Application of ABC transporter family gene OsABCB11 in plant breeding regulation

Abstract

The invention discloses an application of an ABC transport protein family gene OsABCB11 in regulation and control of plant breeding. Belongs to the field of plant genetic engineering. According to the application of the ABC transport protein family gene OsABCB11 in plant breeding regulation and control, the amino acid sequence of the protein encoded by the ABC transport protein family gene OsABCB11 is shown as SEQ ID No: 2. The ABC transporter family gene OsABCB11 is overexpressed in rice, so that absorption of Cd in an overexpressed plant under Cd stress and transfer of Cd from the root to the stem and leaf are remarkably reduced compared with those of a wild plant, and the Cd content of grains in the overexpressed plant planted in Cd-polluted soil is remarkably reduced compared with that of the wild plant; however, the content of essential elements in the grains and the yield of the rice are not negatively influenced, so that a new candidate gene resource is provided for creating safe rice with low Cd grains, and a potential repairing method is also provided for controlling Cd pollution of the rice.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, in particular to ABC transporter family genes OsABCB11 Application in plant breeding regulation. Background Art

[0002] Farmland soil is facing severe challenges of heavy metal pollution, among which cadmium (Cd) pollution is particularly noteworthy and has become a prominent problem restricting the sustainable development of agriculture. Cd is a non-essential heavy metal element for plants and humans, and is highly toxic. It is listed as a Class I human carcinogen by the International Agency for Research on Cancer (IARC). The sources of Cd pollution are complex and diverse, mainly including the deposition of industrial waste gas, irrigation of mining and smelting wastewater, automobile exhaust emissions, and the burning of garbage and crop straw. In addition, the excessive use of Cd-containing chemical fertilizers and organic fertilizers in agricultural production is also an important source of pollution. The waste gas containing heavy metals in the atmosphere infiltrates into farmland through rainfall, further exacerbating the problem of heavy metal pollution in the soil. These pollution sources lead to the continuous accumulation of Cd in farmland soil, posing a serious threat to farmland ecosystems and food security.

[0003] When plants absorb Cd from the soil through their roots, they transport it to the aboveground parts, especially the edible parts of cereal crops. Compared with other heavy metals, Cd is more likely to migrate from the soil to the food chain, posing a serious threat to food safety and human health. Excessive accumulation of Cd in plants will destroy their nutritional balance, cause damage to proteins, DNA and cell membranes, and also cause the accumulation of toxic reactive oxygen, which will seriously affect the growth and yield of crops. Among them, rice is an important food crop. More than 60% of the population relies on rice as their staple food, and its production safety has attracted much attention. Studies have shown that rice has a higher absorption capacity for Cd than other cereals, so rice has become the main way for the general population to take in Cd, with a contribution rate of up to 56%, and for the southern population it has increased to 65%. Therefore, exploring the absorption, transportation and accumulation mechanisms of rice for Cd, as well as discovering related regulatory genes, is of great significance for breeding low Cd accumulation rice varieties and ensuring food security and human health.

[0004] ABC transporters are a large class of conserved proteins that are widely present in the biological world, and their role in plants is particularly important. In the biological world, the ABC protein family can be divided into 8 subfamilies from ABCA to ABCI, but plants lack the ABCH subfamily. ABC transporters usually contain two characteristic domains, namely the trans-membrane domain (TMD) and the nucleotide binding domain (NBD). These domains work together to use the energy released by ATP hydrolysis to drive the transport of various substrates on the biological membrane. These substrates include small inorganic and organic molecules (such as amino acids, sugars, nucleosides, vitamins and metal ions, etc.) and large organic compounds (such as peptides, lipid molecules, oligonucleotides and polysaccharides, etc.). ABC proteins regulate the transmembrane transport of these substrates and participate in regulating hormone and lipid metabolism, stomatal opening and closing, metal ion transport and other important physiological processes to help plants cope with various biological or abiotic stresses, so that plants can adapt to the ever-changing environment.

[0005] The individual genes of the ABC transporter family and how to use the ABC transporter family genes to prevent Cd accumulation in plants need further study. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a novel ABC transporter family gene OsABCB11 Application in plant breeding regulation.

