Method for knocking out PK15 cell line from sATP6v0d2 gene and application of method in inhibition of Japanese encephalitis virus infection

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a construction method of a porcine ATP6v0d2 (sATP6v0d2) knockout PK15 cell line and application of the porcine ATP6v0d2 knockout PK15 cell line in inhibition of Japanese encephalitis virus infection. The invention provides the sgRNA of the specific targeting sATP6v0d2, the sATP6v0d2 gene is knocked out in the pig kidney PK15 cell in combination with a CRISPR / Cas9 gene editing technology, and the obtained monoclonal cell can remarkably inhibit the infection of the Japanese encephalitis virus and has important significance on prevention and treatment of the Japanese encephalitis disease. The method is simple, convenient and efficient, and the constructed cell line can be widely applied to researches related to ATP6v0d2 gene functions and Japanese encephalitis virus infection and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a method for knocking out a PK15 cell line using a sATP6v0d2 gene and an application thereof in inhibiting Japanese encephalitis virus infection. Background Art

[0002] Japanese encephalitis is an acute zoonotic central nervous system disease caused by Japanese encephalitis virus (JEV). The virus belongs to the arbovirus family Flaviviridae and is a single-stranded positive-sense RNA virus with an envelope. Japanese encephalitis virus invades cells and enters endosomes through receptor-mediated endocytosis. The weakly acidic environment in the endosome induces conformational changes in glycoproteins and initiates the release of the viral genome into the cytoplasm for subsequent translation and assembly. Japanese encephalitis virus can be transmitted among multiple species through mosquitoes, and pigs are its main source of infection and amplification host. Japanese encephalitis virus infection usually causes abortion, stillbirth, mummified fetuses and weak fetuses in pregnant sows, while boars lose their breeding ability due to testicular swelling, which seriously affects the operation of the pig industry and causes huge economic losses. Due to the lack of in-depth research on the pathogenesis of Japanese encephalitis, there is still no specific drug for the treatment of Japanese encephalitis. Currently, the spread of Japanese encephalitis virus can only be prevented and alleviated by isolating mosquitoes, vaccinating and feeding broad-spectrum drugs. Therefore, finding a cell line that can inhibit Japanese encephalitis virus infection is a prerequisite for designing and developing new anti-Japanese encephalitis virus drugs, and related work is urgently needed.

[0003] Among them, gene editing technology is a technology that uses molecular biological methods to target specific genes in cells for precise modification, mutation or shearing. After about 40 years of development and innovation, the third-generation gene editing technology that relies on clustered regularly interspaced short palindromic repeats CRISPR / Cas9 uses small molecule sgRNA to specifically edit the target gene. Compared with the first-generation ZFN and second-generation TALEN gene editing technology, it is more convenient, efficient and time-saving. At present, CRISPR / Cas9 has been widely used in cutting-edge research in biology, medicine and other fields. This technology can be used to quickly and easily establish gene knockout cell lines.

[0004] The process of Japanese encephalitis virus invading host cells depends on the acidic internal environment. The intracellular acidic environment is mainly completed by V-ATPase by consuming ATP to transport H+ from the cytoplasm to the endosome cavity. ATP6v0d2 is an important subunit of the V-ATPase complex, which is mainly expressed in osteoclasts, macrophages, and kidney cells. At present, the research on the function of ATP6v0d2 is mainly focused on processes such as osteoclast fusion, protein degradation, autophagy lysosome generation and tumor microenvironment acidification. Whether ATP6v0d2 regulates the infection of Japanese encephalitis virus by changing the intracellular acidic internal environment has not been reported.

[0005] The preliminary study of the present invention found that knocking down the expression of the sATP6v0d2 gene using RNAi technology limited the infection of Japanese encephalitis virus, indicating that sATP6v0d2 is involved in regulating the infection of Japanese encephalitis virus and can be used as a target for designing and screening new drugs against Japanese encephalitis virus. Based on this, in order to further study and confirm the regulatory role of sATP6v0d2 in the infection process of Japanese encephalitis virus, the present invention designed sgRNA specifically targeting the sATP6v0d2 gene, and achieved complete knockout of the gene in pig kidney PK15 cells with the help of CRISPR / Cas9 technology. It was first discovered that the sATP6v0d2 knockout monoclonal cell line can significantly inhibit the infection of Japanese encephalitis virus, providing tools and materials for the study of ATP6v0d2 gene function and Japanese encephalitis virus infection, and has broad application prospects.

