Application of VISTA gene as primary liver cancer early diagnosis marker

Abstract

The invention provides application of a VISTA gene as a primary liver cancer early diagnosis marker, and belongs to the technical field of biological medicine. The invention finds that proliferation and clone formation of the liver cancer can be effectively inhibited by inhibiting expression of the VISTA gene, and proliferation and clone formation of the liver cancer can be remarkably enhanced by overexpressing the VISTA gene. The BRD4 is an upstream regulatory factor of VISTA, the protein level of VISTA is obviously increased after the BRD4 is over-expressed, and the protein level of VISTA is obviously reduced after the BRD4 is knocked down; the MMP11 is a downstream substrate of the VISTA, the VISTA regulates and controls the MMP11 at the transcriptional level and the protein level, the expression level of the VISTA is over-expressed, the expression level of the MMP11 is obviously increased, and after the VISTA is knocked down, the expression level of the MMP11 is obviously reduced. The BRD4 regulates and controls the mRNA transcription of the MMP11 by regulating and controlling the expression of the VISTA, so that the occurrence of the primary liver cancer is influenced.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to an application of the VISTA gene as an early diagnostic marker for primary liver cancer. Background Art

[0002] Primary liver cancer is the fourth leading cause of cancer death worldwide. Due to the lack of donor livers and tumor heterogeneity, there is currently no cure, so there is an urgent need to study the underlying mechanisms of liver cancer and explore new potential tumor therapeutic targets. VISTA is a new immunotherapy target, but little is known about the non-immune checkpoint function of VISTA in liver cancer. Summary of the invention

[0003] In view of this, the object of the present invention is to provide an application of VISTA gene as an early diagnostic marker for primary liver cancer.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides the use of a reagent for detecting the expression amount of the VISTA gene in preparing a product for early diagnosis / prognosis prediction of primary liver cancer.

[0006] Preferably, the product comprises a chip or a kit.

[0007] The present invention also provides the use of an agent for knocking down VISTA gene expression in the preparation of a drug for treating and / or preventing primary liver cancer.

[0008] The present invention also provides the use of a liver cancer cell line with low VISTA gene expression in the preparation of a drug for treating and / or preventing primary liver cancer.

[0009] The present invention also provides the use of an agent for knocking down the expression of the BRD4 gene in the preparation of a drug for treating and / or preventing primary liver cancer.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The present invention discovered for the first time that the expression of the VISTA gene is upregulated in liver cancer, and the overall survival of liver cancer patients with high expression of the VISTA gene is significantly reduced, suggesting that detecting the expression level of the VISTA gene can become one of the auxiliary diagnostic indicators for liver cancer diagnosis, and that high expression of the VISTA gene has a high accuracy as a diagnostic factor for liver cancer.

[0012] The present invention also found that inhibiting VISTA gene expression can effectively inhibit the proliferation and cloning of liver cancer, and overexpressing VISTA gene can significantly enhance the proliferation and cloning of liver cancer. Therefore, interfering with the expression of VISTA gene can become a new way to prevent or treat liver cancer, providing new ideas for the later development of related drugs and clinical treatment.

[0013] The present invention also found that BRD4 is an upstream regulatory factor of VISTA. After overexpression of BRD4, the VISTA protein level is significantly increased, and after knocking down BRD4, the VISTA protein level is significantly reduced; MMP11 is a downstream substrate of VISTA. VISTA regulates MMP11 at the transcriptional level and protein level. After overexpression of VISTA, the expression level of MMP11 is significantly increased, and after knocking down VISTA, the expression level of MMP11 is significantly reduced. BRD4 regulates the mRNA transcription of MMP11 by regulating the expression of VISTA, thereby affecting the occurrence and development of primary liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the VISTA protein level result map of the tumor site of liver cancer patients in the TCGA database;

[0015] Figure 2 This is the result graph of VISTA mRNA level in tumor sites of liver cancer patients in the TCGA database;

[0016] Figure 3 This is the protein level result graph of VISTA in human clinical liver cancer samples;

