Method for inhibiting gene horizontal transfer based on vibrio harveyi fnr knockout

Abstract

The invention discloses a method for inhibiting gene horizontal transfer based on vibrio harveyi fnr knockout, and relates to the fields of molecular biology and gene engineering. The method for inhibiting gene horizontal transfer disclosed by the invention comprises the following steps: introducing a target exogenous plasmid into a conjugational transfer donor bacterium and then conjugating with a recipient bacterium. The fnr gene of the recipient bacterium vibrio harveyi is knocked out, so that the efficiency of obtaining exogenous plasmids by the vibrio harveyi through conjugational transfer is reduced, and the method has the characteristic that the conjugational transfer efficiency is remarkably reduced. Compared with a wild type host cell, the efficiency of obtaining the plasmid pMMB207 in donor bacteria escherichia coli by the host cell with the fnr gene knocked out through conjugational transfer is reduced by 6.76 times. According to the method, the obtaining capacity of host cells on exogenous plasmids is greatly reduced, and the method has very important significance on resisting pathogenicity and drug resistance of microorganisms.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for inhibiting gene horizontal transfer based on Vibrio harveyi fnr knockout. Background Art

[0002] Vibrio harveyi is an important conditional pathogen of marine aquaculture organisms, causing great harm to the marine aquaculture industry. A survey of marine fish diseases along the coast of South China found that about 70% of vibriosis in marine fish was caused by Vibrio harveyi. Due to the limitations of other control methods such as vaccines and immunopotentiators, antibiotics are considered to be the most effective and flexible weapon against bacterial infectious diseases and are widely used to prevent or treat bacterial diseases in aquaculture. At present, the drug resistance situation of Vibrio harveyi is severe, with a resistance index as high as 0.60. The urgency of effective disease prevention and control and the drug resistance caused by antibiotic treatment both indicate that it is urgent to explore new disease prevention and control strategies, and reducing toxicity and resistance is the fundamental requirement for disease prevention and control, and is the key to implementing green and healthy aquaculture.

[0003] The key to reducing toxicity and resistance lies in the control of virulence genes and drug resistance genes. Virulence genes and drug resistance genes of pathogenic microorganisms can be horizontally transmitted between different species through mobile genetic elements such as plasmids through conjugation transfer, thereby enhancing the pathogenicity and drug resistance of pathogens and increasing the complexity and variability of disease prevention and control. Therefore, reducing the efficiency of conjugation transfer of plasmids between bacteria can effectively prevent and control the spread and diffusion of virulence and drug resistance genes, and is considered to be one of the effective strategies for preventing and controlling the spread of virulence and drug resistance of pathogenic microorganisms. Summary of the invention

[0004] In view of the problems existing in the above-mentioned prior art, the purpose of the present invention is to provide a method for inhibiting horizontal gene transfer. The method is used for plasmid conjugation transfer, which can effectively reduce the efficiency of plasmid conjugation transfer and effectively solve the problem of rapid spread of drug-resistant and pathogenic bacteria.

[0005] To solve the above problems, the present invention is achieved as follows:

[0006] The first object of the present invention is to provide an application of knocking out the gene fnr encoding the bacterial CRP / FNR family transcriptional regulator in inhibiting horizontal gene transfer.

[0007] Preferably, the bacterium is Vibrio harveyi, and the CRP / FNR family transcriptional regulatory factor encoding gene fnr is shown as 385bp-1131bp of SEQ ID NO.1.

[0008] The fnr gene is located at positions 3053987-3054733 on chromosome 1 of the Vibrio harveyi genome, with an ID of CU052_14940 and consists of 747 bases. Its encoded protein FNR is a CRP / FNR family transcriptional regulator with an ID of NP_797915.1.

[0009] The second object of the present invention is to provide a Vibrio harveyi with low conjugation transfer efficiency, wherein the CRP / FNR family transcriptional regulatory factor encoding gene fnr of the Vibrio harveyi is knocked out, and the CRP / FNR family transcriptional regulatory factor encoding gene fnr is shown as 385bp-1131bp of SEQ ID NO.1.

[0010] The third object of the present invention is to provide a method for constructing Vibrio harveyi with low conjugative transfer efficiency, which is to knock out the CRP / FNR family transcription regulatory factor encoding gene fnr of Vibrio harveyi to obtain Vibrio harveyi with low conjugative transfer efficiency, wherein the CRP / FNR family transcription regulatory factor encoding gene fnr is shown as 385bp-1131bp of SEQ ID NO.1.

