Recombinant yeast for preparing lumbrukinase and application thereof

Abstract

The invention provides recombinant saccharomycetes for preparing lumbrukinase and application of the recombinant saccharomycetes, and relates to the technical field of genetic engineering. According to the invention, when the lumbrukinase F238 is expressed, one or more genes in VPS29, BMT3 and SUN4 are knocked out in a targeted manner by utilizing a CRISPR-Cas9 gene editing technology, so that the expression quantity of the lumbrukinase F238 is increased. According to the recombinant engineering bacterium, the yield of the lumbrukinase can be obviously increased and can reach 257% at most, meanwhile, the activity of the lumbrukinase is obviously enhanced and can reach 769.6 U / mL at most, and the recombinant engineering bacterium has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a recombinant yeast for preparing lumbrokinase and an application thereof. Background Art

[0002] Thrombotic disease is a common disease that endangers human life and health, and the incidence and mortality rates are increasing year by year. Currently, the common drugs used to prevent and treat thrombotic diseases are mainly urokinase, streptokinase, tissue plasminogen activator (t-PA), etc., but clinical studies have found that these drugs have limited efficacy, large side effects and are expensive. Therefore, there is an urgent need to seek a new antithrombotic drug that is easy to obtain, has significant efficacy, no side effects and is low in price for clinical treatment.

[0003] Lumbrokinase (Lumbrokinase, LK) is a group of serine proteases with good fibrinolytic activity obtained from earthworms. It has the dual efficacy of thrombolysis and prevention of thrombosis, and can effectively prevent and treat ischemic cardiovascular and cerebrovascular diseases. At present, most of the lumbrokinase capsules and injections used in the domestic medical field are directly extracted from earthworms. The procedure for obtaining high-purity pure natural lumbrokinase is complicated and difficult. Due to the low purity of the obtained enzyme preparation, it is limited to oral administration and cannot be used for clinical treatment of humans. Therefore, the use of heterologous expression to obtain high-purity lumbrokinase has become a research direction for scientific researchers. It is reported that lumbrokinase has been successfully expressed in fungi, bacteria and animal cells. At present, the study of heterologous expression of lumbrokinase is limited to the shake bottle stage, and large-scale production has not been carried out. Therefore, increasing the yield of lumbrokinase has become the main goal of current lumbrokinase research. High-density fermentation using recombinant bacteria is an effective way to achieve industrial production of lumbrokinase.

[0004] Current studies have shown that the production and secretion of source proteins involves multiple physiological and biochemical reactions in cells, and there are many unknown genes that may play a key role. For example, Swedish researchers found through high-throughput screening methods that knocking out the protein transport-related genes GOS1, VPS5, TDA3 or the deacetylase complex subunit encoding gene HDA2 can increase the secretion level of α-amylase, destroy the cell wall protein CWP2 gene, and increase the extracellular enzyme activity of recombinant Saccharomyces cerevisiae β-glucosidase, providing new ideas for transforming recombinant engineered bacteria to increase the production and activity of lumbrokinase. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a recombinant engineered bacterium for producing lumbrokinase. The recombinant engineered bacterium achieves efficient expression of lumbrokinase F238 by expressing lumbrokinase F238 and at the same time, utilizing CRISPR-Cas9 gene editing technology to target and knock out one or more of the VPS29, BMT3, and SUN4 genes, thereby laying a foundation for the industrial application of lumbrokinase F238.

[0006] On the one hand, the present invention provides a recombinant engineered bacterium for preparing lumbrokinase, wherein the recombinant engineered bacterium expresses lumbrokinase F238; the amino acid sequence of the lumbrokinase F238 is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.8 or a nucleotide sequence that has at least 98% identity with SEQ ID NO.8.

[0007] Furthermore, the recombinant engineered bacteria utilizes CRISPR-Cas9 gene editing technology to target and knock out one or more genes among VPS29, BMT3, and SUN4 genes. The following steps are included:

[0008] S1: Construction of Cas9 and gRNA co-expression plasmid;

[0009] S2: Preparation of donor DNA;

[0010] S3: Preparation of competent cells;

[0011] S4: Construct strains with one or more genes in VPS29 and BMT3 knocked out.

