RNA cyclization composition for improving cyclization efficiency, and preparation method and application of circRNA

Abstract

The invention belongs to the technical field of molecular biology, and discloses an RNA cyclization composition for improving cyclization efficiency, and a preparation method and application of circRNA. The composition for RNA cyclization comprises a precursor fragment and a cyclization induction fragment, the cyclization induction fragment comprises an affinity arm I and an affinity arm II which are complementarily paired with two ends of a to-be-cyclized sequence respectively, and the space distance of 3 '-intron and 5'-intron is effectively shortened through the bridging effect of the cyclization induction fragment, so that the cyclization effect of the RNA is improved, and the cyclization effect of the RNA is improved. According to the present invention, the two transesterification reactions are introduced, such that the active sites for catalyzing the two transesterification reactions are close to each other, the precursor fragment has excellent in-vitro cyclization efficiency, and the circRNA obtained through cyclization has characteristics of extremely low exogenous nucleotide residue and high biological safety.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to an RNA cyclization composition for improving cyclization efficiency, a preparation method of circRNA and applications thereof. Background Art

[0002] The permuted intron-exon (PIE) strategy based on the breakage and recombination of group I introns is widely used to synthesize circular RNA (circRNA) in vitro. The cyclization of RNA depends largely on the secondary or tertiary structure of the precursor RNA. At present, the methods to improve the cyclization efficiency of circRNA are very limited. The most common practice is to retain the exons adjacent to the two ends of the group I intron in the precursor fragment of the synthetic circRNA, and to introduce homologous arms in the upstream and downstream of the precursor fragment to improve the structure of the transcribed precursor RNA, so that the 5' and 3' splicing sites are close to each other to promote cyclization, which improves the cyclization efficiency to a certain extent. However, there are more exogenous nucleotides remaining in the circRNA obtained by cyclization using the existing technology, which may lead to unexpected immunogenicity and low biosafety; and the exons may also interact with the introduced homologous arms, affecting the formation of splicing bubbles, which is not conducive to the cyclization to form the expected circRNA, and has great limitations. Summary of the invention

[0003] The first object of the present invention is to provide a composition for RNA cyclization. The composition specifically includes a precursor fragment and a cyclization inducing fragment, wherein the cyclization inducing fragment includes an affinity arm I and an affinity arm II, and the affinity arm I and the affinity arm II are respectively complementary to the two ends of the sequence to be cyclized. Through the bridging effect of the cyclization inducing fragment, the distance between the 3'-intron and the 5'-intron in space is effectively shortened, so that the active sites catalyzing the two transesterification reactions are close to each other. Compared with the original precursor fragment, the precursor fragment bridged by the cyclization inducing fragment has a higher self-splicing catalytic activity, and can better realize the cyclization of RNA. In addition, the precursor fragment only includes 3'-intron and 5'-intron at both ends of the sequence to be cyclized, which can be almost completely sheared off in vitro cyclization, and the resulting circRNA has only 0 to 5 nt exogenous nucleotides. The preparation of circRNA using the RNA cyclization composition has the advantages of high cyclization efficiency and very small amount of exogenous nucleotide residues, and has good application prospects.

[0004] The second object of the present invention is to provide a method for preparing circRNA.

[0005] The third object of the present invention is to provide the use of the above-mentioned RNA cyclization composition in the preparation of RNA drugs, preparation of RNA vaccines and / or regulation of cell expression.

[0006] Specifically, the RNA cyclization composition provided by the present invention includes: a precursor fragment, which includes a 3'-intron, a sequence to be cyclized and a 5'-intron connected in sequence along the 5' to 3' direction; a cyclization inducing fragment, which includes an affinity arm I and an affinity arm II, wherein the affinity arm I is complementary to the 5' end sequence of the sequence to be cyclized, and the affinity arm II is complementary to the 3' end sequence of the sequence to be cyclized.

[0007] Furthermore, the sequence to be cyclized includes an IRES sequence and a coding sequence in sequence from 5' to 3' direction.

[0008] Furthermore, the length of the affinity arm I is 15 to 35 bp, and the length of the affinity arm II is 15 to 35 bp.

[0009] Furthermore, the cyclization inducing fragment consists of an affinity arm I and an affinity arm II.

[0010] Furthermore, the cyclization inducing fragment is ssDNA and / or ssRNA.

[0011] Furthermore, the molar ratio of the precursor fragment to the cyclization inducing fragment is 1:(1-50).

[0012] Further, the 3'-intron and the 5'-intron are derived from one or more of the type I intron of the CoB gene of Fusarium oxysporum, the type I intron of the thymidylate synthase gene of T4 bacteriophage, the type I intron of the precursor tRNA of Anabaena, and the type I intron of the precursor rRNA of Tetrahymena thermophila.