[0017] Figure 4 This is the result graph of VISTA mRNA levels in human clinical liver cancer samples;

[0018] Figure 5 This is the result of using immunochemical staining technology to detect the expression level of VISTA in human liver cancer tissue samples;

[0019] Figure 6 The VISTA immunohistochemical staining was performed on the tumor tissue of liver cancer patients, and the scores were made according to the area and intensity of the staining particles, and the results were analyzed jointly with the patient's survival period;

[0020] Figure 7 This is a picture of the results of a protein immunoblot experiment using PLVX-shRNA-VISTA to construct a human liver cancer cell line PLC-5 and Huh7 that stably knocked down VISTA protein;

[0021] Figure 8This is a picture of the results of a protein immunoblotting experiment using pLVX-EF1a-IRES-Puro-VISTA to construct human liver cancer cell lines PLC-5 and Huh7 that stably overexpress VISTA protein;

[0022] Fig. 9 This is the result of knocking down VISTA and the proliferation ability of the human liver cancer cell line PLC-5;

[0023] Fig.10 This is the result of the proliferation ability of human liver cancer cell Huh7 after knocking down VISTA;

[0024] Fig.11 This is the result of the proliferation ability of human liver cancer cell PLC-5 after overexpression of VISTA;

[0025] Fig.12 This is the result of the proliferation ability of human liver cancer cell Huh7 after overexpression of VISTA;

[0026] Fig.13 This is a graph showing the results of clone formation ability after knocking down VISTA and overexpressing VISTA in human liver cancer cell lines PLC-5 and Huh7;

[0027] Fig.14 This is the result of EDU experiment to detect the cell proliferation ability after overexpression of VISTA gene and knockdown of VISTA gene;

[0028] Fig.15 The protein and mRNA levels of VISTA in two liver cancer cell lines, PLC-5 and Huh7, stimulated by JQ1 for different time periods;

[0029] Fig.16 Different concentrations of JQ1 stimulated the protein and mRNA levels of VISTA in two liver cancer cell lines, PLC-5 and Huh7;

[0030] Fig.17 The protein and mRNA levels of VISTA in two liver cancer cell lines, PLC-5 and Huh7, after knocking down BRD4;

[0031] Fig.18 is the mRNA level of VISTA in two liver cancer cell lines, PLC-5 and Huh7, after overexpression of BRD4;

[0032] Fig.19 This is the result of immunofluorescence analysis of cells after overexpression of BRD4;

[0033] Fig. 20 is the protein level of VISTA after overexpression of BRD4-BD1 and BRD4-BD2;

[0034] Fig.21 This is a chromatin immunoprecipitation experiment result diagram verifying that BRD4 binds to the promoter of the VISTA gene;

[0035] Fig. 22 This is the protein expression level result diagram of MMP11 in the tumor site of liver cancer patients in the TCGA database;

[0036] Fig.23 This is the result of the correlation analysis between VISTA and MMP11 expression in liver cancer samples from the TCGA database;

[0037] Fig.24 This is the result of immunofluorescence experiment of co-localization of VISTA and MMP11;

[0038] Fig.25 is the protein level and mRNA level of MMP11 after knockdown of VISTA;

[0039] Fig.26 is the protein level and mRNA level of MMP11 after overexpression of VISTA;

[0040] Fig. 27 This is the result of the cell immunofluorescence experiment after overexpressing VISTA;

[0041] Fig.28 is the protein expression levels of VISTA and MMP11 in two liver cancer cell lines after knockdown of BRD4;

[0042] Fig.29 is the protein expression levels of VISTA and MMP11 in two liver cancer cell lines after overexpression of BRD4;

[0043] Fig.30 This is the result of detecting the protein level of MMP11 after overexpressing BRD4 in two liver cancer cell lines, PLC-5 and Huh7, in which VISTA was stably knocked down;

[0044] Fig.31 This is a graph showing the results of a chromatin immunoprecipitation experiment to verify that VISTA binds to the promoter of the MMP11 gene. DETAILED DESCRIPTION

[0045] The present invention provides the use of a reagent for detecting the expression amount of the VISTA gene in the preparation of a product for early diagnosis / prognosis prediction of primary liver cancer. In the present invention, the product includes a chip or a kit.