[0006] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the above technical defects, provide a method for knocking out the sATP6v0d2 gene in a PK15 cell line and its application in inhibiting Japanese encephalitis virus infection, combine CRISPR / Cas9 technology to achieve knockout of sATP6v0d2 in pig kidney PK15 cells, and the obtained monoclonal cell line can significantly inhibit the infection of Japanese encephalitis virus. It can be used as a tool cell line for studying the molecular mechanism of Japanese encephalitis virus infection and screening antiviral drugs, and has a high application value.

[0008] In order to solve the above problems, the technical solution of the present invention is a method for knocking out the PK15 cell line of sATP6v0d2 gene, comprising the following steps:

[0009] Step 1, designing a sgRNA sequence (sgRNA1, sgRNA2 or sgRNA3) targeting the sATP6v0d2 gene; the sgRNA1 and sgRNA2 are located in the first exon region of the sATP6v0d2 gene, and sgRNA3 is located in the second exon region of the sATP6v0d2 gene;

[0010] Step 2: The primer of sgRNA in step 1, add CACCG at the 5' end of the sense strand, AAAC at the 5' end of the antisense strand, and C at the 3' end of the antisense strand to synthesize single-stranded sgRNA;

[0011] Step 3: synthesize the double-stranded sgRNA with BsmBI enzyme sticky ends by annealing the single-stranded sgRNA in step 2;

[0012] Step 4: Recombining the double-stranded sgRNA in step 3 into the LentiCRISPRv2 vector by enzyme ligation;

[0013] Step 5, transfecting the recombinant plasmid in step 5 into PK15 cells;

[0014] Step 6: Use puromycin to screen the successfully transfected cells;

[0015] Step 7: Use the limiting dilution method to screen and obtain the PK15 monoclonal cell line with sATP6v0d2 knockout.

[0016] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used to inhibit Japanese encephalitis virus infection, and the Japanese encephalitis virus is epidemic Japanese encephalitis virus.

[0017] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the cell line is selected from the pig kidney PK15 cell line, which is a classic cell line tool for studying the pathogenesis of porcine viral diseases.

[0018] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the reagent for knocking out sATP6v0d2 expression is sgRNA targeting the sATP6v0d2 gene.

[0019] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the sgRNA is selected from sgRNA1, sgRNA2, or sgRNA3, the targeting sequence of the sgRNA1 is: CGCTGAGCTGTACTTCAATG; the targeting sequence of the sgRNA2 is: CAATGTGGACCATGGCTACC; the targeting sequence of the sgRNA3 is: CAAGAAGTTGCCGTAATCAG.

[0020] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the sgRNA1 is a double-stranded fragment formed by annealing sgRNA1-F and sgRNA1-R primers:

[0021] sgRNA1-F: 5'-CACCGCGCTGAGCTGTACTTCAATG-3';

[0022] sgRNA1-R: 5'-AAACATTGAAGTACAGCTCAGCGC-3'.

[0023] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the sgRNA2 is a double-stranded fragment formed by annealing sgRNA2-F and sgRNA2-R primers:

[0024] sgRNA2-F: 5'-CACCGCAATGTGGACCATGGCTACC-3';

[0025] sgRNA2-R: 5'-AAACGGTAGCCATGGTCCACATTGC-3'.

[0026] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the sgRNA3 is a double-stranded fragment formed by annealing sgRNA3-F and sgRNA3-R primers:

[0027] sgRNA3-F: 5'-CACCGCAAGAAGTTGCCGTAATCAG-3';

[0028] sgRNA3-R: 5'-AAACCTGATTACGGCAACTTCTTGC-3'.

[0029] Furthermore, the sATP6v0d2 gene knockout PK15 cell line method is used in inhibiting Japanese encephalitis virus infection, and the method for knocking out the expression of sATP6v0d2 in PK15 cells is: using CRISPR / Cas9 gene editing technology to lose the function of the protein encoded by the sATP6v0d2 gene in PK15 cells.

[0030] The advantages of the present invention compared with the prior art are:

[0031] 1. The present invention provides an sgRNA targeting the sATP6v0d2 gene, and achieves the knockout expression of the sATP6v0d2 gene in pig kidney PK15 cells with the help of CRISPR / Cas9 gene editing technology.