[0013] Furthermore, the 3'-intron and the 5'-intron are derived from type I introns of the CoB gene of Fusarium oxysporum, the nucleotide sequence of the 3'-intron is shown in SEQ ID NO:1, and the nucleotide sequence of the 5'-intron is shown in SEQ ID NO:4.

[0014] Furthermore, the cyclization inducing fragment consists of affinity arm I, E2, E1 and affinity arm II connected sequentially from the 5' to the 3' end; the nucleotide sequence of E2 is shown in SEQ ID NO:7, SEQ ID NO:10 or SEQ ID NO:12, and the nucleotide sequence of E1 is shown in SEQ ID NO:8, SEQ ID NO:11 or SEQ ID NO:13.

[0015] Furthermore, the 3'-intron and the 5'-intron are derived from type I introns of Anabaena precursor tRNA; the nucleotide sequence of the 3'-intron is shown in SEQ ID NO: 14, and the nucleotide sequence of the 5'-intron is shown in SEQ ID NO: 15.

[0016] Furthermore, the cyclization inducing fragment consists of affinity arm I, E2, E1 and affinity arm II connected sequentially from the 5' to the 3' end; the nucleotide sequence of E2 is shown in SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO: 20, and the nucleotide sequence of E1 is shown in SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21.

[0017] Furthermore, the RNA cyclization composition also includes Hammerhead ribozyme.

[0018] Furthermore, the nucleotide sequence of the Hammerhead ribozyme is shown in SEQ ID NO:5.

[0019] The preparation method of circRNA provided by the present invention comprises: taking the above-mentioned RNA cyclization composition to perform an in vitro transcription reaction to obtain an in vitro transcription product; taking the in vitro transcription product to perform an in vitro cyclization reaction to obtain the circRNA.

[0020] The present invention also provides the use of the above-mentioned RNA cyclization composition in preparing RNA drugs, preparing RNA vaccines and / or regulating cell expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the structures of the precursor fragment and the cyclization-inducing fragment in the RNA cyclization composition provided in Example 3 of the present invention and the cyclization process thereof.

[0022] Figure 2 This is one of the experimental result graphs of the cyclization efficiency test provided in Example 12 of the present invention.

[0023] Figure 3 FIG2 is the experimental result diagram of the cyclization efficiency test provided in Example 12 of the present invention.

[0024] Figure 4 Figure 3 is the experimental result of the cyclization efficiency test provided in Example 12 of the present invention.

[0025] Figure 5 This is a graph showing the experimental results of the cyclization efficiency test provided in Example 17 of the present invention. DETAILED DESCRIPTION

[0026] Based on a deep understanding of the spatial structure of most type I introns and the conformational changes during the self-splicing catalytic process, the inventors of the present invention have found through extensive and in-depth research that by introducing an exogenous fragment whose two ends are complementary to the two ends of the sequence to be cyclized, the bridging effect of the exogenous fragment can effectively shorten the distance between the 3'-intron and the 5'-intron in space, so that the catalytic active sites are close to each other, and the catalytic active sites are correctly folded and connected to form a more ideal spatial conformation, which is conducive to the cyclization of RNA, so that the precursor fragment has excellent cyclization efficiency without introducing exons and exogenous affinity arms, and no exogenous nucleotides are introduced into the circRNA obtained by cyclization, and the biological safety is high. Based on this, the technical solution of the present invention is obtained.

[0027] In the present invention, the RNA cyclization composition specifically includes a precursor fragment and a cyclization inducing fragment. The precursor fragment is a template conventionally used in the existing PIE strategy, and the cyclization inducing fragment is a key substance creatively adopted by the present invention to promote cyclization and improve cyclization efficiency. Through its bridging effect, the self-splicing catalytic activity of the precursor fragment can be effectively improved, thereby achieving a good cyclization effect.

[0028] In the present invention, the cyclization-inducing fragment is limited to being able to achieve the aforementioned bridging effect to improve the self-splicing catalytic activity of the precursor fragment. The present invention does not impose any particular limitation on its specific form, and it can be, but is not limited to, one or more of dsDNA, ssDNA, dsRNA and ssRNA. In some specific embodiments, the cyclization-inducing fragment is more preferably ssDNA and / or ssRNA.

[0029] In the present invention, the molar ratio of the precursor fragment to the cyclization inducing fragment is preferably 1:(1-50), such as 1:1, 1:3, 1:6, 1:10, 1:15, 1:30, 1:40, 1:50 or any value therebetween. At this time, a sufficient number of cyclization inducing fragments in the in vitro transcription reaction system and the in vitro cyclization reaction body can better achieve the effect of promoting cyclization and improving cyclization efficiency.