[0046] The present invention also provides the use of an agent for knocking down VISTA gene expression in the preparation of a drug for treating and / or preventing primary liver cancer.

[0047] The present invention also provides the use of a liver cancer cell line with low VISTA gene expression in the preparation of a drug for treating and / or preventing primary liver cancer.

[0048] The present invention also provides the use of an agent for knocking down the expression of the BRD4 gene in the preparation of a drug for treating and / or preventing primary liver cancer.

[0049] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0050] Example 1

[0051] Verification of VISTA expression level in liver cancer tissues

[0052] 1. Statistical analysis of TCGA database data revealed that the VISTA protein level in patients with liver cancer ( Figure 1 ) and mRNA levels ( Figure 2 ) were significantly highly expressed.

[0053] Second, we conducted a protein imprinting experiment on liver tissues adjacent to the cancer and in the cancerous area, and found that the protein level of VISTA in the liver cancer area ( Figure 3 ) and mRNA levels ( Figure 4 ) were significantly increased.

[0054] 3. Immunohistochemical staining of cancer tissue and adjacent tissue chips of 90 pairs of liver cancer patients was performed. The specific steps are as follows:

[0055] 1. Dewaxing and rehydrating: Place the slices in a 62°C oven for 1 hour, then dewax in environmentally friendly dewaxing solutions 1 and 2 for 10 minutes, then rehydrate in 100% ethanol, 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol, and double distilled water for 3 minutes respectively;

[0056] 2. Antigen repair: Place the sections in an antigen repair solution containing 1 mM EDTA and 0.05% Tween and heat to 95°C for 20 minutes, then take them out and let them cool to room temperature. Then wash them in PBS solution 3 times, 3 minutes each time.

[0057] 3. Quench endogenous peroxidase: Place the slices in 3% hydrogen peroxide solution for 10 minutes, then wash with PBS three times, 3 minutes each time;

[0058] 4. Blocking: Use 3% bovine serum albumin solution (BSA, prepared with PBS solution) for blocking for 10 minutes;

[0059] 5. Incubate with primary antibody: remove the blocking solution on the slide, add 100 μL VISTA primary antibody (1:100) and BRD4 primary antibody (1:100) on the sliced ​​tissue, and incubate in a humidified box at 4°C overnight;

[0060] 6. Incubate with secondary antibody: Rewarm at room temperature for 15 minutes, then wash with PBS 3 times, 3 minutes each time. Then add horseradish peroxidase-labeled secondary antibody (Proteintech, ready-to-use HRP-labeled goat anti-mouse / rabbit secondary antibody), incubate at room temperature for 30 minutes, and wash with PBS solution 3 times, 3 minutes each time;

[0061] 7. DAB staining: Use DAB color developing solution for color development, the staining time is about 3 minutes (the staining time is determined according to the specific staining degree);

[0062] 8. Hematoxylin staining: Place the cells in hematoxylin solution for 5 minutes to stain the nuclei (the specific staining time depends on the specific staining degree), stop staining in tap water, then differentiate in 1% hydrochloric acid ethanol solution (75% ethanol, volume ratio) for 3 seconds, and turn blue in tap water for about 1 hour;

[0063] 9. Dehydration, transparency, and sealing with neutral resin sealing agent: Dehydrate in 50% ethanol, 75% ethanol, 85% ethanol, 95% ethanol, and 100% ethanol for 3 minutes, then use dewaxing solution 1 and 2 to make it transparent for 10 minutes, take out, wipe dry, and seal with neutral resin sealing agent;

[0064] 10. Take pictures under a microscope, then perform statistical scoring and conduct VISTA-related survival rate analysis based on the scores and patient information of the tissue source.

[0065] Experimental results: VISTA was found to be highly expressed in human liver cancer tissue samples ( Figure 5 ) and is negatively correlated with patient prognosis ( Figure 6 ).

