some specific embodiments, the initial pH of the fermentation medium is adjusted to 5.5-7.5 using a pH regulator. More specifically, the pH regulator is sodium hydroxide and concentrated hydrochloric acid. Preferably, the initial pH of the fermentation medium is 6.0-7.2, 6.3-6.9. For example, it can be 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2.

[0049] In some specific embodiments, the fermentation temperature is 35-37°C, such as 35°C, 36°C, or 37°C.

[0050] In some embodiments, the fermentation method is anaerobic fermentation.

[0051] In a specific embodiment, the fermentation medium is composed of: 20 g / L glucose, 20 g / L xylose, 5 g / L beef powder, 10 g / L peptone, 5 g / L sodium chloride, 0.5 g / L potassium dihydrogen sulfate, 0.5 g / L magnesium sulfate heptahydrate, and the initial pH is adjusted to 7.0 with sodium hydroxide.

[0052] The present invention also provides a use of a gene in inhibiting the production of hydrogen by Klebsiella bacteria, wherein the gene comprises a D-lactate dehydrogenase gene, and inactivation of the D-lactate dehydrogenase gene can increase the hydrogen production of the Klebsiella bacteria.

[0053] In some specific embodiments, the gene further comprises an acetolactate synthase gene, and inactivating both the D-lactate dehydrogenase gene and the acetolactate synthase gene can further increase the hydrogen production of the Klebsiella bacteria.

[0054] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0055] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0056] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0057] The Klebsiella pneumoniae (Kp) in the following examples uses the strain CGMCC 1.6366 (also known as TUAC01, AC01), which is isolated from soil. The isolation process and properties are described in (Isolation and characterization of microorganisms able to produce 1,3-propanediol under aerobic conditions. World Journal of Microbiology Biotechnology 2008, 24: 1731-1740).

[0058] Klebsiella oxytoca (Ko) uses the M5a1 strain, which was also called Klebsiella pneumoniae M5a1 in the early days. For details, see (Dixon RA, Postgate JR. Transfer of nitrogen-fixation genes by conjugation in Klebsiella pneumoniae. Nature 1971; 234(5323): 47–8).

[0059] Klebsiella variabilis (Kv) may be a Klebsiella variabilis strain isolated according to routine operations, or Klebsiella variabilis 342 may be used. For details, see (Fouts, DE et al., Complete genome sequence of the N2-fixing broad host range endophyte Klebsiella pneumoniae 342 and virulence predictions verified in mice. PLoS Genet 4, e1000141.). This bacterium was initially identified as Klebsiella pneumoniae and later re-identified as Klebsiella variabilis.

[0060] Klebsiella michiganensis (Km) may be a Klebsiella michiganensis strain isolated according to conventional operations, or Klebsiella michiganensis 342 ATCC BAA-2403 may be used. For details, see (Saha R, Farrance CE, Verghese B, et al. Klebsiella michiganensis sp. nov., a new bacterium isolated from a tooth brush holder. Curr Microbiol, 2013, 66: 72-78).

[0061] Example 1D - Construction of engineered Klebsiella bacteria with inactivated lactate dehydrogenase

[0062] 1.1. Construction of upstream and downstream fragments of knockout D-lactate dehydrogenase (ldhA) gene

[0063] According to the genome information of Klebsiella pneumoniae 573 (genome sequence GenBank GCA_000240185.2), the upstream primer and downstream primer of PCR were designed for the ldhA gene of D-lactate dehydrogenase, i.e., SEQ ID No.1. The specific sequences are as follows:

[0064] Upstream primer ldhA-up-f: aagtcttATTCCGGGGATCCGTCGA (SEQ ID NO. 3),

[0065] Downstream primer ldhA-up-r: aagggaaaggcaTGTAGGCTGGAGCTGCTTCG (SEQ ID NO. 4),

[0066] Downstream primer ldhA-down-f: agcctacaTGCCTTTCCCTTTTGTGCTCCTC (SEQ ID NO. 5),

[0067] Downstream primer ldhA-down-r: catgcctgcaggtcgacgatGAGCAGGCGCTGGCGG (SEQ ID NO. 6).

[0068] The upstream and downstream fragments of the D-lactate dehydrogenase gene were obtained by PCR amplification using the above primers and the Klebsiella pneumoniae Kp genomic DNA as a template.