[0007] The purpose of the present invention is achieved through the following technical solutions: ABC transporter family genes OsABCB11 Application in plant breeding regulation, the ABC transporter family gene OsABCB11 The amino acid sequence of the encoded protein is shown in SEQ ID No: 2.

[0008] Furthermore, the ABC transporter family gene OsABCB11 The nucleotide sequence is shown in SEQ ID No: 1.

[0009] Furthermore, the plant breeding regulation refers to overexpression of ABC transporter family genes in plants OsABCB11 , improve plant tolerance to cadmium, increase plant biomass, and reduce the cadmium content in plant seeds.

[0010] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0011] ABC transporter family genes OsABCB11Application in improving plant tolerance to cadmium and / or preparing / cultivating plant varieties with low cadmium accumulation in seeds.

[0012] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0013] Contains the above ABC transporter family genes OsABCB11 The invention relates to the use of a plant expression vector and a host cell in improving plant tolerance to cadmium and / or preparing / cultivating plant varieties with low grain cadmium accumulation.

[0014] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0015] A method for enhancing plant tolerance to cadmium and / or reducing the cadmium content in plant seeds, comprising: OsABCB11 Overexpression step.

[0016] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0017] Compared with the prior art, the present invention has the following advantages and effects: (1) The present invention involves the ABC transporter family gene OsABCB11 Overexpression in rice resulted in the OsABCB11 The growth of the overexpression strain was significantly better than that of the wild type, and the Cd content in the grains of the overexpression strain was significantly lower than that of the wild type. OsABCB11 Overexpression had no obvious adverse effects on rice yield-related traits and the absorption of essential metal elements. OsABCB11 It can be used as a potential candidate gene to breed rice varieties with low Cd accumulation to reduce the threat of Cd pollution to food safety and human health, and also provide a potential remediation method for rice Cd pollution control.

[0018] (2) The present invention overexpresses ABC transporter family genes OsABCB11 , which can effectively improve the tolerance of rice to Cd and reduce the Cd content in rice grains, providing candidate gene resources for low-Cd molecular breeding of rice and Cd pollution control. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Rice ABC transporter family gene OsABCB11Gene information diagram; the blank rectangle and the black line in the middle of the diagram are the 5' untranslated region (UTR), the blank pentagon represents the 3'UTR, the black rectangle represents the exon, the black line represents the intron, and the double arrows below the diagram represent the coding sequence (CDS) region of the gene.

[0020] Figure 2 Schematic diagram of the empty GFP vector pCAMBIA35s-EGFP for protein subcellular localization.

[0021] Figure 3 The subcellular localization observation of OsABCB11, a member of the rice ABC transporter family, in rice protoplasts. (a) is the result of subcellular localization in rice protoplasts; (b) is the result of subcellular localization in tobacco mesophyll cells. The excitation wavelength and observation wavelength of GFP observation are 488 nm and 507 nm, respectively, emitting green fluorescence; the excitation wavelength and emission wavelength of the membrane marker protein OsRac3-Mcherry are 587 nm and 610 nm, respectively, emitting red fluorescence; the scale of the OsABCB11 subcellular localization map is 30 μm.

[0022] Figure 4 Rice ABC transporter family gene OsABCB11 The relative expression detection results at different time points under the condition of a final concentration of 10 μM CdCl2, where (a) is OsABCB11 The relative expression in the aerial part, (b) OsABCB11 The relative expression levels in roots, the experiment was repeated three times independently; t Test; * stands for P <0.05; ** represents P <0.01.

[0023] Figure 5 Rice ABC transporter family gene OsABCB11 Relative expression detection results under different metal element treatments (100 μM); CK is the blank control, and rice Actin1 Gene( Os10g0510000 ) was used as an internal reference gene, and the experiment was repeated three times independently; t Test; * stands for P <0.05.