[0066] Example 2

[0067] Construction and expression verification of VISTA gene overexpression and knockdown recombinant lentiviral vector

[0068] 1. Construction of recombinant lentiviral vector for overexpression of VISTA gene

[0069] 1. Design PCR primers: Find the human full-length coding sequence of VISTA in NCBI, use Primer 5 software to design relevant primers, select pLVX-EF1a-IRES-Puro (P0405, Miaoling plasmid) as the vector, add FLAG tag protein sequence to the primer according to the VISTA sequence and vector restriction site, and design appropriate PCR primers. The primer sequence is:

[0070] VISTA-EcoRI-forward:

[0071] CGGAATTCATGGGAGACTACAAGGACGATGATGACAAGATGGGCGTCCCCA(SEQ ID NO:1)

[0072] VISTA-Xba I-reverse:CTAGTCTAGACTAGATGACCTCAAAGTTTGGAGA(SEQ ID NO:2)

[0073] 2. Amplify the VISTA fragment: Use the cDNA obtained by reverse transcription of total RNA from human liver cancer cell PLC-5 as a template to amplify the VISTA fragment by PCR.

[0074] The PCR amplification system (50 μl system) is as follows:

[0075] High-fidelity DNA polymerase 1 μl

[0076] 5×SF buffer 10μl

[0077] Primer mix (10 μM) 4 μl

[0078] cDNA 2 μl

[0079] dNTP (10uM) 1μl

[0080] dH 2 O 32 μl

[0081] PCR reaction, the procedure is as follows:

[0082] (1) Pre-denaturation at 95°C for 3 min

[0083] (2) Denaturation at 95°C for 30 seconds

[0084] (3) Annealing at 60°C for 20 seconds

[0085] (4) Extension at 72°C for 30 seconds

[0086] Steps (2) to (4) were repeated for 35 cycles.

[0087] Continue extension: 72℃ for 10min.

[0088] 3. Identification and gel recovery: The PCR product was subjected to agarose gel electrophoresis to recover the target band. This step used an agarose gel recovery kit (TIANgen) for gel recovery. For detailed steps, refer to the kit manual.

[0089] 4. Enzyme digestion and enzyme ligation: Use restriction endonucleases EcoR I and Xba I to perform double enzyme digestion on the PCR product recovered from the gel and the lentiviral vector pLVX-EF1a-IRES-Puro at 37°C. The enzyme digestion system is as follows:

[0090] PCR product digestion system:

[0091] EcoR I, Xba I 1 μl each

[0092] 2×Tango buffer 4μl

[0093] 14 μl of PCR product was recovered from gel.

[0094] Lentiviral vector restriction enzyme digestion system:

[0095] EcoR I, Xba I 1 μl each

[0096] 2×Tango buffer 4μl

[0097] Lentiviral vector: 1 μg

[0098] Make up to 20 μl with double distilled water and digest at 37℃ overnight.

[0099] The double-enzyme digestion products were purified using a universal DNA purification kit (TIANgen).

[0100] The purified product was subjected to enzyme ligation.

[0101] Enzyme-linked system (20 μl):

[0102] 5 μl of purified lentiviral vector product

[0103] PCR fragment purification product 12μl

[0104] T4 ligase 1 μl

[0105] T4 ligase buffer (10×) 2 μl;

[0106] Incubate the enzyme overnight at 16°C.

[0107] 5. Conversion

[0108] (1) Add 20 μl of the ligation product and 30 μl of competent cells to a clean, sterile centrifuge tube, pipette gently to mix, and place on ice for 30 min.

[0109] (2) After the above steps are completed, the centrifuge tube containing the target product after the above treatment is placed in a 42°C water bath for heat shock for 90 seconds, and then placed on ice for 5 minutes.

[0110] (3) Add 500 μl of LB liquid culture medium without antibiotics to the above centrifuge tube and culture at 37°C and 200 rpm for 60 min.

[0111] (4) Centrifuge at 3000 rpm for 5 min, retaining a small amount of supernatant to mix the bacteria.