[0032] 2. The present invention provides a method for constructing a sATP6v0d2 knockout cell line by transfecting a recombinant vector containing a sATP6v0d2 sgRNA fragment into a host cell;

[0033] 3. The monoclonal cell line obtained according to the present invention can significantly inhibit the infection of Japanese encephalitis virus, providing tools and materials for the study of ATP6v0d2 gene function and Japanese encephalitis virus infection, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 A map of the LentiCRISPRv2 vector containing the sgRNA sequence of the present invention;

[0035] Figure 2 This is a schematic diagram of the sgRNA targeting the sATP6v0d2 genomic region of the present invention;

[0036] Figure 3 The sequencing maps of the recombinant plasmids of LentiCRISPRv2-sgRNA1, LentiCRISPRv2-sgRNA2, and LentiCRISPRv2-sgRNA3 of the present invention;

[0037] Figure 4 The results of Western Blotting for detecting sATP6v0d2 protein expression in wild-type and knockout cell lines of the present invention; GAPDH is an internal reference;

[0038] Figure 5 This is the result of immunofluorescence detection of sATP6v0d2 protein distribution in wild-type and knockout cell lines of the present invention; Hoechst marks the cell nucleus; scale 20 micrometers;

[0039] Figure 6This is a graph showing the results of the wild-type and sATP6v0d2 knockout pig kidney PK15 cell viability detection analysis of the present invention;

[0040] Figure 7 This is a graph showing the results of detecting the morphology of wild-type and sATP6v0d2 knockout pig kidney PK15 cells using a phase contrast microscope (20×) according to the present invention; scale bar: 200 μm;

[0041] Figure 8 The results of scratch repair of wild-type and sATP6v0d2 knockout pig kidney PK15 cells of the present invention (A)

[0042] and analysis statistics (B); scale bar 500 μm;

[0043] Fig. 9 The distribution (A) and fluorescence intensity comparison result (B) of the lysosomal marker probe LysoTracker Red in wild-type and sATP6v0d2 knockout pig kidney PK15 cells of the present invention; Hoechst labeled cell nuclei; scale 20 micrometers;

[0044] Fig.10 The present invention is a real-time fluorescence quantitative detection of the relative content of Japanese encephalitis virus mRNA in the culture medium (A) and in the cells (B) of wild-type and sATP6v0d2 knockout pig kidney PK15 cells;

[0045] Fig.11 The present invention is an immunoblot detection result and gray value statistical graph of the expression of Japanese encephalitis virus E protein in wild-type and sATP6v0d2 knockout pig kidney PK15 cells;

[0046] Fig.12 The present invention shows the immunofluorescence detection results (A) and analysis statistics (B) of the distribution of Japanese encephalitis virus E protein in wild-type and sATP6v0d2 knockout pig kidney PK15 cells; Hoechst marks the cell nucleus; the scale is 200 micrometers. DETAILED DESCRIPTION

[0047] The following is a clear and complete description of the technical solution of the present invention in conjunction with the embodiments, so that researchers in the field can fully understand the present invention. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0048] It should be understood that the professional terms described in the present invention are only for describing specific embodiments, rather than for limiting the present invention. Unless otherwise specified, all professional terms used herein have the same meanings as commonly understood by those skilled in the art in the field of the present invention.

[0049] Although only preferred methods and materials are described herein, methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.

[0050] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the present invention.The present invention description and examples are intended to be exemplary only.

[0051] The words “including,” “having,” “containing,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0052] The Japanese encephalitis virus (SA-14-14-2) vaccine strain involved in the following examples was purchased from Wuhan Keqian Biological Co., Ltd. and preserved by the Animal Metabolism Regulation and Immune Response Team of the College of Life Sciences of Henan Agricultural University.

[0053] The LentiCRISPRv2 vector involved in the following examples is preserved by the Animal Metabolism Regulation and Immune Response Team of the College of Life Sciences of Henan Agricultural University. Figure 1 shown.

[0054] Example 1: Design of sgRNA targeting sATP6v0d2 gene

[0055] The sATP6v0d2 gene sequence information (NC_010446.5) was searched in the NCBI database, and the first and second exons of the gene were selected as target design regions.