[0011] Preferably, the method comprises the following steps:

[0012] Step 1, designing gene knockout primers for the CRP / FNR family transcriptional regulator encoding gene fnr on the Vibrio harveyi genome;

[0013] Step 2: Using Vibrio harveyi as the starting strain, knock out the CRP / FNR family transcriptional regulatory factor encoding gene fnr, and obtain the gene-deficient strain V.harveyi 345-Δfnr, which is a Vibrio harveyi with low conjugation transfer efficiency.

[0014] Preferably, the gene knockout primers in step one are: upstream homology arm amplification primers: aagcttgatatcgaattcAAGC ACCCAGTGTATG and atcgtgatctaagatggtgATCCAACTGATCCAGTTC, and downstream homology arm amplification primers ga actggatcagttggatCACCATCTTAGATCACGAT and ttggtaacgaatcagacCAAAGTCGAAGCTATCGTC.

[0015] Preferably, in step 2, the knocking out of the CRP / FNR family transcriptional regulator encoding gene fnr specifically comprises the following steps:

[0016] (1) PCR amplification of the upstream and downstream homology arms of the fnr gene and the linearized suicide plasmid;

[0017] (2) isothermally assembling upstream and downstream homology arms and linearizing the suicide plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into the intermediate host E. coli GEB802 and the donor bacterium E. coli GEB883, and obtaining positive clones by PCR identification;

[0018] (3) The donor bacterium E. coli GEB883 was cultured to the early logarithmic stage, and the recipient bacterium V. harveyi 345 was cultured to the early logarithmic stage;

[0019] (4) The early logarithmic-stage recipient bacterium V. harveyi 345 was heat-shocked at 40°C for 30 min and subjected to conjugation transfer experiments with the early logarithmic-stage donor bacterium E. coli GEB883;

[0020] (5) Screening and identifying single-exchange clones and double-exchange clones to obtain strains with a deleted fnr gene, i.e., Vibrio harveyi with low conjugative transfer efficiency;

[0021] In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single exchange clones specifically refers to screening by a plate containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double exchange clones specifically refers to screening by a plate containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing a primer pair: GCATCAAAGTCGTTTTCCATCA and TCAGTATATTGGAGTACACAAGGTAC for PCR identification.

[0022] Further, in some embodiments of the present invention, before the conjugation transfer step, the above method includes: an fnr gene knockout step; the above fnr gene knockout step includes: constructing a recombinant suicide plasmid containing upstream and downstream homologous arm fragments of the targeting fragment (fnr gene fragment to be knocked out); introducing the recombinant suicide plasmid into the conjugation transfer donor bacterial host Escherichia coli GEB883; and conjugating the donor bacteria containing the recombinant suicide plasmid with the recipient bacteria.

[0023] It should be noted that the above-mentioned gene knockout method uses homologous recombination to knock out the fnr gene, but in some other embodiments, other gene knockout methods can also be used to knock out the fnr gene. No matter what method is used to knock out the fnr gene, such as complete knockout, partial knockout, or even using RNAi interference vector to inhibit the expression of the fnr gene to inactivate it, as long as the fnr gene of the recipient bacteria does not function during the conjugation transfer of the plasmid, it falls within the protection scope of the present invention.

[0024] The fourth object of the present invention is to provide the use of the above-mentioned Vibrio harveyi with low conjugation transfer efficiency as a genetically engineered bacterium in gene knockout, inhibition of horizontal gene transfer or reduction of drug-resistant bacteria.

[0025] The fifth object of the present invention is to provide a method for inhibiting horizontal gene transfer based on fnr knockout of Vibrio harveyi, which comprises the following steps: introducing the target exogenous plasmid into a conjugative transfer donor bacterium, and then conjugating with the above-mentioned Vibrio harveyi with low conjugative transfer efficiency.

[0026] Preferably, the exogenous plasmid is pMMB207, and the donor bacteria is Escherichia coli GEB883.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention has found for the first time that knocking out the fnr gene can inhibit the efficiency of acquiring exogenous plasmids through conjugation transfer compared with wild strains. Based on this result, in the process of conjugation transfer, the donor bacteria containing the target exogenous plasmid are mixed with the recipient bacteria with the fnr gene knocked out, and conjugation transfer is performed, which can reduce the conjugation transfer efficiency of the target exogenous plasmid from the donor bacteria to the recipient bacteria, inhibit the horizontal transfer of exogenous genes, and is of great significance for resisting the rapid spread of drug-resistant and pathogenic microorganisms.

