Method for editing tomato gene by using CRISPR / Cas9 system to enlarge fruits and application

Abstract

The invention discloses a method for enlarging fruits by editing a tomato gene by using a CRISPR / Cas9 system and application, a method for creating a tomato fruit enlarging material through gene editing can be applied to cultivation for improving tomato yield, and relates to the fields of tomato transgenic technology and molecular breeding. The method comprises the following steps: firstly, constructing a CRISPR / Cas9-gRNA (pHEE401-gRNA) vector to accurately edit SlKNUCKLES (SlKNU) (Solyc02g160370) genes in tomatoes, taking Micro-Tom variety tomato cotyledons as explants, transforming by an agrobacterium GV3101 mediated method, screening by taking hygromycin as resistance to obtain positive transgenic tomatoes, then sequencing the SlKNU genes and observing fruit phenotypes, and finally, identifying the SlKNUCKLES (SlKNU) genes. Finally, a homozygous SlKNU gene editing strain without Cas9 is obtained, namely, the tomato mutant with the SlKNU function completely lost, the fruit core and peel number obviously increased and the fruit volume obviously increased is obtained, so that the yield of tomatoes is increased, and therefore, the gene has outstanding application prospects and economic values in high-quality molecular breeding for increasing the yield of tomatoes.

Description

Technical Field

[0001] The present invention belongs to the field of tomato transgenic technology and molecular breeding, and specifically relates to a method and application of editing the SlKNU gene by using the CRISPR / Cas9 system to cause SlKNU mutation and create a tomato mutant with enlarged fruit and increased carpels. Background Art

[0002] Fruit is a plant organ, which is formed by the withering of the anthers, filaments, receptacles and other stamens after pollination and fertilization, and the development of the ovary. After pollination and fertilization, the ovules in the ovary develop into seeds, and the ovary develops into fruits. The ovary, style, stigma and other parts constitute a single pistil or a compound pistil, where a single pistil is a pistil composed of a single carpel, and a compound pistil is a pistil composed of more than two carpels. The determination of the number of carpels is affected by the activity of the floral meristem (FM). When the initiation of each round of floral organs is completed, the FM activity is programmed to terminate, thereby determining the number of carpels and eventually forming a certain number of fruit chambers.

[0003] When plants transition from vegetative growth to reproductive growth, the SAM transforms into the inflorescence meristem (IM), FM is produced around the IM, and finally forms the floral organ. Therefore, the maintenance and timely termination of FM activity are crucial for the normal development of flowers. The termination of Arabidopsis FM activity is a complex and delicate regulatory process. In the shoot apical meristem (SAM) and FM, the transcription factor WUSCHEL (WUS) with a homeotic domain can specifically maintain the activity of stem cells and plays an important role in the maintenance and termination of FM activity. When the flower develops to the 6th to 7th stage, the initiation of the pistil primordium is completed. In order to ensure the certainty of the floral organ, the activity of FM should be terminated in time. When the flower develops to the sixth stage, the KNUCKLES (KNU) gene encoding a C2H2-type zinc finger protein begins to be expressed. The KNU protein can directly bind to the promoter region of WUS and recruit the Polycomb-group (PcG) complex to form the H3K27me3 repressive epigenetic modification mark on the WUS chromatin, thereby inhibiting the expression of the WUS gene and terminating FM activity in a timely manner.

[0004] In tomato (Solanum lycopersicum), nucleotide polymorphisms in the 15-bp repressor element downstream of the SlWUS gene cause differences in the number of fruit locules between different varieties. An increase in the number of tomato fruit locules will lead to an increase in fruit yield of approximately 30%, which has very important agronomic significance. Therefore, by studying the regulation of SlWUS expression in tomatoes, it is possible to control tomato fruit yield. The function of the KNU gene is relatively conservative. There is also a SlKNU gene encoding a C2H2-type zinc finger protein in tomatoes, and its protein can directly bind to the SlWUS promoter region to inhibit the expression of SlWUS.