[0030] In the present invention, the precursor fragment does not introduce additional exogenous exons and exogenous homology arms, and specifically includes a 3'-intron, a sequence to be cyclized, and a 5'-intron sequentially connected along the 5' to 3' direction. The precursor fragment has excellent cyclization efficiency under the action of the cyclization inducing fragment, and only 0 to 5 nt of exogenous nucleotides remain in the circRNA obtained after cyclization.

[0031] In the present invention, the cyclization inducing fragment at least includes affinity arm I and affinity arm II. Wherein, the affinity arm I is designed according to the 5' end sequence of the sequence to be cyclized in the precursor fragment, that is, the affinity arm I is complementary to the 5' end sequence of the sequence to be cyclized. The affinity arm II is designed according to the 3' end sequence of the sequence to be cyclized in the precursor fragment, that is, the affinity arm II is complementary to the 3' end sequence of the sequence to be cyclized. Wherein, the 5' end sequence refers to the sequence close to the 5' end of the sequence to be cyclized, and the distance between the 5' end sequence and the 5' end of the sequence to be cyclized can be 0 to 50 bp, such as 0 bp, 4 bp, 5 bp, 8 bp, 10 bp, 20 bp, 38 bp, 50 bp or any integer value therebetween. The 3' end sequence refers to the sequence close to the 3' end of the sequence to be cyclized, and the distance between the 3' end sequence and the 3' end of the sequence to be cyclized can be 0 to 50 bp, such as 0 bp, 2 bp, 5 bp, 6 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp or any integer value therebetween.

[0032] In the present invention, "I" and "II" in the affinity arm I and affinity arm II are only used for distinction to facilitate description and have no other special meaning.

[0033] In the present invention, the cyclization inducing fragment is preferably composed of affinity arm I and affinity arm II. The cyclization inducing fragment is more preferably composed of affinity arm I and affinity arm II connected sequentially from the 5' to the 3' end. At this time, the cyclization inducing fragment is rigidly connected to the two ends of the sequence to be cyclized, and the distance between the 3'-intron and the 5'-intron is the shortest. The conformation of the 3'-intron and the 5'-intron can be changed under the induction of in vitro cyclization conditions to restore the self-splicing catalytic activity. The cyclization efficiency can be significantly improved through the synergistic cooperation of the cyclization inducing fragment and the in vitro cyclization conditions.

[0034] In the present invention, when the cyclization inducing fragment is composed of affinity arm I and affinity arm II, the cyclization inducing fragment is applicable to most of the precursor fragments in the existing PIE strategy. Those skilled in the art can design the nucleotide sequences of affinity arm I and affinity arm II in the cyclization inducing fragment based on the above description of affinity arm I and affinity arm II and the precursor fragment actually used. The present invention does not impose any particular limitation on the specific nucleotide sequences of affinity arm I and affinity arm II.

[0035] In the present invention, the length of the affinity arm I is preferably 15 to 35 bp, such as 15 bp, 18 bp, 20 bp, 25 bp, 30 bp, 35 bp or any integer value therebetween; the length of the affinity arm II is preferably 15 to 35 bp, such as 15 bp, 20 bp, 28 bp, 30 bp, 35 bp or any integer value therebetween. At this time, the cyclization-inducing fragment can bring the 3'-intron and the 5'-intron sufficiently close, and the complex formed by complementary pairing with the precursor fragment has appropriate stability, so that the cyclization-inducing fragment can achieve a good effect of promoting cyclization, and can be easily removed after the cyclization is completed.

[0036] In the present invention, the 3'-intron and the 5'-intron are derived from the known type I introns with self-splicing catalytic activity, which can be obtained by breaking and reversing the sequence of the known type I introns, or by modifying the sequences obtained by the aforementioned breaking and reversing by base addition, base substitution and / or domain deletion, etc., and the present invention does not impose any particular limitation thereto.

[0037] In the present invention, specific examples of the type I intron include but are not limited to: one or more of the type I intron of the CoB gene of Fusarium oxysporum, the type I intron of the thymidylate synthase gene of T4 phage, the type I intron of the precursor tRNA of Anabaena, and the type I intron of the precursor rRNA of Tetrahymena thermophila.

[0038] In the present invention, the cyclization inducing fragment may preferably also include one or more segments of exons (E1 and E2), partial sequences in 3'-introns and partial sequences in 5'-introns. Wherein, the exons (E1 and E2) are homologous to the 3'-introns and 5'-introns in the precursor fragments.

[0039] In some specific embodiments, the cyclization inducing fragment is preferably composed of affinity arms I, E2, E1 and affinity arm II connected in sequence. At this time, the cyclization inducing fragment has the function of bridging the 3'-intron and the 5'-intron, and the E2 and E1 thereon interact with the 3'-intron and the 5'-intron to form a more complete type I intron structure, which can effectively improve the self-splicing catalytic activity of the 3'-intron and the 5'-intron, thereby achieving a good cyclization effect.