[0024] Figure 6 Rice ABC transporter family gene OsABCB11Relative expression detection results under different hormone treatments; (a) is the result of abscisic acid treatment, (b) is the result of ethephon treatment, (c) is the result of salicylic acid treatment, (d) is the result of methyl jasmonate treatment, and (e) is the result of indoleacetic acid treatment. CK is the blank control, with rice Actin1 Gene( Os10g0510000 ) was used as an internal reference gene; the experiment was repeated three times independently; t Test; * stands for P <0.05; ** represents P <0.01.

[0025] Figure 7 Rice ABC transporter family gene OsABCB11 The results of relative expression level detection in different growth stages of rice and various tissues of rice; the experiment was repeated three times independently.

[0026] Figure 8 Schematic diagram of gene overexpression vector and knockout vector; (a) is the map of rice gene overexpression vector pOX (containing 5×flag tag); (b) is the map of CRISPR / gRNA intermediate vector; (c) is the map of pYLCRISPR / Cas9-MH binary expression vector.

[0027] Fig. 9 for OsABCB11 Gene overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11) and statistical graphs of growth traits; (a) shows the growth of ZH11 after 7 days of culture under hydroponic conditions without Cd and containing 10 μM CdCl2 and 100 μM CdCl2. OsABCB11 Overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11), the scale bar is 5 cm; (b) after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions, OsABCB11 Overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2) and wild type (ZH11); (c) after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions, OsABCB11 Overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11); (d) after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions. OsABCB11 Overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11); (e) after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions, OsABCB11 Overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11) root dry weight statistics; the experiment was repeated three times independently; t Test; * stands for P <0.05; ** represents P <0.01.

[0028] Fig.10 After being cultured in a Cd solution with a final concentration of 100 μM for 7 days, OsABCB11 Gene overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas-1 , cas-2 ) and wild-type rice (ZH11); (a) is the result of Cd content determination in the shoots and roots, (b) is the result of Cd content determination in the xylem sap; the experiment was repeated three times independently. t Test, * represents P <0.05, ** indicates P <0.01.

[0029] Fig.11 In the experiment of Cd-contaminated soil cultivation OsABCB11 Overexpression lines ( OE-1 , OE-2), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11) and yield trait statistical results; (a) is the Cd-contaminated soil cultivation experiment OsABCB11 Overexpression lines ( OE-1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11), the scale bar is 20 cm; (b–g) are the phenotypic observation results of the Cd-contaminated soil cultivation experiment OsABCB11 Overexpression lines ( OE- 1 , OE-2 ), knockout strains ( cas - 1 , cas - 2 ) and wild type (ZH11) at maturity, plant height (b), panicle length (c), effective tiller number (d), fruit setting rate (e), 1000-grain weight (f), and yield per plant (g). The experiment was repeated three times independently. t Test; * stands for P <0.05, ** indicates P <0.01.

[0030] Fig.12 In the experiment of Cd-contaminated soil cultivation OsABCB11 Gene overexpression lines ( OE-1, OE-2 ), knockout strains ( cas-1, cas-2 ) and wild-type rice (ZH11) grains. (a) is the Cd content analysis result, (b) is the essential metal element content analysis result. The experiment was repeated three times independently. t Test; * stands for P <0.05; ** represents P <0.01. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0032] The experimental methods in the following examples that do not specify specific experimental conditions are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the construction of the vectors (including gene knockout vectors, overexpression vectors, and subcellular localization vectors) mentioned in the examples is carried out according to the conventional genetic engineering field operation methods. The sequences of the backbone vector pCAMBIA-1300, promoter elements (including 35S, Ubi), reporter genes (including GFP), etc. used are all sequences that have been published on relevant websites or databases in the field of genetic engineering (https: / / cambia.org and https: / / www.ncbi.nlm.nih.gov); pCAMBIA35s-eGFP can be obtained from conventional commercial channels. The materials and reagents used, unless otherwise specified, are reagents and materials obtained from commercial channels. The chemical reagents used in the examples are all imported or domestic analytically pure.