[0005] Obtaining varieties with excellent shapes through traditional breeding requires a lot of manpower, material resources, financial resources, and a long time period. Therefore, reducing time costs, shortening breeding years, reducing manpower, material resources, financial resources, reducing workload, and obtaining varieties with excellent traits in the shortest time has always been the most concerned issue for breeders. The birth of the powerful gene editing tool CRISPR / Cas9 can achieve site-specific editing of endogenous target genes without introducing exogenous genes, thereby obtaining target trait varieties. As an efficient gene editing tool for plant genetic improvement and molecular breeding, CRISPR / Cas9 is simple to operate, low in cost, and has high editing efficiency. Moreover, since there is no introduction of exogenous genes, it is significantly different from conventional transgenic plants, and its application prospects in crop genetic improvement are very broad. However, so far, there has been no report on obtaining multi-carpel tomatoes with enlarged fruits after knocking out the SlKNU gene using CRISPR / Cas9 technology. Summary of the invention

[0006] The purpose of the present invention is to create a method and application of increasing tomato carpels and enlarging fruits through gene editing technology. The method uses CRISPR / Cas9 gene editing technology to achieve site-directed mutation of the SlKNU gene, so that the SlKNU gene function is completely lost, thereby obtaining multi-carpel tomatoes with enlarged fruits that are stable in inheritance and without foreign gene insertion. It is intended to increase the yield of tomatoes, thereby significantly expanding the economic benefits of tomato planting.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The method and application of editing a tomato gene to enlarge fruit using the CRISPR / Cas9 system comprises the following steps:

[0009] (1) Selection of gRNA target site: According to literature reports, there are three genes in tomato that are highly homologous to KNU in Arabidopsis, namely Solyc00g014800, C2H2_SL2.50Ch12 and SlKNU. All three genes have a C2H2 domain, while only SlKNU has an EAR domain, which is the same as KNU in Arabidopsis. Therefore, SlKNU gene was selected as the target gene for editing. According to the CRISPR / Cas9 target design website https: / / cctop.cos.uni-heidelberg.de / , two targets were selected, one of which was before the C2H2 domain and the other was before the EAR domain, because the function of the KNU gene depends on these two key domains;

[0010] The sequence of the first gRNA target site is: 5′CACCCACCTAGTTTATGATT3′;

[0011] The sequence of the second gRNA target site is: 5′CCGTTTTCTATCCTCCGCCG3′;

[0012] (2) Primer design of gRNA fragment: According to the CRISPR / Cas9 primer design principles, the primer design of gRNA fragment is:

[0013] Upstream primer of the first target, gRNA-F-1: 5'-ATATATGGTCTCGATTGCTGGGGCAACGGAGTTAGACGTTTTAGAGCTAGAAATAGC-3'

[0014] Downstream primer of the first target gRNA-R-1: 5'-ATTATTGGTCTCGAAACCAGCTGAATCTCGACCTTACAATCTCTTAGTCGACTCTAC-3'

[0015] Upstream primer of the second target, gRNA-F-2: 5'-ATATATGGTCTCGATTGAATCATAAACTAGGTGGGTGGTTTTAGAGCTAGAAATAGC-3'

[0016] Downstream primer of the second target gRNA-R-2: 5'ATTATTGGTCTCGAAACCCGTTTTCTATCCTCCGCCGCAATCTCTTAGTCGACTCTAC3'

[0017] (3) Construction of gRNA expression vector: Using plasmid pCBC-DT1T2 as a template, PCR amplification and purification were performed using gRNA-F / R primers to obtain the gRNA fragment. The PCR product and the vector were then cut with restriction endonucleases, and the cut product and the vector were ligated with T4 DNA ligase. The ligated product was transformed into Escherichia coli, and positive clones were screened and extracted from the plasmid to obtain the CRISPR / Cas9-gRNA expression vector.

[0018] (4) The CRISPR / Cas9-gRNA expression vector was transformed into GV3101 Agrobacterium to obtain Agrobacterium containing the expression vector, and the Agrobacterium containing CRISPR / Cas9-gRNA was used to infect wild-type Micro-Tom tomatoes.