[0040] In some specific embodiments, when the 3'-intron and the 5'-intron are derived from the type I intron of the CoB gene of Fusarium oxysporum, the nucleotide sequence of E2 is shown in SEQ ID NO: 7, SEQ ID NO: 10 or SEQ ID NO: 12, and the nucleotide sequence of E1 is shown in SEQ ID NO: 8, SEQ ID NO: 11 or SEQ ID NO: 13. The nucleotide sequence of the 3'-intron is specifically shown in SEQ ID NO: 1; the nucleotide sequence of the 5'-intron is specifically shown in SEQ ID NO: 4.

[0041] In some specific embodiments, when the 3'-intron and the 5'-intron are derived from the type I intron of the Anabaena precursor tRNA, the nucleotide sequence of the E2 is shown in SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO: 20, and the nucleotide sequence of the E1 is shown in SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21. The nucleotide sequence of the 3'-intron is shown in SEQ ID NO: 14; and the nucleotide sequence of the 5'-intron is shown in SEQ ID NO: 15.

[0042] In the present invention, the RNA cyclization composition preferably also includes a Hammerhead ribozyme. The Hammerhead ribozyme refers to an RNA sequence with self-catalytic cleavage ability, and the RNA sequence has a hammerhead structure. At this time, the introduction of the Hammerhead ribozyme is conducive to the process of self-cleavage and separation of the cyclization-induced fragment after co-transcription of the RNA.

[0043] In some specific embodiments, the nucleotide sequence of the Hammerhead ribozyme is preferably as shown in SEQ ID NO:5.

[0044] In the present invention, the sequence to be cyclized refers to the sequence to be retained in the circRNA, which is divided into coding sequence and non-coding sequence according to the role played. Those skilled in the art can make adaptive selection according to the circRNA to be obtained, and the present invention does not impose any special limitation on it.

[0045] In the present invention, the coding sequence refers to the base sequence encoding RNA or protein synthesis. Those skilled in the art can make adaptive selections based on the desired circRNA, and the present invention does not impose any particular limitation thereto.

[0046] In the present invention, the non-coding sequence refers to a base sequence with a gene expression regulation function, and specific examples may be, but are not limited to, one or more of an IRES sequence, a Kozak sequence, and a uORF sequence. Those skilled in the art may make an adaptive selection based on the desired circRNA, and the present invention does not impose any particular limitation thereto.

[0047] In the present invention, the sequence to be cyclized preferably includes an IRES sequence and a coding sequence. In some specific embodiments, specific examples of the IRES sequence include but are not limited to: one or more of a CVB3 IRES sequence, an EV71 IRES sequence, and an EMCVIRES sequence. Among them, the CVB3 IRES sequence refers to an IRES sequence derived from Coxsackievirus B3 (CVB3); the EV71 IRES sequence refers to an IRES sequence derived from enterovirus 71 (EV71); the EMCVIRES sequence refers to an IRES sequence derived from encephalomyocarditis virus (EMCV). In some preferred embodiments, when the nucleotide sequences of the 3'-intron and the 5'-intron are specifically as shown in SEQ ID NO: 1 and 4, the IRES sequence is preferably arranged at one end of the sequence to be cyclized away from the 5'-intron, that is, the sequence to be cyclized includes an IRES sequence and a coding sequence in sequence along the 5' to 3' direction.

[0048] In the present invention, the 3'-intron, 5'-intron and sequence to be cyclized are only exemplary descriptions and do not limit the protection scope of the present invention. Those skilled in the art can design the cyclization-inducing fragment based on the scheme disclosed in the present invention. That is, the technical solutions of introducing nucleotide fragments complementary to both ends of the sequence to be cyclized during the preparation of circRNA so as to bring the self-splicing catalytic active sites close to each other are all included in the protection scope of the present invention.

[0049] In the present invention, the RNA cyclization composition may further include an in vitro transcription reaction reagent and / or an in vitro cyclization reaction reagent. Wherein, the in vitro transcription reaction reagent is a type of reagent conventionally used in in vitro transcription reactions, and those skilled in the art may make adaptive choices according to actual needs, and the present invention does not specifically limit its specific components and proportions. The in vitro cyclization reaction reagent is a type of reagent conventionally used in in vitro cyclization reactions, and those skilled in the art may make adaptive choices according to actual needs, and the present invention does not specifically limit its specific components and proportions.

[0050] The present invention also provides a method for preparing circRNA, which specifically comprises: taking the above-mentioned RNA cyclization precursor fragment and / or RNA cyclization composition for in vitro transcription reaction to obtain an in vitro transcription product; taking the in vitro transcription product for in vitro cyclization reaction to obtain the circRNA.