[0112] (5) Add the above bacterial solution evenly onto the LB plate, spread it evenly with a sterile spreading rod, and incubate it upside down at 37°C for about 14 hours (the duration can be appropriately extended depending on the growth of the colony).

[0113] 6. Identification: After the plate is recovered, about 50-100 colonies can be seen. Use a 10μl pipette tip to pick up a single growing colony and put it into 10μl sterile water. Gently blow and use it as a PCR template for colony PCR identification.

[0114] The PCR system is:

[0115] DNA polymerase Taq 1 μl

[0116] 10×Taq buffer 2μl

[0117] Primer mix (10 μM) 2 μl

[0118] Bacterial liquid template 4μl

[0119] dNTP (10 μM) 1 μl

[0120] dH 2 Make up to 20 μl with 0.1% HO.

[0121] Agarose gel electrophoresis was performed, and the target bacterial solution with a positive PCR result was added to 8 ml of liquid LB medium containing antibiotics, and cultured at 37°C and 200 rpm for about 16 hours, and then plasmid extraction was performed using a plasmid mini-extraction kit (TIANGEN Company).

[0122] The target plasmid was identified by agarose gel electrophoresis after PCR.

[0123] The PCR system is:

[0124] DNA polymerase Taq 1 μl

[0125] 10×Taq buffer 2μl

[0126] Primer (10 μM) 1 μl each

[0127] Plasmid 100ng

[0128] dNTP (10 μM) 1 μl

[0129] dH 2 Make up to 20 μl with 0.1% HO.

[0130] The plasmids with positive PCR results were sequenced (Qingke Biotechnology Co., Ltd.) to ensure that the target fragment of the constructed pLVX-EF1a-IRES-Puro-VISTA plasmid had no mutations and the sequence was completely correct.

[0131] 2. Acquisition of VISTA knockdown recombinant lentiviral vector: PLVX-shRNA-VISTA was purchased from Ubest Biotech

[0132] Stable cell line construction:

[0133] 1. Cell preparation: 293T cells were cultured in DMEM medium containing 10% fetal bovine serum and passaged;

[0134] 2. Cell plating: 293T cells with good growth status are plated in a 10 cm culture dish at a density of 60%-70%;

[0135] 3. Transfection: 12 hours after plating, replace the culture medium with serum-free medium.

[0136] 3. Transfection system:

[0137] 1. VISTA gene overexpression recombinant lentiviral vector pLVX-EF1a-IRES-Puro-VISTA transfection system:

[0138] 200 μl serum-free medium

[0139] pLVX-EF1a-IRES-Puro-VISTA plasmid 12 μg

[0140] VSVG packaging plasmid 9 μg

[0141] DR packaging plasmid 6 μg

[0142] Lipo 8000 transfection reagent 54 μl

[0143] 2. VISTA knockdown recombinant lentiviral vector PLVX-shRNA-VISTA system:

[0144] 200 μl serum-free medium

[0145] PLVX-shRNA-VISTA plasmid 12 μg

[0146] VSVG packaging plasmid 9 μg

[0147] DR packaging plasmid 6 μg

[0148] Lipo 8000 transfection reagent 54 μl

[0149] After gently pipetting to mix, gently add dropwise to the 293T cell culture dish and continue to culture cells under normal conditions.

[0150] 4. Lentivirus Packaging

[0151] 6-8h after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum and culture was continued. During the culture period, the color change of the culture medium should be closely monitored and an appropriate amount of culture medium should be added in time to keep the pH value of the culture medium at a normal level. 72h after transfection, the culture supernatant was filtered and collected with a 4.5μm diameter sterile filter to obtain the lentiviral supernatant containing pLVX-EF1a-IRES-Puro-VISTA and PLVX-shRNA-VISTA.