[0019] (5) The callus tissue obtained in step (4) is induced to obtain regenerated seedlings after hygromycin resistance screening, and transgenic positive seedlings are obtained through screening.

[0020] (6) From the positive transgenic seedlings obtained in (5), a few leaves are cut to extract genomic DNA. Then, a pair of primers is designed on the Cas9 gene sequence. After PCR amplification, 1% agarose gel electrophoresis is performed. The appearance of a bright band of appropriate size is the positive seedling that has been transferred into the CRISPR / Cas9 expression vector. Then, a pair of primers is designed 100 bp before and after the two target sites for PCR amplification. The PCR amplification products are sequenced and analyzed to analyze whether there is gene editing near the target site. If it is a homozygous mutation, further statistical observation is made through phenotype, and seeds produced after self-pollination are collected. Then the seeds are planted and strains without Cas9 are screened as homozygous plants without exogenous genes. In this way, the seeds of the next generation can be stably inherited and no editing will occur. If the sequencing analysis shows that it is a heterozygous, the next generation of homozygous editing screening is carried out, and further homozygous strains without Cas9 are screened for subsequent experiments.

[0021] (7) After sequencing the PCR products and identifying the homozygous edited strain without Cas9 gene insertion, the SlKNU gene function was completely lost and the multi-carpel tomato plant had enlarged fruits.

[0022] The SlKNU gene sequence described in step (1) is shown in SEQ ID NO: 1 (507 bp).

[0023] Since the S1KNU gene does not contain introns, the bases 1 to 507 from the 5' end in SEQ ID NO: 1 are the S1KNU coding sequence (CDS).

[0023] The design of the target and gRNA primers in step (2) were both referenced from the CRISPR / Cas9 target design website https: / / cctop.cos.uni-heidelberg.de / .

[0024] The CRISPR / Cas9-gRNA expression vector in step (3) is the pHEE401 vector.

[0025] The PCR amplification system in step (3) is as follows: 1 μL of pCBC-DT1T2 template diluted 100 times, 25 μL of 2×Phanta MaxMaster Mix, 1 μL of gRNA-F / R, add water to 50 μL, and the PCR amplification program is as follows: pre-denaturation at 95°C for 6 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0026] The gRNA fragment digestion product and vector connection system described in step (3) is: 2 μg of gRNA fragment, 2 μg of pHEE401 vector, 1 μL of BsaI enzyme (NEB), 5 μL of 10x BsaI buffer, 1 μL of T4 DNA ligase, 5 μL of 10x T4 Buffer, add water to 50 μL, and then set the PCR instrument to 37°C for 5h, 50°C for 5min, and 80°C for 10min. When the program is completed, the gRNA fragment and the pHEE401 vector are connected.

[0027] The PCR product in step (3) was purified using the Omega Gel Extraction Kit.

[0028] The Agrobacterium described in step (4) is Agrobacterium tumefaciens GV3101.

[0029] Advantages and prospects of the present invention:

[0030] The present invention designs a specific target of the SlKNU gene, constructs a CRISPR-Cas9-gRNA (pHEE401-gRNA) expression vector, and transforms tomatoes using GV3101 Agrobacterium-mediated transformation, and uses hygromycin as a resistance marker for screening to obtain positive transgenic tomatoes, and then determines whether homozygous gene editing occurs through sequencing identification and phenotypic observation, and finally obtains a homozygous strain without exogenous gene insertion, which is a mutant tomato with SlKNU deletion, larger fruit and more carpels. The invention can significantly increase the number of carpels and the size of the tomato fruit by editing the SlKNU gene, thereby increasing the yield of tomatoes, and has important application prospects in molecular breeding for improving the quality of tomatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the construction of the gRNA expression vector (pHEE401-gRNA), where Figure A is a map of the connection between the vector and gRNA; Figures B and C are the sequencing result maps of the connection between gRNA-1 and gRNA-2 and pHEE401, respectively.