[0029] The present invention provides a method for inhibiting gene horizontal transfer based on fnr knockout, which greatly reduces the ability of host cells to acquire exogenous plasmids through conjugation transfer. Compared with the starting bacteria, the conjugation transfer efficiency of V.harveyi 345-Δfnr is significantly reduced. The method greatly reduces the ability of Vibrio harveyi to absorb exogenous plasmids, which is of great significance for resisting the pathogenicity and drug resistance of microorganisms.

[0030] The method for inhibiting horizontal gene transfer provided by the present invention comprises: mixing a donor bacterium containing a target exogenous plasmid with a recipient bacterium with a knockout fnr gene, knocking out the fnr gene of the recipient bacterium, reducing conjugation transfer, and inhibiting horizontal gene transfer. The method has the characteristic of significantly reducing the efficiency of conjugation transfer. For example, compared with the wild-type V.harveyi 345, the efficiency of V.harveyi 345-Δfnr with a knockout fnr gene in obtaining plasmid pMMB207 through conjugation transfer is reduced by 6.76 times. The method for inhibiting horizontal gene transfer provided by the present invention is of great significance for resisting the emergence of drug-resistant pathogens.

[0031] The starting strain V. harveyi 345 of the present invention has been published in NCBI (CP025537, CP025538, CP025539, CP025540). The recombinant plasmid intermediate host E. coli GEB802, donor bacteria E. coli GEB883, and plasmid pSW7848 involved in the present invention have been published in the document: Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology [J]. Frontiers in microbiology, 2018: 2394. The inventor also holds the above-mentioned microorganisms and vectors, and guarantees to provide them to the public within 20 years from the date of application. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 To construct a knockout strain of fnr, the gene encoding the CRP / FNR family transcriptional regulator;

[0033] Among them, lane M1: DNA Marker DL5000; lane 1: pSW7848 linearized fragment; lane M2: DNA Marker DL2000; lane 2 / 3: fnr upstream / downstream fragments; lane M3: DNA Marker DL2000; lane 4: recombinant pSW7848-fnr detection fragment; lane M4: DNA Marker DL2000; lane 5: using wild strain Vibrio harveyi 345 genomic DNA as template, the fnr gene knockout identification primer amplification results; lane 6: using fnr candidate mutant strain genomic DNA as template, the fnr gene knockout identification primer amplification results.

[0034] Figure 2 The figure is a comparison of the conjugative transfer efficiency of the starting strain V. harveyi 345 and V. harveyi 345-Δfnr in chloramphenicol plates.

[0035] Figure 3 A comparison of the relative conjugation efficiencies of the starting strains V. harveyi 345 and V. harveyi 345-Δfnr. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described below in conjunction with embodiments, but the protection scope of the present invention is not limited thereto.

[0037] For the source of suicide plasmid pSW7848, see the literature: Val, ME., Skovgaard, O., Ducos-Galand, M., Bland, MJ, Mazel, D., 2012. Genome engineering in Vibrio cholerae: a feasible approach to address biological issues. PLoS Genet. 8, e1002472.

[0038] For the source of E.coli GEB883, please refer to the literature: Nguyen, AN, Disconzi, E., Charrière, GM, Destoumi eux-Garzón, D., Bouloc, P., Le Roux, F., Jacq, A., 2018. csrB geneduplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibriotasmaniensis LGP32.mSphere.3,e00582-00518.

[0039] E. coli GEB802 is disclosed in the literature Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology [J]. Frontiers in microbiology, 2018: 2394. E. coli GEB802 is π3813 in the article.

[0040] Embodiment 1:

[0041] 1. Knockout of the gene fnr (CU052_14940) encoding the CRP / FNR family transcriptional regulator in the genome of V. harveyi 345

[0042] In the experiment, we designed corresponding gene knockout primers for the fnr gene (Table 1).

[0043] Table 1 Primers related to gene knockout and identification

[0044]

[0045] The fnr gene ORF and its upstream and downstream sequences (specifically shown in SEQ ID NO. 1), the italic ATG and TAA are the fnr start codon and stop codon respectively, that is, from 385 bp to 1131 bp.