[0056] According to the sgRNA design principles, log on to http: / / crispr-era.stanford.edu / index.jsp to analyze the sATP6v0d2 sequence. The results are as follows Figure 2 As shown in the figure, three pairs of 20 bp sgRNA fragments were selected according to the scores and named as: sgRNA1 (CGCTGAGCTGTACTTCAATG), sgRNA2 (CAATGTGGACCATGGCTACC), and sgRNA3 (CAAGAAGTTGCCGTAATCAG). CACCG sticky ends were added to the 5' end of the sgRNA fragment, and AAAC and C sticky ends were added to the 5' end and 3' end of the reverse sequence, respectively, as primers for sgRNA targeting the sATP6v0d2 gene. The sgRNA primers were synthesized by Shenzhen BGI Co., Ltd.

[0057] The sgRNA primer sequences are as follows:

[0058] sgRNA1-F: 5'-CACCGCGCTGAGCTGTACTTCAATG-3';

[0059] sgRNA1-R: 5'-AAACATTGAAGTACAGCTCAGCGC-3';

[0060] sgRNA2-F: 5'-CACCGCAATGTGGACCATGGCTACC-3';

[0061] sgRNA2-R: 5'-AAACGGTAGCCATGGTCCACATTGC-3';

[0062] sgRNA3-F: 5'-CACCGCAAGAAGTTGCCGTAATCAG-3';

[0063] sgRNA3-R: 5'-AAACCTGATTACGGCAACTTCTTGC-3';

[0064] Example 2: Construction of LentiCRISPRv2-sgRNA recombinant plasmid

[0065] Annealing of sgRNA primers: Dissolve the primers in Example 1 in ultrapure water to 20 μM, prepare 20 μL annealing reaction system: 3 μL of upstream primer (F); 3 μL of downstream primer (R); add ultrapure water to 20 μL. Incubate the reaction system at 95°C in a PCR instrument for 10 minutes, then cool down by 5°C every three minutes until it reaches 16°C, and finally obtain a double-stranded sgRNA fragment.

[0066] LentiCRISPRv2 vector digestion: Use BsmBI restriction endonuclease to digest the LentiCRISPRv2 vector, and prepare 20μL digestion reaction system: LentiCRISPRv2 vector, 3μg; BsmBI, 1μL; 10×CutSmart buffer, 2μL; add ultrapure water to 20μL. Place the reaction system in a PCR instrument and incubate at 37℃ for 6 hours. Then, perform agarose gel electrophoresis on the reaction product, and use the Novagen gel recovery kit to recover the LentiCRISPRv2 linearized vector with sticky ends after digestion.

[0067] sgRNA enzyme ligation to LentiCRISPRv2 vector: double-stranded sgRNA fragments were ligated to the linearized LentiCRISPRv2 vector by enzymes, and 20 μL enzyme ligation reaction system was prepared: double-stranded sgRNA, 13 μL; linearized LentiCRISPRv2 vector, 4 μL; T4 ligase, 1 μL; 10×T4 Ligase Buffer, 2 μL. The reaction system was placed in a PCR instrument and incubated at 16°C for 12 hours.

[0068] Recombinant plasmid transformation and single clone verification: Take 10 μL of enzyme-linked product and transform it into 100 μL DH5α E. coli competent cells, ice bath for 30 minutes, heat shock at 42°C for 1 minute, and then ice bath for 1 minute. Add 500 μL of non-resistant LB liquid culture medium to the above product, and culture at 37°C, 220rpm for 1 hour. Then use a coating rod to spread the competent cells on an LB solid culture plate containing ampicillin antibiotic resistance, and invert and culture at 37°C for 12 hours.

[0069] A single clone colony was selected and cultured in a liquid LB medium containing ampicillin antibiotic resistance for 12 hours. The plasmid was extracted using the Novozymes plasmid extraction kit. LentiCRISPRv2-sgRNA1, LentiCRISPRv2-sgRNA2, or LentiCRISPRv2-sgRNA3 was sequenced using the hU6F primer (5'-GAGGGCCTATTTCCCATGATT-3'). The test results were as follows: Figure 3 As shown, sgRNA1, sgRNA2, or sgRNA3 have been cloned into the LentiCRISPRv2 vector, respectively, indicating that the LentiCRISPRv2-sgRNA recombinant plasmid was successfully constructed.