[0012] The VPS29 gene nucleotide sequence is a nucleotide sequence encoding a protein of SEQ ID NO.2. Preferably, the VPS29 gene nucleotide sequence is as shown in SEQ ID NO.1, and the VPS29-gRNA sequence is as shown in SEQ ID NO.9.

[0013] The BMT3 gene nucleotide sequence is a nucleotide sequence encoding a protein of SEQ ID NO.4. Preferably, the BMT3 gene nucleotide sequence is as shown in SEQ ID NO.3, and the BMT3-gRNA sequence is as shown in SEQ ID NO.10.

[0014] The SUN4 gene nucleotide sequence is a nucleotide sequence encoding a protein of SEQ ID NO.6. Preferably, the SUN4 gene nucleotide sequence is as shown in SEQ ID NO.5, and the SUN4-gRNA sequence is as shown in SEQ ID NO.11.

[0015] The Cas9 gene nucleotide sequence is shown in SEQ ID NO.12, and the encoded amino acid sequence accession number is GenBank: UFQ04583.1. In one embodiment of the present invention, the recombinant expression cassette of Cas9 and gRNA is on a nucleic acid construct, and the geneticin G418 resistance tag is screened.

[0016] The donor DNA uses Pichia pastoris GS115 genomic DNA as a template and uses overlap extension PCR technology to obtain left and right homologous arm fragments of VPS29 gene, BMT3 gene and SUN4 gene.

[0017] The nucleic acid construct includes any one or more of pHIL-D2, pPIC3.5, pHIL-S1, pPIC9, pPink-LC, pPink-HC, pGAPZA, and pGAPZaA plasmids; the recombinant promoter is preferably a constitutive promoter, including any one or more of GAP promoter, TEF1 promoter, PGK1 promoter, and HGT1 promoter.

[0018] Furthermore, the recombinant engineered bacteria contains at least one copy of a nucleotide sequence encoding lumbrokinase F238.

[0019] Preferably, the copy number of the nucleotide sequence encoding lumbrokinase F238 in the recombinant engineered bacteria is 1 to 3. In an embodiment of the present invention, the copy number of the nucleotide sequence encoding lumbrokinase in the recombinant engineered bacteria is 3.

[0020] Furthermore, the recombinant engineered bacteria of the present invention also include a drug resistance gene fragment. The drug resistance gene fragment is used for screening of recombinant engineered bacteria. In an embodiment of the present invention, the drug resistance fragment is a geneticin G418 resistance gene.

[0021] Furthermore, the recombinant engineered bacteria also include a signal peptide sequence, and the signal peptide sequence is used for the secretory expression of exogenous proteins in the recombinant engineered bacteria. In an embodiment of the present invention, the signal peptide sequence in the recombinant engineered bacteria is a mating factor signal peptide of Saccharomyces cerevisiae a; preferably, the nucleotide sequence encoding the mating factor signal peptide of Saccharomyces cerevisiae a is shown in SEQ ID NO.13.

[0022] Furthermore, the recombinant engineered bacteria is selected from one or more of Pichia pastoris, Hansenula, Candida, and Saccharomyces cerevisiae. Preferably, the recombinant engineered bacteria is Pichia pastoris; more preferably, the Pichia pastoris is Pichia pastoris GS115.

[0023] On the other hand, the present invention also provides the use of the recombinant engineered bacteria in producing lumbrokinase F238 and / or increasing the expression level of lumbrokinase F238.

[0024] In the last aspect, the present invention also provides lumbrokinase F238 prepared by fermentation using the above-mentioned recombinant engineered bacteria.