[0033] The pOx vector was provided by Academician Liu Yaoguang from the State Key Laboratory of Conservation and Utilization of Subtropical Agricultural Bioresources, South China Agricultural University. The pOx vector has been used in “Li YH, Yang YQ, Liu Y, Li CX, Zhao YH, Li ZJ, Liu Y, Jiang DG, Li J, Zhou H, Chen JH, Zhuang CX, Liu ZL. Overexpression of OsAGO1b induces adaxially rolled leaves by affecting leaf abaxialsclerenchymatous celldevelopment in rice. Rice (NY), 2019, 12(1): 60.

[0034] pYLCRISPR / Cas9-MH and CRISPR / gRNA vectors were provided by Academician Liu Yaoguang from the State Key Laboratory of Conservation and Utilization of Subtropical Agricultural Bioresources, South China Agricultural University. pYLCRISPR / Cas9-MH and CRISPR / gRNA have been made public in the article “Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Methods for construction of plant CRISPR / Cas9 multi-gene editing vector and mutation analysis. Chinese Science: Life Sciences. 2018, 48(7): 783-794. doi: 10.1360 / N052018-00069.”

[0035] Unless otherwise specified in the examples, the rice used was the wild type Zhonghua 11 rice variety, which was commercially available.

[0036] Example 1 (1) Rice ABC transporter family genes OsABCB11 Structure OsABCB11 The accession number in the GenBank database is Os01g0533900. The gene is located on chromosome 1 of rice. Its DNA is 8589 bp (SEQ ID No: 1), containing 12 exons and 11 introns ( Figure 1 ), the predicted encoded protein amino acid sequence length is 1133 amino acids (SEQ ID No: 2). OsABCB11 The mRNA length of the gene is 3928 bp, and the CDS length is 3402 bp (SEQ ID No: 3).

[0037] (2) Subcellular localization analysis of OsABCB11, a member of the rice ABC transporter family According to the conventional operation method in the field of genetic engineering, green fluorescent protein (GFP) was fused to the C-terminus of OsABCB11 protein. OsABCB11 The gene was inserted into the empty vector (pCAMBIA35s-eGFP) containing the 35S promoter for protein subcellular localization (see the schematic diagram of pCAMBIA35s-eGFP). Figure 2 The transient expression recombinant vector driven by the 35S promoter was obtained between the 35S promoter and eGFP ( p35S::OsABCB11-GFP ), transform rice protoplasts and tobacco mesophyll cells. In addition, the GFP empty vector ( p35S::GFP ; i.e. pCAMBIA35s-eGFP), cytoplasmic membrane fluorescent marker protein vector ( p35S::OsRac3-Mcherry ) as a control, and observed the fluorescence localization. The results showed that in both rice and tobacco, OsABCB11 In cells with fusion expression vectors, the green fluorescence of GFP is mainly distributed in the cell membrane, cytoplasm and nucleus; while the green fluorescence signal emitted by the GFP empty vector control is distributed throughout the cell (results are shown in Figure 3 as shown).

[0038] (3) OsABCB11 qRT-PCR analysis of gene responses to Cd stress, other metal stresses, and hormone treatment The Zhonghua 11 (ZH11) rice seedlings were hydroponically cultured in an artificial climate chamber. Kimura B nutrient solution was replaced every 3 days. The conditions were set at 12 h light, 28 °C, 12 h dark, 25 °C, and 60% relative humidity. The rice seedlings cultured for 30 days were treated with Cd (CdCl2 was added to Kimura B nutrient solution to make the final concentration of CdCl2 10 µM, and the rice seedlings were cultured for 0, 3, 6, 9, 12, 24, 48, 60, and 72 h; in the same way, the rice seedlings were cultured for 1 day with CuSO4·5H2O, ZnSO4, MgSO4, CaCl2·2H2O, NaCl, FeSO4, MnSO4, CoCl2, NiCl2, and AlCl3·6H2O solutions with a final concentration of 100 µM; in the same way, different concentrations (according to Figure 6 The rice seedlings were treated with abscisic acid (ABA), ethrel (ETH), salicylic acid (SA), methyl jasmonate (MeJa), and indoleacetic acid (IAA) (shown in Figure 1) for 1 day. The aboveground part and root were selected as materials. The conventional methods in the field of genetic engineering were used. According to the operating manual of the reagent company, the RNA of rice tissue was extracted using Trizol reagent from Genstar Company (China). The cDNA was obtained by reverse transcription using StarScript Ⅲ All-in-one kit from Genstar Company (China). Then, the Realstar Fast SYBR qPCR Mix quantitative PCR kit from Genstra Company (China) was used to quantify the RNA in the aboveground part and root of the material. OsABCB11 The expression of the gene was detected by qRT-PCR. The forward primer of qRT-PCR detection was 5'-TGGTGGGAGCTTCTGCATTT -3', and the reverse primer was 5'-GCATCAACAGACAGCCTTGC -3'. The reaction program of qRT-PCR was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 30 s / kb, 35 cycles; 72℃, 5 min. In addition, OsABCB11 Rice Actin1 ( Os10g0510000 ) was used as the internal reference gene, and the primers used were 5′-AGACGAACTCCACTCCGGTA -3′ (forward primer) and 5′- TGAGCGAACTCCTTGAACCC -3′ (reverse primer).