[0046] The genome of V. harveyi 345 was extracted as a template, and the upstream homology arm amplification primers: fnr-U_fwd: aa gcttgatatcgaattcAAGCACCCAGTGTATG and fnr-U_rev: atcgtgatctaagatggtgATCCAACTGATCC AGTTC, and the downstream homology arm amplification primers fnr-D_fwd: gaactggatcagttggatCACCATCTTAGATCACGAT and fnr-D_rev: ttggtaacgaatcagacCAAAGTCGAAGCTATCGTC were used to obtain the upstream and downstream flanking sequences of the fnr gene. The suicide plasmid pSW7848 was used as a template, and the linearized plasmid pSW7848 was obtained by PCR amplification using primers pSW7848-F and pSW7848-R. The upstream and downstream flanking sequences were isothermally assembled with the linearized plasmid using the seamless cloning kit ClonExpress MultiS One Step Cloning Kit (Nanjing Novi Biotechnology Co., Ltd.), and the obtained recombinant plasmid pSW7848-fnr (whose sequence is shown in SEQ ID NO.2) was successively transformed into the intermediate host E. coli GEB802 and the donor bacteria E. coli GEB883 (the preparation and transformation methods of E. coli GEB802 and E. coli GEB883 competent cells refer to the invention patent CN 107904228 A), and the positive clones were screened by PCR based on the primers pSW7848-check-F and pSW7848-check R. The above PCR amplification system and procedure refer to the invention patent CN 107904228 A.

[0047] The mutant strain V.harveyi 345-Δfnr was constructed with reference to the invention patent CN 107904228 A. The recipient bacterium V.harveyi 345 was cultured to the early logarithmic stage (OD 600nm =0.3-0.7), and then heat-shocked at 40°C for 30 min and cultured to the early logarithmic phase (OD 600nm=0.3-0.7) donor bacteria containing the recombinant plasmid pSW7848-fnr were transferred by conjugation to E. coli GEB883. The recombinant plasmid pSW7848-fnr in the E. coli GEB883 strain was transferred into V. harveyi 345 by conjugation transfer of bacterial genes. Since the pSW7848 plasmid cannot replicate itself in V. harveyi 345, it can only replicate with the genome after the plasmid is integrated into the genome of V. harveyi 345 by homologous recombination. The integration of the plasmid will give V.harveyi 345 resistance to chloramphenicol, and D-glucose will inhibit the expression of the toxic gene ccdB of the suicide plasmid pSW7848. These single-exchange clones can be obtained by screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; then, plates containing 0.2% L-arabinose (inducing the expression of the toxic gene ccdB) are coated to screen double-exchange clones, and the clones are further coated with 0.2% L-arabinose and plates containing 34 μg / mL chloramphenicol and 0.2% L-arabinose to screen candidate mutants. PCR identification is performed on clones that are not resistant to chloramphenicol (del fnr-check-F and del fnr-check-R), and clones with successful gene knockout are obtained, namely the mutant strain V.harveyi 345-Δfnr. According to this process, fnr is knocked out, and the identification results of its gene knockout are in line with expectations ( Figure 1 ).

[0048] 2. Implementation Effect

[0049] The starting strain V. harveyi 345 and the obtained mutant strain V. harveyi 345-Δfnr were heat-shocked at 40℃ for 10 min in the early logarithmic phase and then cloned into a plasmid carrying the RP4 type shuttle plasmid pMMB207 (which has chloramphenicol resistance and can self-replicate in V. harveyi 345, and the construction method is shown in Liu, JX, Zhao, Z., Deng, YQ, Shi, Y., Liu, YP, Wu, C., Luo, P., Hu, CQ, 2017. Complete genome sequence of Vibrio campbellii LMB29 isolated from red drum with four native coliGEB883) was conjugated. After conjugation overnight, the plaques were collected with 1 mL of fresh culture medium (LBS culture medium, containing 1% peptone, 0.5% yeast powder, and 3% sodium chloride by mass fraction) and diluted in multiples. 100 μL of bacterial solution with different dilutions was applied to LBS plates containing 34 μg / mL chloramphenicol (containing 1% peptone, 0.5% yeast powder, 3% sodium chloride, and 1.5% technical agar powder by mass fraction) to screen the conjugants, and the conjugation transfer efficiency was statistically analyzed. The results showed that ( Figure 2 , Figure 3 , Table 2), compared with the starting strain V. harveyi 345, the conjugative transfer efficiency of V. harveyi 345-Δfnr was significantly reduced by 6.76 times.