[0025] The beneficial effects of the present invention include:

[0026] The present invention constructs a recombinant engineered bacterium for preparing human lumbrokinase, which can significantly increase the expression level of human lumbrokinase, and can make the production of human lumbrokinase reach up to 257% at the highest, and the enzyme activity can reach up to 769.6U / mL. The recombinant engineered bacterium of the present invention improves the structure of proteins and cell walls related to protein transport, and knocks out one or more of the genes VPS29 gene related to protein transport and the genes BMT3 and SUN4 genes related to cell wall composition, resulting in transport protein defects and cell wall structural defects, and significantly enhancing the heterologous protein secretion ability of the recombinant engineered strain. The recombinant engineered bacteria show strong potential in increasing the production of proteins with high economic value and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0028] Figure 1 Schematic diagram of the structure of the recombinant expression cassette pPICZA-rF238 encoding lumbrokinase;

[0029] Figure 2 It is a schematic diagram of the structure of the recombinant expression cassette pART202 encoding the Cas9 recombinant nucleic acid molecule and the VPS29-gRNA recombinant nucleic acid molecule;

[0030] Figure 3 It is a schematic diagram of the structure of the recombinant expression cassette pART204 encoding the Cas9 recombinant nucleic acid molecule and the BMT3-gRNA recombinant nucleic acid molecule;

[0031] Figure 4 It is a schematic diagram of the structure of the recombinant expression cassette pART206 encoding the Cas9 recombinant nucleic acid molecule and the SUN4-gRNA recombinant nucleic acid molecule;

[0032] Figure 5 It is the colony pattern in Example 3;

[0033] Figure 6 The SDS-PAGE gel electrophoresis pattern of the recombinant engineering bacteria expressing lumbrokinase F238 in Example 4, wherein numbers 1-7 correspond to the electrophoresis patterns of lumbrokinase F238 of the recombinant engineering bacteria 1-7, respectively, and M is a protein marker;

[0034] Figure 7This is a schematic diagram of the results of expressing lumbrokinase F238 by each recombinant engineered bacteria in Example 4;

[0035] Figure 8 This is a schematic diagram of the detection results of the lumbrokinase F238 activity produced by each recombinant engineered bacteria in Example 5. DETAILED DESCRIPTION

[0036] Expression cassette: refers to a gene expression system that contains all the necessary elements required for the expression of foreign proteins, including promoter, foreign gene cloning site, signal peptide sequence, mature peptide coding sequence of the target protein, terminator, selection marker, etc.

[0037] Vector: refers to autonomous DNA that can bring foreign DNA into host cells for replication or ultimately expression of foreign gene DNA. It is mainly divided into cloning vectors and expression vectors. The former is mainly used for gene replication and amplification, while the latter is mainly used for the expression of target genes.

[0038] Host cell: refers to the cell that accepts foreign genes during transformation or transduction.

[0039] Recombinant engineered bacteria: a fungal cell strain that uses genetic engineering methods to efficiently express exogenous genes.

[0040] In order to more clearly explain the overall concept of the present invention, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features known in the art are not described.

[0041] If no specific conditions are specified in the examples, the experiments were carried out according to conventional conditions or conditions recommended by the manufacturer.

[0042] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0043] The molecular biology experimental methods not specifically described in the following examples were all carried out according to the kits and product instructions, or with reference to the methods described in the book Molecular Cloning Laboratory Manual (3rd edition) by J. Sambrook.

[0044] The sources of experimental materials and reagents involved in the present invention are as follows.

[0045] Strain: Pichia pastoris GS115, purchased from Biobio Biotech Co., Ltd.

[0046] Expression vector: The expression vectors pPICZA and pGAPZA were purchased from commercial sources. The following expression cassettes were constructed in the laboratory: 1) An expression cassette encoding at least one recombinant nucleic acid molecule of lumbrokinase, the structure of which is shown in the following figure: Figure 1 2) an expression cassette encoding a Cas9 recombinant nucleic acid molecule and a VPS29-gRNA recombinant nucleic acid molecule, the structure of which is shown in FIG. Figure 2 3) an expression cassette encoding a Cas9 recombinant nucleic acid molecule and a BMT3-gRNA recombinant nucleic acid molecule, the structure of which is shown in FIG. Figure 3 4) an expression cassette encoding a Cas9 recombinant nucleic acid molecule and a SUN4-gRNA recombinant nucleic acid molecule, the structure of which is shown in FIG. Figure 4 shown.