[0070] Example 3: Construction of sATP6v0d2 knockout cell line

[0071] About 2×105 pig kidney PK15 cells were plated in a 6-well plate and cultured. When the cell confluence reached 80%, 2 μg of each of the LentiCRISPRv2-sgRNA1, LentiCRISPRv2-sgRNA2, or LentiCRISPRv2-sgRNA3 recombinant plasmids constructed in Example 2 was dissolved in 200 μL jetPRIME buffer, and 4 μL jetPRIMEreagent was added to the above system. After standing for 10 minutes, it was added to the PK15 cell culture medium.

[0072] The LentiCRISPRv2 vector was transfected into PK15 cells in the same manner as a control group.

[0073] 24 hours after transfection, discard the original culture medium and add the culture medium containing puromycin at a final concentration of 2 μg / mL to continue culturing the cells. The culture medium containing puromycin was replaced every 3 days. During this process, it can be observed under a microscope that some cells will gradually die, and small cell clusters with puromycin resistance will appear in the plate.

[0074] Obtain monoclonal cells by limiting dilution method: digest the above cells with digestion solution containing 0.25% trypsin and 0.02% EDTA, and resuspend the cells with culture medium. According to the cell counting results, the cell suspension is divided into each well of the 96-well plate so that each well contains about 1 cell. After 3 days of culture, observe under a microscope, exclude multi-cell wells, mark single-cell wells and continue to culture for 10 days. These cells are regarded as monoclonal cells. Subsequently, the monoclonal cell group is digested with digestion solution and transferred to a 48-well plate for continued subculture. After the cells are fully grown, they are transferred to 24-well plates, 12-well plates, and 6-well plates for expansion culture.

[0075] Example 4: Identification of sATP6v0d2 knockout cell lines

[0076] The expression of ATP6v0d2 in cells was detected by immunoblotting and immunofluorescence using ATP6v0d2 antibody (ab321809).

[0077] The immunoblotting process is as follows: the cell samples were washed twice with 4°C pre-cooled PBS, RIPA (strong) cell lysis buffer was added and supplemented with protease inhibitors, and the cells were allowed to stand on ice for 30 minutes to fully lyse. The samples were collected in a centrifuge tube and centrifuged at 4°C and 12000g for 15 minutes. The supernatant was mixed with 6×SDS loading buffer and the protein was fully denatured in a boiling water bath for 5 minutes. The samples were subjected to SDS-PAGE electrophoresis at a constant voltage of 100V for 1.5 hours. The proteins were then transferred to a 0.45μm PVDF membrane at a constant current of 250mA. The membrane was blocked with a fast blocking solution at room temperature for 15 minutes, and the ATP6v0d2 antibody and GAPDH internal reference antibody were used as primary antibodies at a dilution ratio of 1:2000 and incubated at 4°C for 12 hours. HRP-labeled goat anti-rabbit IgG was then used as a secondary antibody and incubated at room temperature for 2 hours. After washing 3 times with TBST, data were collected using ECL chemiluminescence reagent in a chemiluminescence instrument.

[0078] The immunofluorescence process is as follows: cells are plated on a slide, and the slide is treated with 100ng / mL Fibronectin in the incubator for 3 hours in advance, which is beneficial for cell attachment and spreading. After 24 hours, the culture medium is discarded, and the cells are rinsed three times with preheated PBS, and then 4% paraformaldehyde (PFA) is added to fix the cells for 30 minutes. PFA is aspirated, washed three times with PBS, and 0.1% TritonX-100 is added to permeabilize the cells for 5 minutes. Triton is aspirated, washed three times with PBS, and 5% skim milk powder is added to block the cells for 20 minutes. Use a light-proof humid box, cover with paper towels and paraffin film. Add 30μL ATP6v0d2 antibody on the paraffin film, use tweezers to carefully pick up the slide and buckle it on the primary antibody (cells facing down), and incubate for 1 hour. Use tweezers to pick up the slide and buckle it back to the well plate (cells facing up), and wash it three times with PBS. Add 30 μL of Alexa 488 fluorescent secondary antibody to the paraffin film, use tweezers to carefully pick up the slide and put it on the primary antibody (cells facing down), and incubate for 1 hour. Use tweezers to pick up the slide and put it back on the plate (cells facing up), and wash it three times with PBS. Wipe the slide clean, dip a small amount of Hoechst-containing mounting medium on the slide with the gun tip, use tweezers to carefully pick up the slide and put it on the mounting medium (cells facing down), and dry it in the dark overnight. If the mounting medium does not dry for a long time, you can apply nail polish around the slide and wait for it to dry.