[0051] In the present invention, the in vitro transcription reaction refers to the synthesis of RNA molecules by simulating the intracellular transcription process in a laboratory environment. It is a technology commonly used in the field of molecular biology. Those skilled in the art can make adaptive choices based on actual needs. The present invention does not impose any particular limitations on its specific steps, reagents and conditions.

[0052] In the present invention, the in vitro cyclization reaction refers to the synthesis of circRNA by simulating the intracellular RNA cyclization process in a laboratory environment. It is a technology commonly used in the field of molecular biology. Those skilled in the art can make adaptive choices according to actual needs. The present invention does not impose any particular limitations on its specific steps, reagents and conditions.

[0053] In the present invention, the circRNA prepared by the above preparation method only has 0 to 5 nt of exogenous nucleotides remaining, and has higher biological activity and biosafety.

[0054] The present invention also provides the use of the above-mentioned RNA cyclization precursor fragment and / or RNA cyclization composition in the preparation of RNA drugs, the preparation of RNA vaccines and / or the regulation of cell expression.

[0055] Embodiments of the present invention are described in detail below, and the examples of the embodiments are intended to be used to explain the present invention, but should not be construed as limiting the present invention. In the embodiments, if specific techniques or conditions are not specified, the techniques or conditions described in the literature in this area or the product specifications are used. If the manufacturer is not specified for reagents or instruments used, they are all conventional products that can be obtained commercially.

[0056] After the precursor fragments and cyclization-inducing fragments involved in the following examples were designed, they were commissioned to a chemical synthesis company for synthesis.

[0057] Example 1

[0058] This example is used to illustrate a precursor fragment for RNA cyclization, which is dsDNA, and specifically includes a 3'-intron, a CVB3 IRES sequence, a GFP sequence and a 5'-intron connected in sequence along the 5' to 3' direction, and the 3'-intron and 5'-intron sequences are derived from the cob gene of Fusarium oxysporum, and the specific nucleotide sequences are shown in Table 1.

[0059] Table 1.

[0060]

[0061]

[0062] Example 2

[0063] This example is used to illustrate a precursor fragment for RNA cyclization. The precursor fragment is dsDNA, which specifically includes a 3'-intron, a GFP sequence, a CVB3 IRES sequence and a 5'-intron sequentially connected along the 5' to 3' direction. The specific nucleotide sequence is shown in Table 1.

[0064] Example 3

[0065] This example is used to illustrate a composition for RNA cyclization, which comprises the precursor fragment and the cyclization-inducing fragment provided in Example 1 at a molar ratio of 1:1, and the precursor fragment and the cyclization-inducing fragment can be induced to self-cleave and separate by the Hammerhead ribozyme with a sequence as shown in SEQ ID: 5. Wherein, the cyclization-inducing fragment is ssRNA, which specifically comprises affinity arms I, E2, E1 and affinity arm II sequentially connected along the 5' to 3' direction, and affinity arm I is complementary to the 5' end sequence of the CVB3 IRES sequence, and affinity arm II is complementary to the 3' end sequence of the GFP sequence, and the specific nucleotide sequences of each fragment are shown in Table 2.

[0066] Table 2.

[0067]

[0068] Reference Figure 1 When the composition provided in this embodiment is used to prepare circular RNA, the cyclization-inducing fragment can be self-cleaved and separated under the action of the Hammerhead ribozyme, and the affinity arm II and the affinity arm I in the cyclization-inducing fragment are respectively bound to the 3' end of the GFP sequence and the 5' end of the CVB3 IRES sequence, effectively shortening the spatial distance between the 3'-intron and the 5'-intron in the precursor fragment, which is beneficial for the 3'-intron and the 5'-intron to exert their self-cleavage catalytic activity, effectively improving the cyclization effect of RNA, and thus obtaining a circRNA with extremely low exogenous nucleotide residues.

[0069] Example 4

[0070] The RNA cyclization composition provided in this example is basically the same as that in Example 3, except that the E2' and E1' fragments shown in Table 3 are used instead of the E2 and E1 fragments in the cyclization-inducing fragments, and the other conditions are the same to obtain the RNA cyclization composition.

[0071] Table 3

[0072]

[0073]

[0074] Example 5

[0075] The RNA cyclization composition provided in this example is basically the same as that in Example 3, except that the E2" and E1" fragments shown in Table 4 are used to replace the E2 and E1 fragments in the cyclization-inducing fragment, and the other conditions are the same to obtain the RNA cyclization composition.

[0076] Table 4.

[0077] sequence name SEQ ID NO: Nucleotide sequence E2” 12 TATGTTTTACCTTATGGACAAATGTCATTATGAGGTGC E1” 13 CGCATCTTAGAGCACCAAGAACATTGACATGAGTTATAGGTACAATAAT

[0078] Example 6

[0079] The RNA cyclization composition provided in this embodiment is basically the same as that in embodiment 3, except that the cyclization-inducing fragment does not include the sequences of E1 and E2, that is, the 5' end of affinity arm II is directly connected to the 3' end of affinity arm I, and other conditions are the same to obtain an RNA cyclization composition.