[0047] Enzymes and kits

[0048] Restriction endonuclease BglII was purchased from NEB; plasmid extraction kit, agarose gel recovery kit, and DNA product purification kit were purchased from Tiangen Biotechnology Co., Ltd.; PrimeSTAR high-fidelity DNA polymerase was purchased from Takara; Zeocin and Geneticin were purchased from Thermo Fisher Scientific.

[0049] Culture medium

[0050] Escherichia coli culture medium LB (1% (w / v) tryptone, 0.5% (w / v) yeast extract, 1% (w / v) NaCl, pH 7.0).

[0051] Yeast culture medium YPD (1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose); yeast screening medium YPDZ (YPD + different concentrations of Zeocin); YPDB (YPD + different concentrations of Geneticin);.

[0052] MD solid medium: glucose 20.0 g / L, YNB 3.4 g / L, ammonium sulfate 10.0 g / L, biotin 4 × 10 -4 g / L (sterilized by 0.22 μm membrane filtration), agar strip 20.0 g / L, used for Pichia pastoris transformation.

[0053] MM solid medium: anhydrous methanol 50 mL / L (w / v), YNB 3.0 g / L, ammonium sulfate 10.0 g / L, biotin 4 × 10 -4 g / L (sterilized by 0.22 μm membrane filtration), agar strip 20.0 g / L, used for Pichia pastoris screening.

[0054] Yeast medium BMGY (1% (w / v) yeast extract, 2% (w / v) peptone, 1.34% (w / v) YNB, 0.00004% (w / v) Biotin, 1% glycerol (V / V)).

[0055] Yeast induction medium BMMY (1% (w / v) yeast extract, 2% (w / v) peptone, 1.34% (w / v) YNB, 0.00004% (w / v) Biotin, 0.4% methanol (V / V)), Note: YNB is yeast nitrogen base (Yeast Nitrogen Base); Biotin is biotin.

[0056] Example 1: Construction of Lumbrokinase Pichia pastoris GS115 Strain

[0057] The nucleic acid molecule encoding the signal peptide of the mating factor of Saccharomyces cerevisiae a (SEQ ID NO.13) and the optimized nucleic acid molecule encoding the F238 gene of lumbrokinase (nucleotide sequence such as SEQ ID NO.8, amino acid sequence such as SEQ ID NO.7) were commissioned to be directly synthesized by a biological company, and then ligated into the plasmid pPICZA digested with EcoRI and NotI to form an expression vector named pPICZA-rF238 (such as Figure 1 shown).

[0058] The expression vector was linearized with DNA restriction endonuclease BglII and transformed into Pichia pastoris GS115 by electroporation. The cells were spread on the selection plate YPDZ containing different high concentrations of Zeocin antibiotics and cultured at 30°C until colonies appeared. Positive transformants were identified by colony PCR and stored in glycerol tubes.

[0059] Pick a single colony that grows fast on the MD plate and slowly on the MM plate, inoculate it into 15 mL of YPD medium, and culture it at 28°C for 18 h. Inoculate the seed liquid into 30 mL of BMMY medium at a 1% inoculum and culture it at 28°C with shaking until OD 600 =2-6. The supernatant was removed by centrifugation to collect the bacteria, 1 mL of BMMY medium was used to resuspend the bacteria, and the resuspended liquid was inoculated into 30 mL of BMMY medium. The culture conditions were 28°C, 220 rpm, and methanol was added once every 24 hours at an addition rate of 0.5%. The fermentation liquid was centrifuged at a fixed point to take the supernatant to detect the activity of lumbrokinase. The enzyme activity is shown in Table 1. As can be seen from Table 1, the recombinant engineered bacteria 2 had the highest enzyme activity, and the recombinant engineered bacteria 2 was used as a template to continue the transformation.