[0032] Figure 2 It is the identification of SlKNU gene editing, where Figure A is the electrophoresis diagram of the PCR product for SlKNU genotype identification of the CR-1#T2 generation and the homozygous plant type. The red arrow indicates the edited band, and the blue arrow indicates the unedited band; Figure B is the sequencing result map of the SlKNU gene of the homozygous edited strain; Figure C is the sequencing result map of the SlKNU of the CR9#T2 generation.

[0033] Figure 3 Figure 2 is the fruit phenotype of the homozygous tomato strain edited by SlKNU gene, where Figure A is a cross-sectional anatomical diagram of the slknu mutant fruit; Figure B is a statistical analysis of the number of fruit locules of the wild type (WT) and mutant (CR-9#); Figure C is a phenotypic diagram of the fruit size of the wild type (WT) and mutant (CR-9#); Figure D is a statistical analysis of the fruit diameters of the wild type (WT) and mutant (CR-9#). Specific implementation method:

[0034] All technical solutions involved in the present invention will now be described in detail and completely in conjunction with the drawings in the embodiments of the present invention. First of all, it is stated that the described embodiments are only a part of the present invention rather than all the embodiments.

[0035] All tomatoes used in the present invention are wild Micro-Tom varieties purchased from Nanjing Fengshuo Horticulture Co., Ltd.

[0036] Embodiment 1:

[0037] 1. Selection of SlKNU gene target site and design of gRNA primers

[0038] By reading relevant literature, we found that the SlKNU gene has two homologous genes in tomatoes, namely Solyc00g014800 and C2H2_SL2.50Ch12. The specific difference between these two genes and SlKNU is that they do not have the EAR domain sequence at their 3' end, and the EAR motif is indispensable for the function of the SlKNU gene. Therefore, we chose the SlKNU gene and selected two targets through the CRISPR / Cas9 target online design website https: / / cctop.cos.uni-heidelberg.de / . One of the targets is before the C2H2 domain, and the other target is selected before the EAR domain. No matter which of the two targets is edited, the SlKNU gene function can be lost. Their sequences are 5'-AATCATAAACTAGGTGGGTG-3' and 5'-CGGCGGAGGATAGAAAACGG-3', respectively.

[0039] 2. Design gRNA amplification primers based on the sequence of the gRNA target site:

[0040] Upstream primer of the first target, gRNA-F-1: 5'-ATATATGGTCTCGATTGCTGGGGCAACGGAGTTAGACGTTTTAGAGCTAGAAATAGC-3'

[0041] Downstream primer of the first target gRNA-R-1: 5'-ATTATTGGTCTCGAAACCAGCTGAATCTCGACCTTACAATCTCTTAGTCGACTCTAC-3'

[0042] Upstream primer of the second target, gRNA-F-2: 5'-ATATATGGTCTCGATTGAATCATAAACTAGGTGGGTGGTTTTAGAGCTAGAAATAGC-3'

[0043] Downstream primer of the second target gRNA-R-2: 5'-ATTATTGGTCTCGAAACCCGTTTTCTATCCTCCGCCGCAATCTCTTAGTCGACTCTAC-3'

[0044] 3. Construction of gRNA expression vector:

[0045] 3.1 Using plasmid pCBC-DT1T2 as amplification template, gRNA-F / R was used for PCR amplification, and then purified by agarose gel electrophoresis to obtain the gRNA fragment. Among them, the PCR amplification system:

[0046] pCBC-DT1T2 1ul 2×Phanta Max Master Mix 25ul gRNA-F 1ul gRNA-R 1ul ddH2O 22ul

[0047] PCR amplification program: pre-denaturation at 95°C for 6 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0048] PCR products were recovered using the Omega Gel Extraction Kit.

[0049] 3.2 The PCR product was connected to the pHEE401 vector by cutting and ligating at the same time. The system is:

[0050] 3.3 The ligation product was transformed into E. coli DH5α, and then spread on kanamycin-resistant LB medium. The next day, a single colony was picked for PCR amplification to detect whether the ligation was successful. The PCR amplification primers were: upstream primer F 5'-TACAGCTAGAGTCGAAGTAGTG-3'; downstream primer R 5'-CCATTACTAATGTCTTCTTACG-3', and the PCR amplification band was about 940bp.