[0080] Comparative Example 1

[0081] This comparative example provides a composition for RNA cyclization, which uses the intron sequence in Example 1, and the composition for RNA cyclization includes a precursor fragment for RNA cyclization but does not include a cyclization inducing fragment, and the precursor fragment includes exon sequences at both ends of the cob gene type I intron of Fusarium oxysporum; wherein the precursor fragment for cyclization is dsDNA, which specifically includes a 3'-intron, E2, a CVB3 IRES sequence, a GFP sequence, E1 and a 5'-intron connected in sequence along the 5' to 3' direction, as shown in Tables 1 and 2.

[0082] Comparative Example 2

[0083] This comparative example provides a composition for RNA cyclization, which uses the intron sequence in Example 1, and the composition for RNA cyclization includes a precursor fragment for RNA cyclization but does not include a cyclization inducing fragment, and the precursor fragment includes a type I intron of the cob gene of Fusarium oxysporum; wherein the precursor fragment for cyclization is dsDNA, which specifically includes a 3'-intron, E2, a GFP sequence, a CVB3 IRES sequence, E1 and a 5'-intron connected in sequence along the 5' to 3' direction, as shown in Tables 1 and 2.

[0084] Example 7

[0085] This example is used to illustrate a precursor fragment for RNA cyclization, which is dsDNA, and specifically includes 3'-intron-2, CVB3 IRES sequence, GFP sequence and 5'-intron-2 connected in sequence along the 5' to 3' direction; and 3'-intron-2 and 5'-intron-2 are derived from the Anabaena pre-tRNA gene, and the nucleotide sequences are specifically shown in Table 5, and the nucleotide sequences of the CVB3IRES sequence and the GFP sequence are specifically shown in Table 1.

[0086] Table 5.

[0087]

[0088] Example 8

[0089] This example is used to illustrate a composition for RNA cyclization, which includes the precursor sequence, cyclization-inducing fragment and Hammerhead ribozyme provided in Example 7. The cyclization-inducing fragment is dsDNA, which can be transcribed in vitro with the precursor fragment to generate ssRNA, thereby promoting cyclization, and specifically includes affinity arm I, E2-2, E1-2 and affinity arm II connected in sequence along the 5' to 3' direction, the nucleotide sequences of E2-2 and E1-2 fragments are specifically shown in Table 6, and the nucleotide sequences of affinity arm I and affinity arm II are specifically shown in Table 2.

[0090] Table 6.

[0091] sequence name SEQ ID NO: Nucleotide sequence E2-2 16 AAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCAC E1-2 17 GGGGGTGTGGCGGAATGGTAGACGCTACGGA

[0092] Example 9

[0093] The RNA cyclization composition provided in this example is basically the same as that in Example 8, except that the E2-2' and E1-2' fragments shown in Table 7 are used instead of the E2-2 and E1-2 fragments in the cyclization-inducing fragments, and the other conditions are the same to obtain the RNA cyclization composition.

[0094] Table 7.

[0095] sequence name SEQ ID NO: Nucleotide sequence E2-2’ 18 AAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCAC E1-2’ 19 GAGACGCTACGGACTT

[0096] Example 10

[0097] The RNA cyclization composition provided in this example is basically the same as that in Example 8, except that the E2-2" and E1-2" fragments shown in Table 8 are used to replace the E2-2 and E1-2 fragments in the cyclization-inducing fragments, and the other conditions are the same to obtain the RNA cyclization composition.

[0098] Table 8.

[0099] sequence name SEQ ID NO: Nucleotide sequence E2-2” 20 ATCCTCCACCCCCAC E1-2” 21 GGGGGTGTCGGA

[0100] Embodiment 11

[0101] The RNA cyclization composition provided in this embodiment is basically the same as that in Example 8, except that the cyclization-inducing fragment does not include the sequences of E1-2 and E2-2, that is, the 5' end of affinity arm II is directly connected to the 3' end of affinity arm I, and other conditions are the same to obtain an RNA cyclization composition.

[0102] Comparative Example 3

[0103] This comparative example provides a composition for RNA cyclization, which uses the intron sequence in Example 8, and the RNA cyclization composition includes an RNA cyclization precursor fragment but does not include a cyclization inducing fragment; wherein the cyclization precursor fragment is dsDNA, which specifically includes a 3'-intron, E2-2', CVB3 IRES sequence, GFP sequence, E1-2' and 5'-intron connected in sequence along the 5' to 3' direction, as shown in Tables 5 and 7.