[0060] Table 1

[0061] Time (h) 12 24 36 48 60 72 84 96 Recombinant engineering bacteria 1 (U / mL) 104.9 183.8 262.6 329.4 369 388.2 394.8 380.6 Recombinant engineering bacteria 2 (U / mL) 129.2 237.2 335.4 426.6 460.6 484.8 503.4 487.8 Recombinant engineering bacteria 3 (U / mL) 119.9 215.8 307 389.4 432.8 463 487 454.8 Recombinant engineering bacteria 4 (U / mL) 109.2 196.4 277.6 346.8 388.4 410.6 427.2 397.6

[0062] Example 2: Construction of Cas9 and gRNA co-expression vector

[0063] In this example, in order to establish a suitable genome editing CRISPR system, the dual promoter pHTX1 (nucleotide sequence as shown in SEQ ID NO.14) was attempted to construct a vector for co-expression of Cas9 and gRNA (Weninger A, HatzlAM, Schmid C, Vogl T, Glieder A. Combinatorial optimization of CRISPR / Cas9expression enables precision genome engineering in the methylotrophic yeast Pichia pastoris. J Biotechnol. 2016 Oct 10; 235: 139-49.).

[0064] The recombinant expression cassette encoding the Cas9 gene and the VPS29-gRNA gene was directly synthesized by a biological company, and then ligated into the plasmid pPICZA digested with BglII and BamHI to form an expression vector named pART201. Using gene homologous recombination technology, the biological company was commissioned to replace the Zeocin resistance gene in pART201 with the Geneticin G418 resistance gene (nucleotide sequence as shown in SEQ ID NO.15) to form an expression vector named pART202 (as shown in Figure 2 shown).

[0065] The recombinant expression cassette encoding the Cas9 gene and the BMT3-gRNA gene was directly synthesized by a biological company, and then connected to the plasmid pPICZA digested with BglII and BamHI to form an expression vector named pART203. Using gene homologous recombination technology, the biological company was commissioned to replace the Zeocin resistance gene in pART203 with the geneticin G418 resistance gene (nucleotide sequence as shown in SEQ ID NO.15) to form an expression vector named pART204 (as shown in Figure 3 shown).

[0066] The recombinant expression cassette encoding the Cas9 gene and the SUN4-gRNA gene was directly synthesized by a biological company, and then ligated into the plasmid pPICZA digested with BglII and BamHI to form an expression vector named pART205. Using gene homologous recombination technology, the biological company was commissioned to replace the Zeocin resistance gene in pART205 with the geneticin G418 resistance gene (nucleotide sequence as shown in SEQ ID NO.15) to form an expression vector named pART206 (as shown in Figure 4 shown).

[0067] Example 3: Construction of VPS29, BMT3, SUN4 gene targeted knockout strains

[0068] In order to prepare the donor DNA for VPS29 knockout, the following operations were performed: using Pichia pastoris GS115 genomic DNA as a template, VPS29-UP-F / VPS29-UP-R and VPS29-DN-F / VPS29-DN-R as primers, PCR was performed to obtain the left and right homologous arm fragments of the VPS29 gene; then, using VPS29-UP-F and VPS29-DN-R as primers and a mixture of the left and right homologous arm fragments as a DNA template, overlap extension PCR technology was used to obtain the donor DNA for VPS29 knockout.

[0069] In order to prepare the donor DNA for BMT3 knockout, the following operations were performed: using Pichia pastoris GS115 genomic DNA as a template, BMT3-UP-F / BMT3-UP-R and BMT3-DN-F / BMT3-DN-R as primers, PCR was performed to obtain the left and right homologous arm fragments of the BMT3 gene; then, using BMT3-UP-F and BMT3-DN-R as primers and a mixture of the left and right homologous arm fragments as a DNA template, overlap extension PCR technology was used to obtain the donor DNA for BMT3 knockout.

[0070] In order to prepare the donor DNA for SUN4 knockout, the following operations were performed: using Pichia pastoris GS115 genomic DNA as a template, SUN4-UP-F / SUN4-UP-R and SUN4-DN-F / SUN4-DN-R as primers, PCR was performed to obtain the left and right homologous arm fragments of the SUN4 gene; then, using SUN4-UP-F and SUN4-DN-R as primers and the mixture of the left and right homologous arm fragments as a DNA template, overlap extension PCR technology was used to obtain the donor DNA for SUN4 knockout.