[0069] 1.2. PCR amplification of apramycin resistance gene sequence

[0070] Using the pIJ773 plasmid (see Gust, B., et al., PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of thesesquiterpene soil odor geosmin. Proceedings of the National Academy of Sciences, 2003.100(4): p.1541.) as a template, PCR amplification was performed using primers to obtain the apramycin resistance gene fragment.

[0071] apr-F primer: ATTCCGGGGATCCGTCGAC (SEQ ID NO.7)

[0072] apr-R primer: TGTAGGCTGGAGCTGCTTCG (SEQ ID NO. 8).

[0073] 1.3. Connection

[0074] The fragments obtained in step 1.1 and step 1.2 are connected into a linear DNA fragment by a connection kit. The linear DNA fragment (SEQ ID NO.9) has homology arms of the D-lactate dehydrogenase ldhA gene sequence at both ends and an apramycin resistance gene in the middle.

[0075] The upstream homology arms of D-lactate dehydrogenase are shown at positions 1 to 19 in the sequence of SEQ ID NO.9, and the downstream homology arms of hydrogenase-3 are shown at positions 1350 to 1369 in the sequence of SEQ ID NO.8; the apramycin resistance gene is shown at positions 494 to 1294 in the sequence of SEQ ID NO.9.

[0076] 1.4. Electroconversion

[0077] The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella pneumoniae Kp, and the transformation voltage was 2000V. The linear DNA fragment and the D-lactate dehydrogenase gene sequence on the chromosome were homologously recombined to screen and obtain strains with D-lactate dehydrogenase gene knockout. The specific steps are as follows:

[0078] 1) The pDK6-red plasmid (see patent CN 102517320 A) was transformed into Klebsiella pneumoniae Kp, and the Klebsiella pneumoniae Kp transformed with the pDK6-red plasmid was named Kp-pDK6-red strain.

[0079] 2) The linear DNA fragment of step 1.3 was transformed into Kp-pDK6-red competent cells by electroporation. Amprin was used to screen for resistant strains, and the resistant strain obtained by screening was named Kp-ΔldhA, in which the D-lactate dehydrogenase gene was inactivated by homologous recombination.

[0080] Preparation of Klebsiella oxytoca Ko expressing D-lactate dehydrogenase (ldhA): The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella oxytoca Ko using the same method as in step 1.4 to obtain Klebsiella oxytoca Ko with inactivated D-lactate dehydrogenase, named Ko-ΔldhA.

[0081] Preparation of Klebsiella mutans Kv expressing D-lactate dehydrogenase (ldhA): The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella mutans Kv using the same method as in step 1.4 to obtain Klebsiella mutans Kv with inactivated D-lactate dehydrogenase, named Kv-ΔldhA.

[0082] Preparation of Klebsiella michiganensis Km of D-lactate dehydrogenase (ldhA): The linear DNA fragment obtained in step 1.3 was transferred into Klebsiella michiganensis Km using the same method as in step 1.4 to obtain Klebsiella michiganensis Km of D-lactate dehydrogenase, which was named Km-ΔldhA.

[0083] Example 2 Construction of Klebsiella engineered bacteria with inactivated acetolactate synthase

[0084] In this embodiment, engineered Klebsiella bacteria in which only acetolactate synthase is inactivated are constructed, including Klebsiella pneumoniae Kp-ΔbudB, Klebsiella oxytoca Ko-ΔbudB, Klebsiella mutans Kv-ΔbudB, and Klebsiella michiganensis Km-ΔbudB.

[0085] The steps include:

[0086] 2.1. Construction of upstream and downstream fragments of the gene encoding acetolactate synthase (budB)

[0087] According to the genome information of Klebsiella pneumoniae 573 (genome sequence GenBank GCA_000240185.2), the upstream primer and downstream primer of PCR were designed for the budB gene of acetolactate synthase, i.e., SEQ ID No. 2. The specific sequence is as follows:

[0088] Upstream primer budB-up-f: acccggggatcctctagagatGAGGCTGTGAAATACCCAGTTCCTTG (SEQ ID NO.10)

[0089] Upstream primer budB-up-r: ggtcgacggatccccggaATGTGACCCCCTTAACTTTCTACGGAAC (SEQ ID NO.11)

[0090] Downstream primer budB-down-f:

[0091] cgaagcagctccagcctacAGTCATCACAATAAGGAAAGGAAAATGAAAAAAGTCGC(SEQ IDNO.12)

[0092] Downstream primer budB-down-r: tgcctgcaggtcgacgatTCCTCGCTCAAAGCAGGCC (SEQ ID NO. 13).