[0104] Example 12

[0105] This example is used to illustrate the cyclization efficiency of the precursor fragments and RNA cyclization compositions provided in the above examples and comparative examples, and specifically includes:

[0106] (1) In vitro transcription reaction: T7 High-Efficiency RNA Synthesis Kit (NEB, catalog number E2040S) was used to perform in vitro transcription reaction on the above RNA cyclization composition according to the instructions to obtain in vitro transcription products.

[0107] (2) In vitro cyclization reaction: The in vitro transcription product was added to a cyclization buffer (comprising 10 mM HEPES, 4 mM MgCl2 and 25 mM NaCl) at a final concentration of 50 nM, and MgCl2 was added to a solution with a concentration of 15 mM. GTP was added to a solution with a concentration of 0.25 mM. The mixture was incubated at 55°C for 30 min. The cyclization product was purified using an RNA purification kit (NEB, catalog number T2040L) according to the instructions.

[0108] (3) The obtained in vitro transcription products and cyclization products were subjected to 4% urea-PAGE gel electrophoresis, and the amount of sample added and the conditions during the electrophoresis were the same. The cyclization efficiency (%) of the RNA cyclization composition provided in each embodiment and comparative example in the in vitro transcription reaction and in vitro cyclization reaction was calculated according to the following formula.

[0109] Cyclization efficiency (%) = X1 / X2×100%

[0110] Wherein, X1 is the band intensity of the cyclized product in the gel electrophoresis diagram; X2 is the band intensity of the in vitro transcription product in the gel electrophoresis diagram. Figures 2 to 4 shown.

[0111] Table 9.

[0112]

[0113] From Table 9 and Figures 2 to 4 The test results shown show that, compared with Comparative Examples 1 and 2, the circRNA obtained by in vitro transcription and in vitro cyclization of the RNA cyclization composition provided in Examples 1 to 6 of the present invention only has 5nt of exogenous bases remaining, and also has a relatively good cyclization efficiency. It is worth noting that, compared with the precursor sequences provided in Comparative Examples 1 and 2, the order of IRES and the target gene in the precursor sequences provided in Examples 1 and 2 unexpectedly significantly affects the cyclization efficiency.

[0114] Compared with Example 7, in the RNA cyclization composition provided in Examples 8 to 11 of the present invention, although the introduction of the cyclization-inducing fragment will cause obvious inhibition of RNA cyclization during the in vitro transcription stage, the inhibitory effect can be eliminated under the induction of in vitro cyclization conditions, which can significantly improve the RNA cyclization efficiency in the in vitro cyclization reaction and only leave 3nt of exogenous bases.

[0115] That is, by introducing a cyclization-inducing fragment complementary to the precursor fragment, the problem of reduced cyclization efficiency caused by the removal of exons in the precursor fragment can be greatly improved, the cyclization efficiency of the precursor fragment without exons can be effectively improved, and circular RNA with extremely low exogenous nucleotide residues can be prepared. Moreover, this method can play a good role in improving the cyclization efficiency for different type I intron systems, has high universality, and has good application prospects.

[0116] Embodiment 13

[0117] The RNA cyclization composition provided in this embodiment is basically the same as that in Example 6, except that the cyclization-inducing fragment is ssDNA, which is composed of affinity arm II and affinity arm I, and the nucleotide sequence is specifically shown in Table 2, and the molar ratio of the precursor fragment to the cyclization-inducing fragment is 1:3. Other conditions are the same to obtain an RNA cyclization composition.

[0118] Embodiment 14

[0119] The RNA cyclization composition provided in this example is basically the same as that in Example 13, except that the molar ratio of the precursor fragment to the cyclization-inducing fragment is 1:6, and other conditions are the same to obtain the RNA cyclization composition.

[0120] Embodiment 15

[0121] The RNA cyclization composition provided in this example is basically the same as that in Example 13, except that the molar ratio of the precursor fragment to the cyclization-inducing fragment is 1:10, and other conditions are the same to obtain the RNA cyclization composition.

[0122] Example 16

[0123] The RNA cyclization composition provided in this example is basically the same as that in Example 13, except that the molar ratio of the precursor fragment to the cyclization-inducing fragment is 1:30, and other conditions are the same to obtain the RNA cyclization composition.

[0124] Embodiment 17

[0125] This example is used to illustrate the cyclization efficiency of the RNA cyclization composition provided in Examples 13 to 16, and specifically includes:

[0126] (1) In vitro transcription reaction: T7 High-Efficiency RNA Synthesis Kit (NEB, catalog number E2040S) was used to perform in vitro transcription reaction on the above precursor fragments according to the instructions to obtain in vitro transcription products.