[0039] The results show that OsABCB11 The gene was significantly induced by Cd, and the expression level of the gene in both the aerial part and the root showed a gradual upward trend as the Cd treatment time prolonged (e.g. Figure 4 The results showed that the expression of this gene had an enhancing effect on the external Cd treatment time.

[0040] The results show that under the treatment of 9 metal elements including Cu, Zn, Mg, Ca, Na, Mn, Co, Ni and Al, OsABCB11 The gene expression was significantly upregulated compared with the control group. OsABCB11 Although the gene expression level increased, it did not change significantly compared with the control group (e.g. Figure 5 as shown).

[0041] right OsABCB11 The 2 kb sequence upstream of the gene (i.e., the promoter region) was sequenced and analyzed, and then the cis-acting elements in the promoter region were identified and annotated using the online tool PlantCare. OsABCB11 The promoter region of the gene is rich in a variety of cis-elements related to hormone regulation, so qRT-PCR was used to detect OsABCB11 The expression response of genes to different hormone treatments. The results showed that different concentrations of abscisic acid ( Figure 6 a) Ethephon ( Figure 6 b) Salicylic acid ( Figure 6 c), methyl jasmonate ( Figure 6 d) and indoleacetic acid ( Figure 6 e) induced the growth of OsABCB11 The expression of genes was upregulated, and the effect was enhanced with the increase of treatment concentration, suggesting that OsABCB11 Genes may play key roles in the complex network of hormone-mediated regulation of plant growth and development and plant responses to external abiotic and biotic stresses, thereby providing plants with the necessary adaptability and survival capabilities.

[0042] (5) OsABCB11 Analysis of spatiotemporal expression patterns of genes in rice The Zhonghua 11 (ZH11) rice seedlings were hydroponically cultured in an artificial climate chamber, and the Kimura B nutrient solution was replaced every 3 days. The conditions were set at 12 h light, 28°C, 12 h dark, 25°C, and 60% relative humidity. Samples were taken at different stages (seedling stage, tillering stage, heading stage, and maturity stage) and different parts (roots, aboveground parts, stems, leaves, etc.) of the wild type rice Zhonghua 11.

[0043] The conventional methods in the field of genetic engineering were used according to the operating manual of the reagent company. The RNA of rice tissue was extracted using Trizol reagent from Genstar (China), and the cDNA was obtained by reverse transcription using StarScript III All-in-one kit from Genstar (China). Then, the Realstar Fast SYBR qPCRMix quantitative PCR kit from Genstar (China) was used to quantify the RNA in different materials. OsABCB11 The expression level of qRT-PCR was detected. The forward primer of qRT-PCR detection was 5'-TGGTGGGAGCTTCTGCATTT -3', and the reverse primer was 5'-GCATCAACAGACAGCCTTGC -3'. The reaction program of qRT-PCR was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 30 s / kb, 35 cycles; 72℃, 5 min. In addition, OsABCB11 Rice Actin1 ( Os10g0510000 ) was used as the internal reference gene, and the primers used were 5'-AGACGAACTCCACTCCGGTA -3' (forward primer) and 5'-TGAGCGAACTCCTTGAACCC -3' (reverse primer).