[0050] Table 2 Conjugative transfer efficiency of V. harveyi 345 and V. harveyi 345-Δfnr

[0051]

[0052] Compared with wild-type host cells, the efficiency of fnr gene knockout host cells in acquiring plasmid pMMB207 in donor Escherichia coli through conjugation transfer is reduced by 6.76 times. This method greatly reduces the host cell's ability to acquire exogenous plasmids, which is of great significance in resisting microbial pathogenicity and drug resistance.

[0053] Based on the above results, it is shown that the deletion of the fnr gene can significantly reduce the efficiency of Vibrio harveyi in acquiring exogenous plasmids through conjugation transfer, inhibit horizontal gene transfer, and thereby prevent or reduce the ability of microorganisms to absorb drug-resistant DNA fragments or pathogenic DNA fragments from the external environment. The method provided by the present invention provides a new approach and idea for reducing or avoiding the emergence of drug-resistant bacteria.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

[0055] SEQ ID NO.1

[0056] AAGCACCCAGTGTATG CCTTTCCATTTGGCTTTATTTGGGGCTGGTTACCCTGTGGACTAGTATACTCGGCGTTAACCTGGTCTGCAGTTTCAGGAGACGCTTTAAACGGCGGATTAATCATGCTGTCGTTTGGTCTCGGAACTCTTCCATCAATGCTTGCCATCGGATATGGTGCGAGCCATTTTCAGAAGTTGCAAAAATCGTTAATATTTAGAAACATCTCTGCATTAATCCTAATAAGCTATGGCATGTAT ACTGCCGCCGGCGCGATGCGAATGCTTGGTTCATATAGCATCAAAGTCGTTTTCCATTTTTTTGCTACCCTTTAGAAGTAAGCGTGATAAAATATTGATGTATATCAAATAGTGAAAGGTTGTTATGATTTCTGAAAAACCTGCAACAAAGCGTATCCAATCAGGTGGTTGCGCGATTCATTGCCAAGATTGTAGCATTAGCCAACTGTGTATTCCGTTCACTCTAAACGAGTCT GAACTGGATCAGTTGGATCAAATCATCGAGCGTAAAAAGCCAATCCAAAAAGGCCAAGAGCTTTTTAAAGCAGGTGATGAGCTAAAATCTCTGTACGCTATCCGCTCTGGCACAATCAAGAGCTACACCATTACAGAACAAGGCGATGAGCAAATTACTGCGTTTCACTTAGCAGGTGACCTTGTAGGTTTTGACGCAATCACGGGCGATCTACACCCAAGTTTTGCTCAAGCACTTGAAACTTCAATGGTTTGTGAGATTCCTTACGAAATCCTTGATGACCTATCAGGCAAAATGCCTAAGCTTCGTCAGCAGATCATGCGTCTAATGAGTAGCGAAATTAAAGGTGACCAAGAAATGATCCTTCTGCTTTCTAAAAAGAATGCTGAAGAACGTCTTGCGGCTTTCCTTTACAACCTATCAACACGTTTCTCGCAACGTGGTTTTAGCCCTCGAGAGTTCCGTCTAACCATGACTCGTGGTGATATTGGTAACTACCTCGGTCTAACAGTTGAAACCATCAGCCGCCTACTTGGTCGCTTCCAGAAATCTGAAATTCTGAGCGTAAAAGGTAAGTACAT CACCATCTTAGATCACGATGCATTGATGGAACTTGCTGGCGTCAGCAAAGACTAATTTGCCCTATCAATTGATGTAGCTCGAAAATGAGCTACATCATATTTCTTCCAAAATCCCTTCGAAAGTCCTCAAATTCTTCCCCAAACTGAGCTACAGTAAAAATGTACCTTGTGTACTCCAATATACTGATTTACCTTATATTCAGTATTTGGTTTTACAATAATAAGTGGGCTTAGATATGAGTATATACAGTAAGATCCTTGTTGTTGCTGACATCAATAATGATGAGCAGCCAGCACTTGCAAGAGCAGTTCAACTCGCTCGAAAAAGTGTATCCAGAAGCCGAATCACTTTCTTTCTGTCAATCTACGATTTTTCGTATGACATGACCTCAATGCTGTCGGTCGATGAAAGAGATGCTATGCGTCGCGGTGTTATCCACCAACGTGAACAATGGATGCGTAAGATAGCCCAACCGTATTTA GACGATAGCTTCGACTTTG SEQ ID NO.2

[0057]

Claims

1. The application of knocking out the fnr gene encoding the bacterial CRP / FNR family transcriptional regulator in inhibiting horizontal gene transfer.