[0079] The results are as follows Figure 4 and Figure 5 As shown, the sATP6v0d2 gene was targeted by sgRNA1, sgRNA2, or sgRNA3, and the expression of sATP6v0d2 in pig kidney PK15 cells was successfully knocked out in combination with CRISPR / Cas9 gene editing technology, and three monoclonal cell lines were screened and named sATP6v0d2-KO1, sATP6v0d2-KO2, or sATP6v0d2-KO3.

[0080] Example 5: Viability detection of sATP6v0d2 gene knockout cell line

[0081] Wild-type PK15 cells (wild-type), sATP6v0d2 knockout cells (sATP6v0d2-KO1, sATP6v0d2-KO2, or sATP6v0d2-KO3) were digested and counted, and 2000 cells were added to each well of the 96-well plate and cultured for 12 hours. 10 μL of CCK-8 solution was added to each well of the 96-well plate, and the culture was continued for 2 hours. The absorbance value of each well at 450 nm was then measured using an ELISA reader. The results are shown in Figure 2. Figure 6As shown, the cell viability of the sATP6v0d2 gene knockout PK15 cell line was comparable to that of the wild-type cells, with no significant difference, indicating that the knockout of the sATP6v0d2 gene did not affect the normal proliferation of the host cells.

[0082] Example 6: sATP6v0d2 gene knockout cell morphology detection

[0083] Wild-type PK15 cells (wild-type) and sATP6v0d2 knockout cells (sATP6v0d2-KO1, sATP6v0d2-KO2, or sATP6v0d2-KO3) were digested and counted, then inoculated into 12-well plates and cultured for 24 hours. The morphology of the cells was then examined using a phase contrast microscope (20×). Figure 7 As shown, there is no obvious difference in cell morphology between the sATP6v0d2 gene knockout PK15 cell line and the wild-type cells, indicating that the knockout of the sATP6v0d2 gene does not affect the normal growth of the host cells.

[0084] Example 7: Detection of migration ability of sATP6v0d2 gene knockout cells

[0085] 5×105 cells were inoculated in a six-well plate and cultured. When the cell confluence reached 100% coverage, a cell scratch experiment was performed. A 200μL pipette tip was used to vertically scratch the plate wells, PBS was washed to remove floating cells, and 2mL of serum-free culture medium was added. Microscope observation and photography were performed in the same field of view at 0, 12, 24, and 36 hours after the scratch, and the migration speed of the two groups of cells was calculated. The results are shown in Figure 2. Figure 8 As shown, there was no significant difference in the cell migration speed between the sATP6v0d2 gene knockout PK15 cell line and the wild-type cells, indicating that the knockout of the sATP6v0d2 gene did not affect the normal growth of the host cells.

[0086] Example 8: Detection of acidic environment of lysosomes in sATP6v0d2 gene knockout cells

[0087] ATP6v0d2 is an important component of V-ATPase, and its functional loss will destroy the acidic environment of lysosomes. In order to verify whether sATP6v0d2 knockout in PK15 cells affects the acidic environment of lysosomes, the present invention uses LysoTracker Red probe to mark the acidic internal environment of lysosomes.

[0088] 1×105 cells were inoculated on the slides and cultured. After 12 hours, the culture medium was discarded and replaced with a culture medium containing 100 nM LysoTracker Red and Hoechst nuclear dye for 1 hour. The culture medium was then discarded and the cells were rinsed twice with preheated PBS buffer. Finally, cell culture medium without phenol red was added to collect data under a laser confocal microscope and perform statistical analysis on the fluorescence signal intensity. The results are shown in Figure 2. Fig. 9 As shown, compared with wild-type cells, the LysoTracker Red fluorescence intensity in the sATP6v0d2 gene knockout PK15 cell line was significantly decreased, indicating that the knockout of the sATP6v0d2 gene destroyed the acidic internal environment of the intracellular lysosomes.