[0152] 5. Lentivirus infection and screening

[0153] Human liver cancer cells Plc-5 and Huh7 (purchased from the ATCC cell bank in the United States) were cultured in DMEM medium containing 10% fetal bovine serum. Cells with good growth conditions were plated in 6 cm cell culture dishes at a density of 60%-70%. After 12 hours of cell adhesion, 3 ml of lentivirus suspension was added, and polybrene (final concentration of 10 μg / ml was added to greatly enhance the infection efficiency). After 48 hours of infection, the culture medium was replaced with 10% DMEM medium containing puromycin (final concentration of 1 μg / ml) for screening. Human liver cancer cells that were not infected with lentiviruses would be killed. After 72 hours of screening, the surviving cells were stably transfected cell lines infected with pLVX-EF1a-IRES-Puro-VISTA and PLVX-shRNA-VISTA.

[0154] VI. Western blotting experiments on stable cell lines:

[0155] 1. Collect cells and extract proteins: Trypsinize the stable cells cultured in a 6cm culture dish, wash with PBS, collect the centrifuged precipitates in a 1.5ml centrifuge tube, add 400μl RIPA solution and 1mM PMSF to the cell precipitate and lyse the cells at 4℃ for 30 minutes. Centrifuge at 4℃ and 12000rpm for 10 minutes, take out 1μl supernatant, and perform BCA quantification on the protein sample. Add 6×protein loading buffer according to the volume of the supernatant, mix well, and boil at 95℃ in a metal bath for 15 minutes. After cooling, aliquot and store the samples at -80℃.

[0156] 2. SDS-PAGE gel electrophoresis

[0157] (1) Prepare 10% SDS-PAGE gel separation gel.

[0158] Separation gel formula:

[0159] 4ml ultrapure water

[0160] 3.3 ml 30% acrylamide

[0161] 2.5ml 1.5M Tris-HCL (pH 8.8)

[0162] 100 μl 10% SDS

[0163] 100 μl 10% ammonium persulfate

[0164] 4 μl TEMED separation gel

[0165] After the separation gel solidifies, add the stacking gel and gently insert the comb into the stacking gel. Formula:

[0166] 2.1 ml ultrapure water

[0167] 0.5 ml 30% acrylamide

[0168] 0.38ml 1.0M Tris-HCL (pH 6.8)

[0169] 30 μl 10% SDS

[0170] 30 μl 10% ammonium persulfate

[0171] 3 μl TEMED

[0172] After the stacking gel solidifies, gently remove the comb, load it into the electrophoresis tank, use electrophoresis buffer for electrophoresis, add protein samples and protein standard molecular weight markers to different lanes of the gel, use 1×protein loading buffer to fill the protein samples, and perform electrophoresis at a constant voltage of 80V. After the sample electrophoresis exceeds the stacking gel, switch to 120V constant voltage electrophoresis, and stop electrophoresis when bromophenol blue electrophoresis reaches the bottom of the gel.

[0173] (2) Transfer: Place the transfer sponge pad (no filter paper required), gel, PVDF membrane (methanol activation required), and transfer sponge pad (no filter paper required) in the transfer clip from the negative electrode to the positive electrode, and remove all bubbles between the gel and PVDF membrane. Use transfer solution to transfer the membrane in the transfer tank. Transfer the membrane on ice at a constant voltage of 80V and a time determined by the molecular weight (1min / kDa).

[0174] (3) Blocking: Use 5% skim milk (prepared in PBST solution) and shake slowly on a shaker for 60 minutes at room temperature for blocking.

[0175] (4) Incubation of primary and secondary antibodies: Prepare primary antibody diluent with the following formula:

[0176] Fetal bovine serum: 3g

[0177] 10% sodium azide: 200 μl

[0178] Add PBST to 100 ml.

[0179] Dilute the primary antibody to the working concentration at 1:1000 with the primary antibody diluent, place the target band in the diluted primary antibody and incubate in a 4°C refrigerator for 16 hours. After the incubation, recover the primary antibody and wash it three times with PBST solution on a shaker, each time for 5 minutes. Add the secondary antibody (1:5000) diluted with 5% skim milk, incubate in a 4°C refrigerator for 1 hour, recover the secondary antibody after the incubation, and wash it three times with PBST solution on a shaker.

[0180] (5) Color development: Mix western Lumaxl Light Peroxide A and B in a 1:1 ratio to form a working solution. Apply the working solution to the target strip, place it on an exposure instrument for color development, and save the image.