[0093] The upstream and downstream fragments of the acetolactate synthase gene were obtained by PCR amplification using the above primers and the Klebsiella pneumoniae Kp genomic DNA as a template.

[0094] 2.2. PCR amplification of streptomycin resistance gene sequence

[0095] The streptomycin resistance gene fragment was obtained by PCR amplification using primers and pIJ778 plasmid as template.

[0096] apr-F primer: ATGAGGGAAGCGGTGATCGC (SEQ ID NO. 14)

[0097] apr-R primer: TTATTTGCCGACTACCTTGGTGATCT (SEQ ID NO. 15).

[0098] 2.3 Connection

[0099] The fragments obtained in step 2.1 and step 2.2 were connected into a linear DNA fragment using a ligation kit. The linear DNA fragment (SEQ ID NO.16) has homologous arms of the budB gene sequence of acetolactate synthase at both ends and a streptomycin resistance gene in the middle.

[0100] The upstream homology arms of acetolactate synthase are shown at positions 1 to 20 in the sequence of SEQ ID NO.16, and the downstream homology arms of acetolactate synthase are shown at positions 1393 to 1411 in the sequence of SEQ ID NO.16; the streptomycin resistance gene is shown at positions 521 to 1312 in the sequence of SEQ ID NO.16.

[0101] 2.4. Electroporation

[0102] The linear DNA fragment obtained in step 2.3 was transferred into Klebsiella pneumoniae Kp, the transformation voltage was 2000V, the linear DNA fragment and the acetolactate synthase gene sequence on the chromosome were homologously recombined, and the strain with inactivated acetolactate synthase gene was screened. The specific steps are as follows:

[0103] 1) The pDK6-red plasmid was transformed into Klebsiella pneumoniae Kp, and the Klebsiella pneumoniae Kp transformed with the pDK6-red plasmid was named Kp-pDK6-red strain.

[0104] 2) The linear DNA fragment in step 2.3 was electroporated into Kp-pDK6-red competent cells. The resistant strain was selected using streptomycin, and the resistant strain obtained was named Kp-ΔbudB, in which the acetolactate synthase gene was inactivated by homologous recombination.

[0105] Preparation of Klebsiella oxytoca Ko expressing acetolactate synthase (budB): The linear DNA fragment obtained in step 2.3 was transferred into Klebsiella oxytoca Ko using the same method as step 2.4 to obtain Klebsiella oxytoca Ko with inactivated acetolactate synthase, which was named Ko-ΔldhA.

[0106] Preparation of Klebsiella variabilis Kv expressing acetolactate synthase (budB): The linear DNA fragment obtained in step 2.3 was transferred into Klebsiella variabilis Kv using the same method as step 2.4 to obtain Klebsiella variabilis Kv with inactivated acetolactate synthase, named Kv-ΔldhA.

[0107] Preparation of Klebsiella michiganensis Km expressing acetolactate synthase (budB): The linear DNA fragment obtained in step 2.3 was transferred into Klebsiella michiganensis Km using the same method as step 2.4 to obtain Klebsiella michiganensis Km in which acetolactate synthase was inactivated, named Km-ΔldhA.

[0108] Example 3D - Klebsiella engineered bacteria with simultaneous inactivation of lactate dehydrogenase and acetolactate synthase

[0109] In this example, acetolactate synthase (budB) was further knocked out based on the Klebsiella engineered bacteria in which D-lactate dehydrogenase (ldhA) was knocked out in Example 1, to obtain Klebsiella engineered bacteria in which both D-lactate dehydrogenase (ldhA) and acetolactate synthase (budB) were knocked out, including Klebsiella pneumoniae Kp-ΔldhAΔbudB, Klebsiella oxytoca Ko-ΔldhAΔbudB, Klebsiella variegata Kv-ΔldhAΔbudB, and Klebsiella michiganensis Km-ΔldhAΔbudB.