[0071] The PCR reaction system is shown in Table 2, and the specific nucleotide sequences of the upstream primer and the downstream primer are shown in Table 3.

[0072] Table 2

[0073] PrimeSTAR HS 12.5μl Upstream primer 1μl Downstream primer 1μl DNA template 5μl <![CDATA[ddH2O]]> 5.5μl

[0074] Table 3

[0075] VPS29-UP-F CCGAGTTGGCTTGGGAGAAT VPS29-UP-R TTCCACTTCCGAACCGTCTG VPS29-DN-F GGAAAAGCAAGTTGCCACCC VPS29-DN-R TTACAATCGACCCCACCAGC BMT3-UP-F TTTGCCGAAACGAGTGAGGA BMT3-UP-R CTTGTTGGCTGCTGTTGTGG BMT3-DN-F CCATCGCTACACAGCCATCT BMT3-DN-R CAACGTAGAGGGCAACGACT SUN4-UP-F GGAGCAAGCAGACACAGACT SUN4-UP-R GGCGGGTTTAGGAGTGTTCA SUN4-DN-F ACTGGAGCCTCTTCCGGTAT SUN4-DN-R AGTCCACCTTACGCTTGCTA

[0076] 2 μg of Cas9 and gRNA co-expression vector and 2 μg of donor DNA were co-transformed into the recombinant engineered bacteria 2 in Example 1, coated on the selection plate YPDB containing blasticidin antibiotic, and cultured at 30°C until colonies appeared. Figure 5 As shown, the positive transformants were identified as recombinant engineered bacteria 5-7 by colony PCR, and the specific information is shown in Table 6.

[0077] Example 4: Expression level of lumbrokinase in recombinant engineered bacteria

[0078] Recombinant engineered bacteria 1-8 were inoculated into 30 mL of BMMY culture medium containing 0.1% (mass fraction) serine and cultured overnight at 220 rpm and 28°C. 600 The pH value was 1.5, 5.5, and the bacterial solution was centrifuged. The precipitate was resuspended in 40 mL of BMMY culture medium. Induction was started at 220 rpm and 28 °C. 0.5% methanol was added every 24 h. After 84 h, the supernatant was collected by centrifugation at 10,000 rpm for 5 min. The supernatant was subjected to SDS-PAGE electrophoresis. The electrophoresis pattern was as follows. Figure 6 The specific results are shown in Table 4 and Figure 7 shown.

[0079] The results showed that when the VPS29, BMT3, and SUN4 genes were knocked out, the expression level of lumbrokinase in the recombinant engineered bacteria 2 was used as a control, and the expression level reached 257%.

[0080] Table 4

[0081]

[0082] Example 5 Bioactivity test of lumbrokinase (F238) expressed by recombinant engineering bacteria

[0083] (2) Preparation of fibrin plate: Take 0.25g agarose and add it to 50ml physiological saline. Heat it to dissolve and keep it in a 45℃ water bath for 30min. Then add 1ml of 200 units / ml thrombin and mix well. Take 0.2g fibrinogen and dissolve it in 50ml barbiturate buffer (pH7.8). Keep it in a 45℃ water bath for 5min. Take 5ml thrombin solution and 5ml fibrinogen solution respectively, mix them evenly, then quickly pour them into a glass plate, place it horizontally for 30min, and put it in the refrigerator for use after solidification.