[0181] Experimental results: It can be seen that after PLVX-shRNA-VISTA infection, the expression of VISTA protein in human liver cancer cells was significantly reduced ( Figure 7 ), after infection with pLVX-EF1a-IRES-Puro-VISTA, the expression of VISTA protein in human liver cancer cells was significantly increased ( Figure 8 ).

[0182] Example 3

[0183] Verify the effect of VISTA on proliferation ability in stable cell lines

[0184] 1. Cell proliferation detection

[0185] The cells of the stable cell lines with good growth conditions were plated in 96-well plates at a number of 1000 per well, and three replicate control groups were set up. The plated cells were Plc-5 and Huh7 cells overexpressing pLVX-EF1a-IRES-Puro-VISTA, knocking down PLVX-shRNA-VISTA and pLVX-EF1a-IRES-Puro. The proliferation ability of the Plc-5 and Huh7 stable cell lines was detected using a CCK kit (Biyuntian). The culture medium was replaced every 24 hours, and CCK8 was added according to the instructions of the kit and the culture was continued for 2 hours. The absorbance was detected at λ = 450nm using an ELISA reader, and the data were collected and statistically analyzed.

[0186] Experimental results: It can be seen that the proliferation of human liver cancer cells was inhibited after knocking down VISTA ( Fig. 9 and Fig.10 ), after overexpression of VISTA, the proliferation ability of human liver cancer cells was enhanced, ( Fig.11 and Fig.12 ).

[0187] 2. Clone Formation Experiment

[0188] Different stable transfected cells were plated and cultured in six-well plates in the same number of 400-800 cells. The plated cells were Plc-5 and Huh7 cells overexpressing pLVX-EF1a-IRES-Puro-VISTA, knocking down PLVX-shRNA-VISTA, and pLVX-EF1a-IRES-Puro (empty), and the culture medium was changed once every 2-3 days. After about two weeks, 4% paraformaldehyde was used for fixation for 30 minutes, and 0.05% crystal violet was used for staining for 20 minutes. The stained six-well plates were washed with double distilled water, dried, observed and photographed, and the results were analyzed.

[0189] Experimental results: It can be seen that after overexpression of VISTA, the proliferation ability of human liver cancer cells is enhanced, and after knocking down VISTA, the proliferation ability of human liver cancer cells is weakened ( Fig.13 ).

[0190] 3. EdU detection of cell proliferation

[0191] (1) Cell preparation: Place a lysine-coated disc at the bottom of a 6-well culture plate and sterilize it with ultraviolet light for 30 minutes. Take the logarithmic growth phase human liver cancer cell lines PLC-5 and Huh7, digest them with trypsin, centrifuge, discard the supernatant, resuspend the cells in culture medium, and blow the cells to a single cell suspension. 2×10 cells per well. 5 The cells were inoculated into a 6-well culture plate so that the cells were evenly attached to the small disc.

[0192] (2) EDU labeling: First, dilute the EDU solution with cell culture medium at a ratio of 1000:1 to prepare an appropriate amount of 50 μM EDU. Add 100 μL of 50 μM EDU to each well, incubate for 2 h, then remove the culture medium and wash the cells twice with PBS, each time for 5 min.

[0193] (3) Cell fixation: 50 μl of 4% paraformaldehyde fixative was added to each well and fixed at room temperature for 30 min. After discarding the fixative, 50 μl of 2 mg / ml glycine was added to each well. After incubation on a decolorizing shaker for 5 min, the cells were washed with PBS three times, each time for 5 min.

[0194] (4) Apollo staining: Add 100 mL of 1×Apollo@ staining reaction solution to each well at room temperature and in the dark, incubate on a decolorizing shaker for 30 min, then discard the staining reaction solution. Add 100 μl of 0.5% TritonX-100 in PBS, and wash 2-3 times on a decolorizing shaker for 10 min each time.