[0051] 3.4 Pick the single colony with the correct PCR amplification and extract the plasmid for sequencing, where the sequencing primer is F 5'-TACAGCTAGAGTCGAAGTAGTG-3'.

[0052] 4. Transform the plasmid with completely correct sequencing into GV3101 Agrobacterium and spread it on LB solid medium containing gentamicin, rifampicin and kanamycin. After a single colony grows, perform colony PCR to verify whether it is a positive clone.

[0053] Embodiment 2:

[0054] 1. Tomato Transformation

[0055] 1.1 Seed disinfection (1) Take 50 wild-type Micro-Tom seeds in two 10 ml test tubes and soak them in 50% sodium hypochlorite solution for 5 min; (2) Discard the sodium hypochlorite and add an appropriate amount of sterilized water; (3) Rotate on a rotor at 40 r / s for 5 min; (4) In a clean bench, pour out the water in the test tube, repeating this cycle 5 times; (5) The seeds were inoculated into 1 / 2MS culture medium that had been prepared and sterilized in advance and placed at room temperature. Twenty-five seeds were inoculated into each culture medium, which was sealed and cultured at 25°C in the dark for 2-4 days. After the seeds germinated, they were transferred to light (16 h in light and 8 h in darkness) and cultured at 25°C.

[0056] 1.2 Cut cotyledons (1) Prepare MS0 medium (cover the solid medium with a piece of sterile filter paper to prevent contamination), a large dish with filter paper, and sterile distilled water in advance; (2) Pour a small amount of distilled water cooled to room temperature into a large dish, take out the seedlings with fully extended cotyledons, cut off the leaves, and then cut 2-3 small cotyledons with wounds from each small leaf, and sow the cotyledons into MS0 medium; (3) After sealing, culture under light for 24-36 hours.

[0057] 1.3 Infection (1) Take a 15 ml sterilized tube in a clean bench, add 2 ml of sterilized LB liquid, pick a single Agrobacterium colony in the solid culture medium, shake at 200 rpm for 16 h (overnight) at 28°C in the dark, and then store in a refrigerator at 4°C. It can be used within 15 days. (2) On the second day, take 1.5 ml of the turbid bacterial solution in the test tube and add it to a sterile Erlenmeyer flask containing 30 ml of kanamycin-resistant liquid LB. Shake the culture at 200 rpm for 6 h at 28°C in the dark. (3) After the bacterial liquid is cultured and suspended, pour the bacterial liquid into a 50ml sterile centrifuge tube (clean bench), then take another 50ml tube, add water to balance it, and centrifuge it in a large centrifuge No. 6 rotor at 3600r for 8-10 minutes. After centrifugation, discard the supernatant liquid, add an appropriate amount of sterile liquid MS, and adjust it to OD600 equal to 0.01-0.1 as the appropriate infection concentration. Then pour the bacterial liquid into a sterile small culture dish, pour the cotyledons into the bacterial liquid with filter paper, and culture it in the dark for 5 minutes. After the bacterial liquid is squeezed out, use sterile filter paper to absorb the bacterial liquid, then add clean new filter paper on the MS0 culture medium, sandwich the infected cotyledons into the culture medium, and culture it in the dark for 48 hours.

[0058] 1.4 Transfection with MS1 callus culture The cotyledons were placed into MS1 medium 48 hours after infection. Generally, one cotyledon in MS0 medium was transferred into 3-4 MS1 medium.

[0059] 1.5 Transgenic MS2-resistant shoot culture The cotyledons with more callus were transferred to MS2 for culture.

[0060] 1.6 Transformation of MS3 into rooting culture The cotyledons of the resistant buds that have grown larger are transferred out, the calluses are excised in a large dish, and then transferred to MS3 culture bottles for culture.