[0110] The steps include:

[0111] The linear DNA fragment obtained in step 1.3 of Example 1 was electrotransformed into Klebsiella pneumoniae Kp-ΔbudB, Klebsiella oxytoca Ko-ΔbudB, Klebsiella variegata Kv-ΔbudB and Klebsiella michiganensis Km-ΔbudB using the same method as step 1.4 of Example 1 to obtain Klebsiella engineered bacteria in which both the D-lactate dehydrogenase (ldhA) gene and the lactate dehydrogenase gene (budB) were inactivated, including Klebsiella pneumoniae Kp-ΔldhAΔbudB, Klebsiella oxytoca Ko-ΔldhAΔbudB, Klebsiella variegata Kv-ΔldhAΔbudB and Klebsiella michiganensis Km-ΔldhAΔbudB.

[0112] The construction process of Klebsiella pneumoniae Kp-ΔbudB, Klebsiella oxytoca Ko-ΔbudB, Klebsiella variabilis Kv-ΔbudB and Klebsiella michiganensis Km-ΔbudB described in this example is shown in Example 2.

[0113] Example 4 Gene expression verification experiment

[0114] In order to verify whether the engineered bacteria in Examples 1 and 3 were successfully constructed, the applicant also conducted an expression verification experiment of the D-lactate dehydrogenase (ldhA) gene and the lactate dehydrogenase gene (budB).

[0115] Specifically, the strains of the genotypes in Examples 1 and 3 were inoculated with fermentation medium, cultured at 35°C and 150 rpm until the logarithmic growth phase, the centrifuged bacterial solution was frozen and the supernatant was discarded, frozen with liquid nitrogen and sent to Meiji Biopharmaceutical Technology Co., Ltd. for prokaryotic transcriptome analysis.

[0116] The fermentation medium components are: glucose 20 g / L, xylose 20 g / L, beef powder 5 g / L, peptone 10 g / L, sodium chloride 5 g / L, potassium dihydrogen phosphate 0.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, and sodium hydroxide is used to adjust the initial pH to 7.0.

[0117] The specific results are shown in Table 1.

[0118] Table 1

[0119]

[0120]

[0121] Note: Gene expression was quantified using the TPM method, taking into account factors such as transcript length and the number of genes expressed in the sample.

[0122] As can be seen from Table 1, in Klebsiella pneumoniae Kp, Klebsiella oxytoca Ko, Klebsiella variegata Kv and Klebsiella michigan Km, the average expression levels of ldhA gene and budB gene were 61.55 and 1071, respectively; while in the engineered bacteria Kp△ldhA, Ko-ΔldhA, Kv-ΔldhA and Km-ΔldhA, the expression level of ldhA gene decreased significantly, only 3.5; in the engineered bacteria Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB, the average expression levels of ldhA gene and budB gene were 6.6 and 0, respectively, that is, the expression levels of ldhA gene and budB gene were significantly decreased.

[0123] This indicates that Examples 1 and 3 of the present application successfully prepared the engineered bacteria Kp△ldhA, Ko-ΔldhA, Kv-ΔldhA and Km-ΔldhA as well as Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB.

[0124] Example 5: Production of Hydrogen by Anaerobic Fermentation

[0125] In order to verify the hydrogen production rate of each strain provided in this application, the applicant conducted a fermentation experiment.

[0126] The applicant inoculated 1 loop each of the starting strains Klebsiella pneumoniae Kp, Klebsiella oxytoca Ko, Klebsiella mutans Kv and Klebsiella michiganensis Km and the engineered bacteria obtained in Examples 1 and 3 into a 250 mL conical flask, containing 50 mL of fermentation medium, and removed the air in the flask with nitrogen. The closed conical flask was maintained in an anaerobic state and connected to a gas collection bag. The speed was 100 rpm and the temperature was kept at 37°C for anaerobic fermentation culture.

[0127] The fermentation medium components are: glucose 20 g / L, xylose 20 g / L, beef powder 5 g / L, peptone 10 g / L, sodium chloride 5 g / L, potassium dihydrogen phosphate 0.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, and sodium hydroxide is used to adjust the initial pH to 7.0.

[0128] After culturing for 12 hours, the components in the fermentation broth and the production of hydrogen were measured.

[0129] Liquid chromatography was used to separate the fermentation broth components using an HPX-87H column and detect using a parallax and UV detector. The mobile phase was 0.005 mol / L sulfuric acid aqueous solution, the flow rate was 0.8 mL / min, the column oven was 65°C, and the injection volume was 20 μL.