[0044] Results OsABCB11 The gene is expressed in all growth stages and different tissues of rice, but its expression level is relatively high in the roots at the seedling and heading stages and in the roots and leaf sheaths at the tillering stage (e.g. Figure 7 These results suggest that OsABCB11 The gene is not only involved in the transport process in rice roots, but may also be involved in the transport or redistribution of Cd in various tissues in the aboveground part.

[0045] (6) OsABCB11 Obtaining gene overexpression strains Conventional methods in the field of genetic engineering were used to extract RNA from rice leaf tissue according to the method in Example 1, and reverse transcribed to obtain single-stranded cDNA. The high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme (China) was then used to amplify the cDNA containing OsABCB11 The double-stranded cDNA fragment of the full-length CDS sequence of the gene was amplified by PCR with a denaturation of 95°C for 5 min, followed by a denaturation of 95°C for 15 s, an annealing of 58°C for 15 s, an extension time of 1 kb / 30 s according to the length of the CDS sequence, and an extension at 72°C for 35 cycles, followed by a final extension at 72°C for 5 min.

[0046] OsABCB11 The primers used for PCR were: 5'-ATGAGCACTGGACAAGGTGT -3' (forward primer) and 5'-CCTTGAACTTGACTTAAGCT -3' (reverse primer). After sequencing verification, the gene containing OsABCB11 The double-stranded cDNA fragment of the full-length CDS sequence of the gene was inserted into the overexpression vector pOx containing the Ubi promoter stored in our laboratory (such as Figure 8 In (a), the Ubi promoter-driven OsABCB11 Gene overexpression vector, i.e. pUbi::OsABCB11 , and then transformed into ZH11 rice. The transformed seedlings and their offspring were planted and screened to obtain OsABCB11 Two independent stable homozygous lines of gene overexpression, namely OE-1, OE-2 .

[0047] (7) OsABCB11 Obtaining gene knockout strains Using conventional genetic engineering methods, using intermediate vectors (such as Figure 8 (b)) and gene knockout vectors (as shown in Figure 8 As shown in (c) in the figure, construct OsABCB11 Knockout vector for two target sites (T1 and T2) of the gene. OsABCB11 T1 of gRNA vector in gene knockout strain (i.e. U3 ) The target primers were: 5'-GCAACTCATGCATTCCTCCAATTG -3' (forward primer) and 5'-GCAACAATTGGAGGAATGCATGAG -3' (reverse primer); T2 (i.e. U6a ) The target amplification primers were: 5'-AGAGACCAGGCCGGAATATTTGGT -3' (forward primer) and 5'-AGAGACCAAATATTCCGGCCTGGT -3' (reverse primer). After transformation of Zhonghua 11, the amplification primers were obtained through planting and screening. OsABCB11 Two independent stable homozygous lines of gene knockout, namely cas-1, cas-2 .

[0048] right OsABCB11 The target sites in the gene knockout strains were sequenced and compared. The results showed that cas - 1 In the strain, there is a 47 bp deletion at target site 1 (T1) and a 1 bp deletion at target site 2 (T2); cas - 2In the knockout strain, there is a 14 bp deletion at target site 1 (T1) and a 2 bp deletion at target site 2 (T2). These base deletions lead to OsABCB11 A frameshift mutation occurred in the coding sequence (CDS) of the gene, causing the amino acid sequence of the encoded protein to terminate prematurely during translation.