[0061] 1.7 Transplantation The seedlings that have grown and have vigorous rooting are transferred out of the culture medium. (1) Cut two small holes at the bottom of a disposable plastic paper cup and put vermiculite in it, put it in a pot disinfected with potassium permanganate, add water and wait for the vermiculite to absorb water; (2) Gently lift the plant in MS3 and wash the solid culture medium around the tomato roots in a slow stream of water to prevent bacteria from growing on the roots in the later stages of growth; (3) Dig a small hole in the middle of the vermiculite, gently wrap the tomato root around and place it into the hole, squeeze and press firmly, take two blue gun tips, clearly mark the variety type on them, and insert them into the vermiculite; (4) Cover with another perforated plastic cup and place in the culture room for cultivation.

[0062] 2. Identification of transgenic plants

[0063] 2.1 A total of 7 mature seedlings were harvested through tomato transformation, which were named CR-1#, CR-2#, CR-3#, CR-4#, CR-5#, CR-6#, and CR-7#;

[0063] 2.2 The above-obtained seedlings were tested by PCR to see whether the target gene was edited. A pair of sequencing primers were designed according to the target site, which were:

[0064] CR-SlKNU-F 5'-GTTTTGACAATCAAATCGGAG-3';

[0065] CR-SlKNU-R 5'-CTTGTTTGATTGTGGAATGGTTG-3';

[0066] 2.3 Extract genomic DNA from leaves of seven mature seedlings and wild-type Micro-Tom leaves respectively, and then perform PCR amplification. PCR reaction system:

[0067] CR plant genomic DNA / wild-type genomic DNA, 1 μL; Green Taq Mix (2X), 5 μL; CR-SlKNU-F; 1 μL; CR-SlKNU-R; 1 μL; ultrapure water, 2 μL;

[0068] The PCR amplification program was as follows: pre-denaturation at 95°C for 6 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min;

[0069] The PCR product was sequenced using the sequencing primer CR-SlKNU-F / R.

[0070] 3. By comparing the sequencing results, we can identify the edited and unedited plants, and whether the edited plants are homozygous or heterozygous. If they are homozygous, we will observe and record the phenotype. If they are heterozygous, we will propagate and wait for the next generation of plants before sequencing. Collect the T0 generation seeds of the edited tomatoes, plant them, obtain the T1 generation seedlings, perform PCR detection to see if the Cas9 gene still exists, and then further detect and screen the homozygous edited tomato plants. The primers for detecting whether the exogenous gene still exists are:

[0071] Cas9-F 5'-GACAAGAAGTACTCGATCGGC-3';

[0072] Cas9-R 5'-GTATTGTGTCCTTGGAGAGCTG-3';

[0073] According to the sequencing results, CR-1# is a heterozygous gene with a large deletion; CR-2# is a heterozygous gene with a deletion of 6 bases; CR-3# is a homozygous gene with an additional base; CR-7# is a homozygous gene with a deletion of one base. Details are as follows:

[0074]

Claims

1. A method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system, characterized in that: Including the selection of gRNA target site; The sequence of the first gRNA target site was: 5′-CACCCACCTAGTTTATGATT-3′; The sequence of the second gRNA target site was: 5′-CCGTTTTCTATCCTCCGCCG-3′; Included gRNA PCR primers: Upstream primer of the first target, gRNA-F-1: 5'-ATATATGGTCTCGATTGCTGGGGCAACGGAGTTAGACGTTTTAGAGCTAGAAATAGC-3' Downstream primer of the first target gRNA-R-1: 5'-ATTATTGGTCTCGAAACCAGCTGAATCTCGACCTTACAATCTCTTAGTCGACTCTAC-3' Upstream primer of the second target, gRNA-F-2: 5'-ATATATGGTCTCGATTGAATCATAAACTAGGTGGGTGGTTTTAGAGCTAGAAATAGC-3' Downstream primer of the second target gRNA-R-2: 5'-ATTATTGGTCTCGAAACCCGTTTTCTATCCTCCGCCGCAATCTCTTAGTCGACTCTAC-3'.