[0130] A gas collecting bag was connected to the exhaust port of the conical flask, and the generated hydrogen was collected by the gas bag. The collected gas was measured for volume, and the concentrations of hydrogen, carbon dioxide and nitrogen therein were measured by gas chromatography to calculate the amount of hydrogen produced. The gas chromatography used a TDX-01 (2m×2mm) chromatographic column and a TCD detector. The fermentation results of each strain are shown in Tables 2 and 3.

[0131] Table 2

[0132] strain <![CDATA[H 2 (mol / mol monosaccharide)]]> <![CDATA[CO 2 (mol / mol monosaccharide)]]> <![CDATA[CO 2 / H 2 ]]> Klebsiella pneumoniae Kp 0.30 0.77 2.57 Klebsiella oxytoca Ko 0.28 0.80 2.86 Klebsiella mutans Kv 0.28 0.73 2.61 Klebsiella michiganensis Km 0.31 0.78 2.52 Kp-△ldhA 0.56 1.64 2.93 Ko-△ldhA 0.55 1.60 2.91 Kv-△ldhA 0.54 1.62 3.00 Km-△ldhA 0.56 1.65 2.95 Kp-△ldhA△budB 0.66 0.43 0.65 Ko-△ldhA△budB 0.68 0.41 0.60 Kv-△ldhA△budB 0.71 0.42 0.59 Km-△ldhA△budB 0.65 0.45 0.69

[0133] As shown in Table 2, under anaerobic conditions, the average hydrogen production rate of the wild-type Klebsiella bacteria Kp, Ko, Kv and Km was 0.29 mol / mol monosaccharide; the average hydrogen production rates of the engineered bacteria kp△ldhA, Ko-ΔldhA, Kv-ΔldhA and Km-ΔldhA with the D-lactate dehydrogenase gene inactivated alone and Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB with both the D-lactate dehydrogenase gene and the acetolactate synthase gene inactivated simultaneously were 0.55 mol / mol monosaccharide and 0.68 mol / mol monosaccharide, respectively.

[0134] Therefore, compared with the wild-type Klebsiella bacteria, the average hydrogen production rate of the engineered bacteria with the D-lactate dehydrogenase gene alone inactivated and the D-lactate dehydrogenase gene and acetolactate synthase gene inactivated simultaneously increased by 89.7% and 134%, respectively.

[0135] In addition, as shown in Table 2, the CO 2 The average emission was 0.77 mol / mol monosaccharide. For the Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB engineered bacteria with both D-lactate dehydrogenase and acetolactate synthase genes inactivated, their CO 2 The average emission is 0.42 mol / mol monosaccharide. Therefore, when producing the same amount of hydrogen, the engineered bacteria with both the D-lactate dehydrogenase gene and the acetolactate synthase gene inactivated produce more CO than the wild-type Klebsiella bacteria. 2 Average emissions were reduced by 74.5%.

[0136] Therefore, the engineered bacteria provided by the technical solution that have inactivated the D-lactate dehydrogenase gene alone or the D-lactate dehydrogenase gene and the acetolactate synthase gene simultaneously have an average hydrogen production rate significantly improved compared with the wild-type Klebsiella bacteria. In addition, for the engineered bacteria that have inactivated the D-lactate dehydrogenase gene and the acetolactate synthase gene simultaneously, on the basis of significantly improving the average hydrogen production rate, CO can be further reduced.2 Average emissions.

[0137] Table 3

[0138]

[0139] As shown in Table 3, under anaerobic conditions, the main metabolites of the wild-type Klebsiella bacteria Kp, Ko, Kv and Km are 2,3-butanediol, lactic acid and ethanol; the main metabolites of the engineered bacteria Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA and Km-ΔldhA in which the D-lactate dehydrogenase gene is inactivated alone under anaerobic conditions are 2,3-butanediol and ethanol; the main metabolites of the engineered bacteria Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB in which both the D-lactate dehydrogenase gene and the acetolactate synthase gene are inactivated under anaerobic conditions are acetic acid and ethanol.