[0089] Example 9: Effect of sATP6v0d2 gene knockout cell line on Japanese encephalitis virus replication

[0090] 1×105 wild-type and sATP6v0d2 knockout cells were plated in 12-well plates respectively. When the cell confluence reached 90%, the culture medium was discarded, and the cells were incubated with Japanese encephalitis virus cell culture medium containing MOI of 0.1 for 2 hours to allow the virus to invade the host cells. The virus solution was then discarded, and the cells were rinsed twice with preheated PBS to ensure that no invading virus was washed away. Finally, culture was continued using culture medium containing 2% fetal bovine serum. After 24 hours, the culture supernatant and cells were collected for Japanese encephalitis virus copy number detection.

[0091] Total RNA was extracted from the culture supernatant and cell samples using Takara RNAiso Plus reagent, and reverse transcribed into cDNA using Novagen HiScript IV 1st Strand cDNA Synthesis Kit. Primers were then designed based on the mRNA sequence of the E protein encoding gene of Japanese encephalitis virus. Upstream primer, 5'-ACTGACATCTCGACGGTGGC-3'; downstream primer, 5'-CTCCCAATCGCTTTACTGGT-3'. Fluorescence quantitative PCR was performed to detect the number of copies of Japanese encephalitis virus according to the Novagen ChamQ SYBR qPCR Master Mix reagent instructions, and each group was repeated 3 times in parallel. The reaction system was: 2×ChamQSYBR qPCR Master Mix, 10μL; 10μM upstream primer, 0.4μL; 10μM downstream primer, 0.4μL; 50×ROXReference Dye, 0.4μL; cDNA, 2μL; ultrapure water was added to 20μL. After the system is prepared, mix it well and place it in the ABI fluorescence quantification instrument for amplification reaction. The reaction conditions are 95℃, 10 seconds; 60℃, 30 seconds; 40 cycles. The number of viral copies in each sample is obtained by comparing the Ct value drawn by the standard curve. The results are as follows Fig.10 As shown, 24 hours after virus infection, the copy number of Japanese encephalitis virus in sATP6v0d2 knockout cells was significantly lower than that in wild-type cells.

[0092] Example 10: Effect of sATP6v0d2 gene knockout cell line on Japanese encephalitis virus E protein

[0093] 1×105 wild-type and sATP6v0d2 knockout cells were plated in 12-well plates respectively. When the cell confluence reached 90%, the culture medium was discarded, and the cells were incubated with Japanese encephalitis virus cell culture medium containing MOI of 0.1 for 2 hours to allow the virus to invade the host cells. The virus solution was then discarded, and the cells were rinsed twice with preheated PBS to ensure that no invading virus was washed away. Finally, culture was continued using culture medium containing 2% fetal bovine serum. After 24 hours, the cells were collected for detection of Japanese encephalitis virus E protein expression level.

[0094] The cell samples were collected and processed by immunoblotting method in Example 4 for SDS-PAGE gel electrophoresis. Abcam Japanese encephalitis virus E protein antibody (ab41671) and GAPDH internal reference antibody were used as primary antibodies, and HRP-labeled goat anti-mouse IgG was used as secondary antibody to detect the level of Japanese encephalitis virus E protein. The gray value of the protein band was analyzed using the ImageJ-GelAnalyzer plug-in. The results are shown in Figure 2. Fig.11As shown, 24 hours after virus infection, the level of Japanese encephalitis virus E protein in sATP6v0d2 knockout cells was significantly lower than that in wild-type cells.

[0095] Example 11: Effect of sATP6v0d2 gene knockout cell line on Japanese encephalitis virus infection rate

[0096] 1×105 wild-type and sATP6v0d2 knockout cells were plated on slides respectively. When the cell confluence reached 90%, the culture medium was discarded, and the cells were incubated with Japanese encephalitis virus cell culture medium containing MOI of 0.1 for 2 hours to allow the virus to invade the host cells. Then the virus solution was discarded, and the cells were rinsed twice with preheated PBS to ensure that no invading virus was washed away. Finally, the culture medium containing 2% fetal bovine serum was used to continue culturing. After 24 hours, the cells were fixed for the detection of the distribution level of Japanese encephalitis virus E protein.