2. A method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system according to claim 1, characterized in that: The following steps are involved: (1) Selection of gRNA target site location: Since the SlKNU gene does not have introns, both targets were designed in the exon region of the gene. Since the protein encoded by this gene has two important domains, one is the C2H2 domain and the other is the EAR domain, the first target was designed before the C2H2 domain and the other target was designed before the EAR domain, with a spacing of 360 bp between the two targets. The sequence of the first gRNA target site was: 5′-CACCCACCTAGTTTATGATT-3′; The sequence of the second gRNA target site was: 5′-CCGTTTTCTATCCTCCGCCG-3′; (2) gRNA PCR primer design: Upstream primer of the first target, gRNA-F-1: 5'-ATATATGGTCTCGATTGCTGGGGCAACGGAGTTAGACGTTTTAGAGCTAGAAATAGC-3' Downstream primer of the first target gRNA-R-1: 5'-ATTATTGGTCTCGAAACCAGCTGAATCTCGACCTTACAATCTCTTAGTCGACTCTAC-3' Upstream primer of the second target, gRNA-F-2: 5'-ATATATGGTCTCGATTGAATCATAAACTAGGTGGGTGGTTTTAGAGCTAGAAATAGC-3' Downstream primer of the second target gRNA-R-2: 5'-ATTATTGGTCTCGAAACCCGTTTTCTATCCTCCGCCGCAATCTCTTAGTCGACTCTAC-3' (3) Construction of gRNA expression vector: Using plasmid pCBC-DT1T2 as a template, PCR amplification and purification were performed with gRNA-F / R primers to obtain gRNA fragments. The PCR product and the vector were then cut with restriction endonucleases, and the digested product and the vector were connected with T4 DNA ligase. After the connection product was obtained, it was transformed into Escherichia coli, and then positive clones were screened and the CRISPR / Cas9-gRNA expression vector was obtained through plasmid extraction. (4) Transforming GV3101 Agrobacterium with the CRISPR / Cas9-gRNA expression vector to obtain Agrobacterium containing the expression vector, and then infecting wild-type Micro-Tom tomatoes with the Agrobacterium containing CRISPR / Cas9-gRNA; (5) the callus obtained in step (4) is induced to obtain regenerated seedlings after hygromycin resistance screening and transgenic positive seedlings are obtained through screening; (6) The regenerated seedlings obtained by hygromycin screening were subjected to DNA level detection of exogenous gene insertion, and the SlKNU gene was amplified and sequenced to detect whether gene editing occurred by comparing it with the wild-type tomato SlKNU gene sequence. Then, phenotypic identification was performed to finally determine whether it was a homozygous edited tomato plant.

3. The method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system according to claim 2, characterized in that: The CRISPR / Cas9 vector used in step (3) is pHEE401.

4. The method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system according to claim 2, characterized in that: The PCR amplification system in step (3) is: 1 μL of pCBC-DT1T2 template diluted 100 times, 25 μL of 2×Phanta MaxMasterMix, 1 μL of gRNA-F / R, add water to 50 μL, and the PCR amplification program is: pre-denaturation at 95°C for 6 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

5. The method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system according to claim 2, characterized in that: The gRNA fragment digestion product and vector connection system described in step (3) is: 2 μg of gRNA fragment, 2 μg of pHEE401 vector, 1 μL of BsaI enzyme (NEB), 5 μL of 10x BsaI buffer, 1 μL of T4 DNA ligase, 5 μL of 10x T4 Buffer, add water to 50 μL, and then set the PCR instrument to 37°C for 5h, 50°C for 5min, and 80°C for 10min. When the program is completed, the gRNA fragment and the pHEE401 vector are connected.

6. The method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system according to claim 2, characterized in that: The Agrobacterium described in step (4) is Agrobacterium tumefaciens GV3101.

7. Use of a tomato mutant with more carpels and enlarged fruits prepared by the method for creating multi-carpel tomato materials with enlarged fruits using the CRISPR / Cas9 gene editing system as described in any one of claims 1 to 6 in tomato breeding.

Images