2. The use according to claim 1, characterized in that: The bacterium is Vibrio harveyi, and the CRP / FNR family transcriptional regulatory factor encoding gene fnr is shown by 385bp-1131bp of SEQ ID NO.

1.

3. A Vibrio harveyi with low conjugation transfer efficiency, characterized in that: The CRP / FNR family transcriptional regulatory factor encoding gene fnr of the Vibrio harveyi is knocked out, and the CRP / FNR family transcriptional regulatory factor encoding gene fnr is shown by 385bp-1131bp of SEQ ID NO.

1.

4. A method for constructing Vibrio harveyi with low conjugative transfer efficiency, characterized in that: The method is to knock out the CRP / FNR family transcriptional regulatory factor encoding gene fnr of Vibrio harveyi to obtain Vibrio harveyi with low conjugation transfer efficiency. The CRP / FNR family transcriptional regulatory factor encoding gene fnr is shown by 385bp-1131bp of SEQ ID NO.

1.

5. The construction method according to claim 4, characterized in that: The following steps are involved: Step 1, designing gene knockout primers for the CRP / FNR family transcriptional regulator encoding gene fnr on the Vibrio harveyi genome; Step 2: Using Vibrio harveyi as the starting strain, knock out the CRP / FNR family transcriptional regulatory factor encoding gene fnr, and obtain the gene-deficient strain V.harveyi 345-Δfnr, which is a Vibrio harveyi with low conjugation transfer efficiency.

6. The construction method according to claim 5, characterized in that: The gene knockout primers described in step one are: upstream homology arm amplification primers: aagcttgatatcgaattcAAGCACCCAGTGTATG and atcgtgatctaagatggtgATCCAACTGATCCAGTTC, and downstream homology arm amplification primers gaactggatcagttggatCACCATCTTAGATCACGAT and ttggtaacgaatcagacCAAAGTCGAAGCTATCGTC.

7. The construction method according to claim 5, characterized in that: In step 2, the knocking out of the CRP / FNR family transcriptional regulator encoding gene fnr specifically comprises the following steps: (1) PCR amplification of the upstream and downstream homology arms of the fnr gene and the linearized suicide plasmid; (2) isothermally assembling upstream and downstream homology arms and linearizing the suicide plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into the intermediate host E. coli GEB802 and the donor bacterium E. coli GEB883, and obtaining positive clones by PCR identification; (3) The donor bacterium E. coli GEB883 was cultured to the early logarithmic stage, and the recipient bacterium V. harveyi 345 was cultured to the early logarithmic stage; (4) The early logarithmic-stage recipient bacterium V. harveyi 345 was heat-shocked at 40°C for 30 min and subjected to conjugation transfer experiments with the early logarithmic-stage donor bacterium E. coli GEB883; (5) Screening and identifying single-exchange clones and double-exchange clones to obtain strains with a deleted fnr gene, i.e., Vibrio harveyi with low conjugative transfer efficiency; In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single exchange clones specifically refers to screening by a plate containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double exchange clones specifically refers to screening by a plate containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing a primer pair: GCATCAAAGTCGTTTTCCATCA and TCAGTATATTGGAGTACACAAGGTAC for PCR identification.

8. Use of the Vibrio harveyi with low conjugation transfer efficiency as claimed in claim 3 as a genetically engineered bacterium in inhibiting horizontal gene transfer or reducing drug-resistant bacteria.

9. A method for inhibiting horizontal gene transfer based on knockout of Vibrio harveyi fnr, characterized in that: The steps include: The target exogenous plasmid is introduced into the conjugative transfer donor bacteria, and then conjugated with the low conjugative transfer efficiency Vibrio harveyi described in claim 3.

10. The method according to claim 9, characterized in that The exogenous plasmid is pMMB207, and the donor bacteria is Escherichia coli GEB883.

Images