[0140] From Table 3 and Table 2, it can be seen that the average hydrogen production rate of the Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA and Km-ΔldhA engineered bacteria with inactivated D-lactate dehydrogenase gene provided in the present application is significantly higher, and more hydrogen can be obtained; in addition, the Kp-ΔldhAΔbudB, Ko-ΔldhAΔbudB, Kv-ΔldhAΔbudB and Km-ΔldhAΔbudB engineered bacteria with inactivated D-lactate dehydrogenase gene and acetolactate synthase gene provided in the present application not only make the average hydrogen production rate significantly higher, but also can reduce CO 2 Average emissions, and its main metabolites are acetic acid and ethanol, which are also commonly used chemical reagents on the market.

[0141] Example 6 Anaerobic fermentation to produce hydrogen

[0142] This example is basically the same as Example 5, except for the fermentation medium components and fermentation conditions, the rest are exactly the same.

[0143] In this embodiment, the fermentation medium components are: 10 g / L glucose, 5 g / L beef powder, 10 g / L peptone, 5 g / L sodium chloride, 3.63 g / L potassium dihydrogen phosphate, 5.7 g / L disodium hydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, and the initial pH is adjusted to 7.0 with sodium hydroxide.

[0144] The fermentation conditions were as follows: the shaking speed was 150 rpm and the fermentation culture was carried out at a constant temperature of 35°C.

[0145] The hydrogen production rate and main metabolites of each strain in this example are shown in Table 4.

[0146] Table 4

[0147]

[0148] As shown in Table 4, the average hydrogen production rate of Klebsiella bacteria is 0.41 mol / mol monosaccharide, and the average hydrogen production rates of the engineered bacteria with the D-lactate dehydrogenase gene inactivated alone and the D-lactate dehydrogenase gene and the acetolactate synthase gene inactivated simultaneously are 0.78 mol / mol monosaccharide and 1.15 mol / mol monosaccharide, respectively. Compared with Klebsiella bacteria, the average hydrogen production rates of the engineered bacteria with the D-lactate dehydrogenase gene inactivated alone and the D-lactate dehydrogenase gene and the acetolactate synthase gene inactivated simultaneously were increased by 90.2% and 180.5%, respectively.

[0149] As shown in Table 4, the main metabolites of Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB engineered bacteria in which both the D-lactate dehydrogenase gene and the acetolactate synthase gene were inactivated under anaerobic conditions were acetic acid and ethanol.

[0150] Therefore, the average hydrogen production rate of the Kp-ΔldhA, Ko-ΔldhA, Kv-ΔldhA and Km-ΔldhA engineered bacteria with inactivated D-lactate dehydrogenase gene provided in the present application is significantly higher, and more hydrogen can be obtained; in addition, the Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB engineered bacteria with inactivated D-lactate dehydrogenase gene and acetolactate synthase gene provided in the present application not only make the average hydrogen production rate significantly higher, but also their main metabolites are acetic acid and ethanol, which are commonly used chemical reagents on the market.

[0151] Example 7 Experiment on optimizing fermentation medium

[0152] In order to further improve the hydrogen productivity of the strain, the applicant selected the better strains in the present application: Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB engineered bacteria in which both the D-lactate dehydrogenase gene and the acetolactate synthase gene are inactivated, to further optimize the formula of the fermentation medium.

[0153] Specifically, the fermentation medium components are: 25.9 g / L molasses, 5 g / L beef powder, 10 g / L peptone, 5 g / L sodium chloride, 3.63 g / L potassium dihydrogen phosphate, 5.7 g / L disodium hydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, and the initial pH is adjusted to 6.0 with concentrated hydrochloric acid. The molasses is commercially available molasses, and the total sugar content thereof is equivalent to 386.2 g sucrose / kg molasses fresh weight as detected by the anthrone method.

[0154] Other fermentation conditions and processes are exactly the same as in Example 6.

[0155] Example 8

[0156] This example is exactly the same as Example 7, except that the initial pH of the fermentation medium is adjusted to 6.3 with concentrated hydrochloric acid, and the rest is exactly the same.

[0157] Example 9

[0158] This example is exactly the same as Example 7, except that the initial pH of the fermentation medium is adjusted to 6.6 with concentrated hydrochloric acid, and the rest is exactly the same.

[0159] Example 10

[0160] This example is exactly the same as Example 7, except that the initial pH of the fermentation medium is adjusted to 6.9 with sodium hydroxide, and the rest is exactly the same.

[0161] Embodiment 11

[0162] This example is exactly the same as Example 7, except that the initial pH of the fermentation medium is adjusted to 7.2 with sodium hydroxide, and the rest is exactly the same.