[0049] (8) Statistics of growth characteristics and Cd content of hydroponic seedlings Will OsABCB11 Gene overexpression strains ( OE-1, OE-2 ), knockout strains ( cas-1, cas-2 ) and ZH11 were used as materials for hydroponic culture. After 30 days of culture, the plants were treated with different concentrations of CdCl2 (0, 10, 100 μM), and after 7 days of culture, the plant phenotypes were observed, and the physiological traits and Cd concentrations in various parts were determined. The method for determining Cd concentration is as follows: the rice samples were cleaned with distilled water, dried in a 60°C oven, and the samples were weighed (0.05-1.0 g for the aboveground part, 0.01-0.1 g for the root part, and 1.0 g for the grain. The grains needed to be shelled in advance, and then the brown rice was ground into powder and weighed; the same amount of overexpression strains, knockout strains, and wild-type groups were weighed). Put it in a glass digestion cup, add 10 mL of mixed acid (concentrated nitric acid and perchloric acid are prepared in a volume ratio of 87:13) to the cup, and digest it in a graphite digestion furnace. The digestion is terminated when the sample volume in the cup is ≤ 0.5 mL. After the sample has cooled, add 2 mL of 1% dilute nitric acid and mix well. Rinse the glass cup with ultrapure water for 3 to 5 times, filter and adjust the volume (Note: the volume of grain samples is adjusted to 15.0 mL, the volume of aboveground samples is adjusted to 15.0 mL, and the volume of root samples is adjusted to 50.0 mL). Use inductively coupled plasma optical emission spectrometry (ICP-OES) to determine the Cd content.

[0050] for OsABCB11 Gene, under Cd treatment, two knockout lines ( cas-1 , cas-2 ) showed significantly weaker growth than the wild type, while the overexpression line ( OE-1 , OE-2 ) grew significantly stronger than the wild type, and with the increase of Cd concentration, the growth differences between strains became more obvious (e.g. Fig. 9). The fresh weight and dry weight of the aboveground part and roots of rice seedlings under 0 and 100 μM Cd treatments were further measured and statistically analyzed. The results showed that in the absence of Cd treatment, there were no significant differences in the fresh weight and dry weight of the aboveground part and roots of each strain. However, under Cd treatment, the aboveground fresh weight, aboveground dry weight, root fresh weight and root dry weight of the knockout strains decreased compared with the wild type, at least 11.15%, 7.85%, 8.56% and 9.14%, respectively. On the contrary, the fresh weight and dry weight of the aboveground part and roots of the overexpression strains increased compared with the wild type, at least 12.89%, 26.57%, 25.71% and 11.24%, respectively. The differences in aboveground dry weight and root fresh weight compared with the wild type were significant (such as Fig. 9 (b), (c), (d) and (e) in the figure).

[0051] The results of Cd content determination showed that OsABCB11 Gene, knockout strains ( cas - 1 , cas - 2 ) significantly increased the Cd content in the shoots and roots compared with the wild type, with an increase of at least 14.91% in the shoots and 21.59% in the roots; OE-1 , OE-2 ) showed a significant decrease in the Cd content in the aboveground and roots compared with the wild type, with the aboveground part decreasing by at least 32.31% and the root part increasing by at least 9.82% (e.g. Fig.10 (a) in the figure), indicating that overexpression in rice OsABCB11 The gene can significantly reduce the absorption of Cd by rice.

[0052] Further testing of the xylem sap of each strain revealed that under Cd treatment, OsABCB11 The Cd content in the xylem sap of the knockout strain increased significantly, by at least 74.44%, while the Cd content in the xylem sap of the overexpression strain decreased significantly, by at least 28.39%. These results indicate that OsABCB11 It can not only regulate the absorption of Cd by rice roots, but also regulate the transport of Cd from roots to aboveground parts (e.g. Fig.10 (as shown in (b) in the figure).

[0053] (9) Cultivation experiment in Cd-contaminated soil Select OsABCB11 Gene overexpression strains ( OE-1, OE-2 ), knockout strains ( cas-1, cas-2) and wild rice ZH11. When the rice seedlings grew to the four-leaf stage, the seedlings with uniform growth were selected and planted in Cd-contaminated soil (the Cd content in the soil was 0.33 mg / kg (pH 5.02), slightly higher than the risk screening level (0.3 mg / kg, pH ≤ 5.5); the contents of other heavy metals in the soil, such as As, Hg, Pb and Zn, did not exceed the corresponding risk screening levels; GB 15618-2018). Rice cultivation followed the conventional guidelines for field rice production, and trait statistics and metal element determination were performed after the rice was fully mature.