[0127] (2) In vitro cyclization reaction: according to the molar ratio of the precursor fragment and the cyclization inducing fragment in the RNA cyclization composition, the in vitro transcription product and the cyclization inducing fragment were added to a cyclization buffer (comprising 10 mM HEPES, 4 mM MgCl2 and 25 mM NaCl), and the concentration of the in vitro transcription product in the solution was adjusted to 50 nM using the cyclization buffer. The solution was pretreated at 65°C for 10 min, then ice-bathed for 5 min, MgCl2 was added until the concentration of MgCl2 in the solution was 15 mM, GTP was added until the concentration of GTP in the solution was 0.25 mM, and the solution was incubated at 55°C for 30 min. The cyclization product was purified using an RNA purification kit (NEB, catalog number T2040L) according to the instructions.

[0128] (3) The obtained cyclization product was subjected to 4% urea-PAGE gel electrophoresis, and the amount of sample added and the conditions during the electrophoresis were the same. The cyclization efficiency (%) in the in vitro cyclization reaction was calculated according to the method provided in Example 12. The results are shown in Tables 10 and Figure 5 shown.

[0129] Table 10.

[0130]

[0131]

[0132] From Table 10 and Figure 5It can be seen from the test results shown that, compared with Example 1, the RNA cyclization compositions provided in Examples 13 to 16 can significantly improve the RNA cyclization efficiency by introducing cyclization-inducing fragments in the form of ssDNA during the in vitro cyclization reaction.

[0133] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

Claims

1. A composition for RNA cyclization, characterized in that The RNA cyclization composition comprises: A precursor fragment, which includes a 3'-intron, a sequence to be cyclized and a 5'-intron sequentially connected along the 5' to 3' direction; The cyclization inducing fragment comprises an affinity arm I and an affinity arm II, wherein the affinity arm I is complementary to the 5' end sequence of the sequence to be cyclized, and the affinity arm II is complementary to the 3' end sequence of the sequence to be cyclized.

2. The RNA cyclization composition according to claim 1, characterized in that The sequence to be cyclized includes an IRES sequence and a coding sequence in sequence from 5' to 3' direction.

3. The RNA cyclization composition according to claim 1, characterized in that The length of the affinity arm I is 15 to 35 bp, and the length of the affinity arm II is 15 to 35 bp.

4. The RNA cyclization composition according to claim 1, characterized in that The cyclization inducing fragment consists of affinity arm I and affinity arm II; Optionally, the cyclization-inducing fragment is ssDNA and / or ssRNA; Optionally, the molar ratio of the precursor fragment to the cyclization inducing fragment is 1:(1-50).

5. The RNA cyclization composition according to claim 1, characterized in that The 3'-intron and the 5'-intron are derived from one or more of the type I intron of the CoB gene of Fusarium oxysporum, the type I intron of the thymidylate synthase gene of T4 bacteriophage, the type I intron of the precursor tRNA of Anabaena, and the type I intron of the precursor rRNA of Tetrahymena thermophila.

6. The RNA cyclization composition according to claim 1, characterized in that The 3'-intron and the 5'-intron are derived from the type I intron of the CoB gene of Fusarium oxysporum, the nucleotide sequence of the 3'-intron is shown in SEQ ID NO: 1, and the nucleotide sequence of the 5'-intron is shown in SEQ ID NO: 4; Optionally, the cyclization inducing fragment consists of affinity arm I, E2, E1 and affinity arm II connected sequentially from 5' to 3' end; the nucleotide sequence of E2 is shown in SEQ ID NO:7, SEQ ID NO:10 or SEQ ID NO:12, and the nucleotide sequence of E1 is shown in SEQ ID NO:8, SEQ ID NO:11 or SEQ ID NO:

13.

7. The RNA cyclization composition according to claim 1, characterized in that The 3'-intron and the 5'-intron are derived from the type I intron of the Anabaena precursor tRNA; the nucleotide sequence of the 3'-intron is shown in SEQ ID NO: 14, and the nucleotide sequence of the 5'-intron is shown in SEQ ID NO: 15; Optionally, the cyclization inducing fragment consists of affinity arm I, E2, E1 and affinity arm II connected sequentially from 5' to 3' end; the nucleotide sequence of E2 is shown in SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO: 20, and the nucleotide sequence of E1 is shown in SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO:

21.

8. The RNA cyclization composition according to claim 1, characterized in that The RNA cyclization composition also includes a Hammerhead ribozyme; Optionally, the nucleotide sequence of the Hammerhead ribozyme is as shown in SEQ ID NO:

5.

9. A method for preparing circRNA, characterized in that: The preparation method comprises: taking the RNA cyclization composition according to any one of claims 1 to 8 to perform an in vitro transcription reaction to obtain an in vitro transcription product; taking the in vitro transcription product to perform an in vitro cyclization reaction to obtain the circRNA.

10. Use of the RNA cyclization composition according to any one of claims 1 to 8 in preparing RNA drugs, preparing RNA vaccines and / or regulating cell expression.

Images