[0084] (2) Take 10 μl of the fermentation broth of the recombinant engineered bacteria 1-7 at 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, and 96 h, and 10 μl of the lumbrokinase standard solution of different concentrations, and spot them on the fibrin plate;

[0085] (3) The plate was placed in a 37°C incubator for 18 hours until a lysis zone appeared. The two vertical diameters of the lysis zone were measured. The logarithm of the number of units of the lumbrokinase standard was used as the horizontal coordinate and the logarithm of the product of the two vertical diameters was used as the vertical coordinate. The regression equation was calculated. The logarithm of the product of the two vertical diameters of the lysis zone obtained by the fermentation broth of the recombinant engineered bacteria 5-7 was substituted into the regression equation to calculate the number of units of its potency. The results are shown in Table 5 and Figure 8 As shown by Figure 8 It can be seen that with the increase of induction time, the enzyme activity of lumbrokinase produced by each recombinant engineered bacteria gradually increased, reaching the highest at 84h, and then slightly decreased. Among them, when the VPS29, BMT3, and SUN4 genes were knocked out, the highest lumbrokinase activity was 769.6U / mL.

[0086] Table 5

[0087] Time (h) 12 24 36 48 60 72 84 96 Recombinant engineering bacteria 5 (U / mL) 162.58 300.96 437.14 551.32 588.5 623.26 645.48 621.28 Recombinant engineering bacteria 6 (U / mL) 168.85 311.3 462.44 576.18 641.52 679.14 701.14 682.22 Recombinant engineering bacteria 7 (U / mL) 191.18 362.56 527.12 665.5 718.74 746.9 769.56 735.68

[0088] The above description is only an embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent substitution, improvement, etc. made within the spirit and principle of the present invention should be included in the scope of the claims of the present invention.

Claims

1. A recombinant engineered bacterium for preparing lumbrokinase, characterized in that: While expressing lumbrokinase F238, the recombinant engineered bacteria also includes the following operations: using CRISPR-Cas9 gene editing technology to target and knock out one or more genes among VPS29, BMT3, and SUN4 genes.

2. The recombinant engineered bacterium according to claim 1, characterized in that The amino acid sequence encoded by the VPS29 gene is shown in SEQ ID NO.2; the amino acid sequence encoded by the BMT3 is shown in SEQ ID NO.4; and the amino acid sequence encoded by the SUN4 gene is shown in SEQ ID NO.

6.

3. The recombinant engineered bacterium according to claim 1, characterized in that The nucleotide sequence of the VPS29 gene is shown in SEQ ID NO.1; the nucleotide sequence of the BMT3 gene is shown in SEQ ID NO.3; and the nucleotide sequence of the SUN4 gene is shown in SEQ ID NO.

5.

4. The recombinant engineered bacterium according to claim 1, characterized in that The recombinant engineered bacteria contains at least one copy of a nucleotide sequence encoding lumbrokinase F238.

5. The recombinant engineered bacterium according to claim 1, characterized in that The recombinant engineered bacteria also include drug resistance gene fragments and / or signal peptide sequences.

6. The recombinant engineered bacterium according to claim 1, characterized in that The recombinant engineered bacteria utilizes CRISPR-Cas9 gene editing technology to target and knock out one or more genes among VPS29, BMT3, and SUN4 genes, including the following steps: S1: Construction of Cas9 and gRNA co-expression plasmid; S2: Preparation of donor DNA; S3: Preparation of competent cells; S4: Construct a strain in which one or more of the VPS29, BMT3, and SUN4 genes are knocked out.

7. The recombinant engineered bacterium according to claim 1, characterized in that The nucleic acid construct of the recombinant engineered bacteria includes any one or more of pHIL-D2, pPIC3.5, pHIL-S1, pPIC9, pPink-LC, pPink-HC, pGAPZA, and pGAPZaA plasmids; the promoter includes any one or more of GAP promoter, TEF1 promoter, PGK1 promoter, and HGT1 promoter.

8. The recombinant engineered bacterium according to claim 1, characterized in that The recombinant engineered bacteria is selected from one or more of Pichia pastoris, Hansenula, Candida, and Saccharomyces cerevisiae.

9. Use of the recombinant engineered bacteria according to any one of claims 1 to 8 in preparing lumbrokinase F238 and / or increasing the expression level of lumbrokinase F238.

10. A method for producing lumbrokinase, characterized in that: The method comprises: preparing lumbrokinase F238 by fermentation using the recombinant engineered bacteria as described in any one of claims 1 to 8.

Images