[0097] The cell samples were collected and processed for immunofluorescence processing according to the immunofluorescence method in Example 4. The Japanese encephalitis virus E protein antibody (ab41671) from Abcam was used as the primary antibody, and the Alexa 488 labeled goat anti-mouse IgG was used as the secondary antibody to detect the distribution of the Japanese encephalitis virus E protein. The Alexa 488 signal fluorescence intensity was analyzed using the software ImageJ. The results are shown in FIG. Fig.12 As shown, 24 hours after virus infection, the Japanese encephalitis virus infection rate in sATP6v0d2 knockout cells was significantly lower than that in wild-type cells.

[0098] In summary, the results show that the sATP6v0d2 gene knockout PK15 cell line was successfully constructed by the method of the present invention and can effectively resist the infection of Japanese encephalitis virus. The present invention constructs three target cell lines sATP6v0d2-KO1, sATP6v0d2-KO2, and sATP6v0d2-KO3 by optimizing sgRNA. The method of the present invention is simple and efficient, and the constructed sATP6v0d2 knockout cell line can provide tools and materials for the research on the function of ATP6v0d2 gene and Japanese encephalitis virus infection, and is of great significance to the disease control in the pig industry.

[0099] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the claims of the present invention.

Claims

1. sATP6v0d2 gene knockout PK15 cell line method, characterized in that: The following steps are involved: Step 1, designing a sgRNA sequence (sgRNA1, sgRNA2 or sgRNA3) targeting the sATP6v0d2 gene; the sgRNA1 and sgRNA2 are located in the first exon region of the sATP6v0d2 gene, and sgRNA3 is located in the second exon region of the sATP6v0d2 gene; Step 2: For the primer of sgRNA in step 1, add CACCG at the 5' end of the sense strand, AAAC at the 5' end of the antisense strand, and C at the 3' end of the antisense strand to synthesize single-stranded sgRNA; Step 3: synthesize the double-stranded sgRNA with BsmBI enzyme sticky ends by annealing the single-stranded sgRNA in step 2; Step 4: Recombining the double-stranded sgRNA in step 3 into the LentiCRISPRv2 vector by enzyme ligation; Step 5: transfect the recombinant plasmid in step 4 into PK15 cells; Step 6: Use puromycin to screen the successfully transfected cells; Step 7: Use the limiting dilution method to screen and obtain the PK15 monoclonal cell line with sATP6v0d2 knockout.

2. The method for knocking out the sATP6v0d2 gene in PK15 cell line according to claim 1 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The Japanese encephalitis virus is Japanese epidemic encephalitis virus.

3. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 1 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The cell line is selected from the porcine kidney PK15 cell line, which is a classic cell line tool for studying the pathogenesis of porcine viral diseases.

4. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 1 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The reagent for knocking out the expression of sATP6v0d2 is sgRNA targeting the sATP6v0d2 gene.

5. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 4 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The sgRNA is selected from sgRNA1, sgRNA2, or sgRNA3, the targeting sequence of the sgRNA1 is: CGCTGAGCTGTACTTCAATG; the targeting sequence of the sgRNA2 is: CAATGTGGACCATGGCTACC; the targeting sequence of the sgRNA3 is: CAAGAAGTTGCCGTAATCAG.

6. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 5 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The sgRNA1 is a double-stranded fragment formed by annealing the sgRNA1-F and sgRNA1-R primers: sgRNA1-F: 5'-CACCGCGCTGAGCTGTACTTCAATG-3'; sgRNA1-R: 5'-AAACATTGAAGTACAGCTCAGCGC-3'.

7. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 5 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The sgRNA2 is a double-stranded fragment formed by annealing the sgRNA2-F and sgRNA2-R primers: sgRNA2-F: 5'-CACCGCAATGTGGACCATGGCTACC-3'; sgRNA2-R: 5'-AAACGGTAGCCATGGTCCACATTGC-3'.

8. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 5 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The sgRNA3 is a double-stranded fragment formed by annealing the sgRNA3-F and sgRNA3-R primers: sgRNA3-F: 5'-CACCGCAAGAAGTTGCCGTAATCAG-3'; sgRNA3-R: 5'-AAACCTGATTACGGCAACTTCTTGC-3'.

9. The method of knocking out the sATP6v0d2 gene in PK15 cell line according to claim 4 is used in inhibiting Japanese encephalitis virus infection, characterized in that: The method for knocking out the expression of sATP6v0d2 in PK15 cells is: using CRISPR / Cas9 gene editing technology to cause the protein encoded by the sATP6v0d2 gene in PK15 cells to lose its function.

Images