[0054] The results show that OsABCB11 The growth of the gene overexpression strain and knockout strain showed no significant difference compared with the wild type, indicating that OsABCB11 Overexpression or knockout of the gene had no significant effect on the growth of rice grown in Cd-contaminated soil (e.g. Fig.11 Further OsABCB11 The yield traits of the gene overexpression strains, knockout strains and wild-type ZH11 were statistically analyzed, and the results showed that OsABCB11 The plant height, effective tiller number, fruit setting rate and yield per plant of the gene overexpression and knockout lines were similar to those of the wild type (e.g. Fig.11 These results show that OsABCB11 Overexpression or knockout of the gene had no significant negative impact on the agronomic traits of rice.

[0055] right OsABCB11 The contents of metal elements in the grains (brown rice) of the overexpression strains and knockout strains of ZH11 and wild-type rice ZH11 at the mature stage were determined. The results showed that the Cd content in the brown rice of the knockout strain increased significantly compared with the wild type, by at least 23.64%, while the Cd content in the brown rice of the overexpression strain decreased significantly, by at least 23.63%, indicating that OsABCB11 Overexpression of the gene helps reduce Cd accumulation in rice grains (e.g. Fig.12 (as shown in (a) in the figure).

[0056] When examining the contents of other essential metal elements (Cu, Fe, Mn, Zn, Mg) in brown rice, it was found that OsABCB11 The Fe content in the knockout strain brown rice decreased significantly, at least by 15.63%, while the Mn, Zn and Mg contents increased significantly, at least by 45.44%, 32.68% and 14.86%, respectively. In contrast, in the overexpression strain, the Cu and Fe contents increased significantly, at least by 13.33% and 14.85%, respectively, while the Zn, Mn and Mg contents did not show significant differences between the overexpression strain and the wild type (e.g. Fig.12(b) in the figure), indicating that OsABCB11 The overexpression of β-catenin did not have a significant negative impact on the contents of other essential metal elements in brown rice.

[0057] The above results show that OsABCB11 Genes provide important candidate gene resources for low Cd molecular breeding of rice. OsABCB11 Overexpression of the gene is expected to effectively reduce the Cd content in grains, while ensuring the yield and nutritional quality of rice, thereby providing a potential genetic engineering strategy for the prevention and control of Cd pollution in rice.

[0058] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. ABC transporter family genes OsABCB11 Application in plant breeding regulation, characterized in that, ABC transporter family genes OsABCB11 The amino acid sequence of the encoded protein is shown in SEQ ID No:

2.

2. The use according to claim 1 is characterized in that ABC transporter family genes OsABCB11 The nucleotide sequence is shown in SEQ ID No:

1.

3. The use according to claim 1 is characterized in that The plant breeding regulation refers to overexpressing ABC transporter family genes in plants OsABCB11 , improve plant tolerance to cadmium, increase plant biomass, and reduce the cadmium content in plant seeds.

4. The use according to claim 1 is characterized in that The plant is a grass plant.

5. The use according to claim 1 is characterized in that: The plant is at least one of wheat, corn and rice.

6. The use according to claim 1 is characterized in that The plant is rice.

7. ABC transporter family genes OsABCB11 Application in improving plant tolerance to cadmium and / or preparing / cultivating plant varieties with low grain cadmium accumulation, characterized in that: ABC transporter family genes OsABCB11 The amino acid sequence of the encoded protein is shown in SEQ ID No:

2.

8. Contains ABC transporter family genes OsABCB11 Use of a plant expression vector and a host cell in improving plant tolerance to cadmium and / or preparing / cultivating plant varieties with low grain cadmium accumulation, characterized in that: ABC transporter family genes OsABCB11 The amino acid sequence of the encoded protein is shown in SEQ ID No:

2.

9. A method for enhancing plant tolerance to cadmium and / or reducing the cadmium content in plant seeds, characterized in that: ABC transporter family genes OsABCB11 Overexpression steps; ABC transporter family genes OsABCB11 The amino acid sequence of the encoded protein is shown in SEQ ID No: 2.

Images