[0163] The applicant has made statistics on the hydrogen production rate of each strain after fermentation in Examples 7 to 11. The specific results are shown in Tables 5 and Figure 1 shown.

[0164] Table 5

[0165]

[0166]

[0167] From Table 5 and Figure 1 It can be seen that in order to further increase the hydrogen production, the applicant has further optimized the formula of the culture medium. The applicant uses molasses as the main carbon source, which can significantly increase the hydrogen yield of the Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB engineered bacteria that simultaneously inactivate the D-lactate dehydrogenase gene and the acetolactate synthase gene provided in this application, compared with the use of glucose, to 2.15-3.12 mol / mol sucrose, and also provides a new path for the green treatment of molasses.

[0168] More preferably, on the basis of using molasses as the main carbon source, when the initial pH of the fermentation medium is 6.3-6.9, the hydrogen yield of Kp-△ldhA△budB, Ko-△ldhA△budB, Kv-△ldhA△budB and Km-△ldhA△budB engineered bacteria in which both the D-lactate dehydrogenase gene and the acetolactate synthase gene are inactivated can be further improved.

[0169] Therefore, when molasses is used as the main carbon source, the hydrogen yield of the engineered bacteria with both the D-lactate dehydrogenase gene and the acetolactate synthase gene inactivated in the present application can be significantly improved, while the industrial waste molasses is effectively utilized to achieve green treatment of molasses.

[0170] In summary, the technical solution of the present invention can significantly improve the hydrogen production rate of Klebsiella engineered bacteria, and when the D-lactate dehydrogenase gene and the acetolactate synthase gene are inactivated at the same time, the hydrogen production rate is further improved. At the same time, the main metabolites are acetic acid and ethanol, which are commonly used substances in industry.

[0171] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. An engineered bacterium of the genus Klebsiella, characterized in that The engineered Klebsiella bacteria are Klebsiella bacteria with an inactivated D-lactate dehydrogenase gene.

2. The Klebsiella engineered bacterium according to claim 1, characterized in that The Klebsiella engineered bacteria are Klebsiella bacteria in which both the D-lactate dehydrogenase gene and the acetolactate synthase gene are inactivated.

3. The Klebsiella engineered bacterium according to claim 1 or 2, characterized in that The Klebsiella bacteria are selected from Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variegata, Klebsiella michiganensis, Klebsiella pseudopneumoniae, Klebsiella aerogenes, Klebsiella pseudovariegata, Klebsiella huaxiensis, Klebsiella africana, Klebsiella pastoriensis or Klebsiella grisei; And / or, the D-lactate dehydrogenase gene is ldhA gene; And / or, the acetolactate synthase gene is a budB gene.

4. The Klebsiella engineered bacterium according to claim 3, characterized in that The wild-type nucleotide sequence of the ldhA gene is shown in SEQ ID No.1; the wild-type nucleotide sequence of the budB gene is shown in SEQ ID No.

2.

5. A method for constructing an engineered bacterium of the genus Klebsiella according to any one of claims 1 to 4, characterized in that: The steps include: Knockout of the D-lactate dehydrogenase gene in Klebsiella bacteria; Preferably, the method further comprises knocking out the acetolactate synthase gene in the Klebsiella bacteria.

6. Use of the engineered Klebsiella bacteria according to any one of claims 1 to 4 in improving the hydrogen production efficiency of Klebsiella bacteria or producing hydrogen in the field of biological hydrogen production.

7. A method for producing hydrogen, characterized in that: The method comprises fermenting with the Klebsiella engineered bacteria as described in any one of claims 1 to 4.

8. The method according to claim 7, characterized in that The components of the fermentation medium include: 10-40 g / L of carbon source, 10-15 g / L of nitrogen source, and 6-20 g / L of inorganic salt.

9. The method according to claim 7, characterized in that: The fermentation conditions include at least one of the following technical features: a) The fermentation temperature is 35-37°C; b) The fermentation method is anaerobic fermentation.

10. The method according to claim 8, characterized in that Using a pH regulator to adjust the initial pH of the fermentation medium to 5.5-7.5; and / or, the carbon source is selected from one or more of glucose, xylose and molasses; And / or, the nitrogen source is selected from one or more of beef extract, beef extract powder and peptone; And / or, the inorganic salt is selected from one or more of sodium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate and magnesium sulfate heptahydrate.

Images