[0195] (5) DNA staining: At room temperature and in the dark, first dilute the reagent Hoechst 33342 at a ratio of 100:1 to prepare an appropriate amount of 1×Hoechst 33342 reaction solution. Add 100 μl of 1×Hoechst 33342 reaction solution to each well, incubate on a decolorizing shaker for 30 min, then discard the staining reaction solution and add 100 μl of PBS to each well for 1-3 washes.

[0196] (6) Image acquisition and analysis: Immediately after staining, images were acquired using a confocal fluorescence microscope.

[0197] Experimental results: Compared with the control group, the proliferation ability of human liver cancer cells was enhanced after overexpression of VISTA, and the proliferation ability of human liver cancer cell lines was significantly weakened after knocking down VISTA ( Fig.14 ).

[0198] Example 4

[0199] Upstream regulators of VISTA

[0200] The results of RNA-seq omics analysis of VISTA and BRD4 showed that the RNA level of VISTA increased after overexpression of BRD4. The RNA level of VISTA decreased significantly after treatment with JQ1 (an inhibitor of BET family proteins BRD2, BRD3, and BRD4), which prompted us to conduct more in-depth research on VISTA.

[0201] 1. Treat human liver cancer cells PLC-5 and Huh7 with the BET protein family inhibitor JQ1, extract the RNA of the treated cells for reverse transcription, and verify the mRNA level of VISTA by fluorescence quantitative PCR. The specific steps are as follows:

[0202] 1. Cell plating: Human hepatoma cell lines PLC-5 and Huh7 were plated on six-well plates after cell subculture.

[0203] 2. Inhibition of BET protein function: 12 hours after cell plating, the culture medium was replaced with DMEM medium containing 0.5% fetal bovine serum for starvation. After 24 hours, JQ1 was used for treatment with a time gradient (0h, 6h, 12h, 24h) and a concentration gradient (0μM, 0.01μM, 0.1μM, 1μM).

[0204] 3. Extract total cell RNA using the trizol method. The specific steps are as follows:

[0205] (1) Wash the cells to be tested in the 6-well plate with PBS solution, add 1 ml of cell RNA lysis solution (Trizol), pipette repeatedly, and collect the cells in a 1.5 ml enzyme-free sterile centrifuge tube.

[0206] (2) Add 200 μl of chloroform and shake to mix.

[0207] (3) Centrifuge at 12,000 rpm for 10 min in a 4°C centrifuge.

[0208] (4) Aspirate the supernatant, preferably less rather than more, and try to avoid aspirating other layered precipitates. Transfer it to another 1.5 ml sterile, enzyme-free centrifuge tube, add an equal volume of isopropanol, and mix thoroughly.

[0209] (5) Centrifuge at 12000 rpm for 10 min. A small amount of white precipitate will be seen at the bottom of the tube. Carefully discard the supernatant.

[0210] (6) Wash the white precipitate with 1 ml of 75% ethanol. Centrifuge at 4°C, 12,000 rpm for 10 min, discard the supernatant and keep the precipitate.

[0211] (7) Dry the tube wall and the white precipitate at room temperature until it becomes translucent, add an appropriate amount of DEPC water to dissolve it, and measure the RNA concentration.

[0212] 4. Reverse transcription:

[0213] Prepare 20 μl reverse transcription system:

[0214] mRNA 1 μg

[0215] 5×qRT SuperMix (Novozymes) 4 μl

[0216] Make up to 20 μl with DEPC water.

[0217] PCR instrument for reverse transcription, reaction procedure:

[0218] 50℃15min

[0219] 85℃5s

[0220] Obtain the reverse transcription product cDNA.

[0221] 5. Fluorescence quantitative PCR:

[0222] The sequences of the QPCR primers for GAPDH and VISTA are:

[0223] GAPDH-homo-F:CATGTTCGTCATGGGTGTGAACCA(SEQ ID NO:3)

[0224] GAPDH-homo-R: ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO: 4)

[0225] VISTA-homo-F:ACCGCCGTATTCCCTGTATGTC(SEQ ID NO:5)

[0226] VISTA-homo-R:TTGTAGAAGGTCACATCGTGC(SEQ ID NO:6)

[0227] Prepare 10 μl fluorescent quantitative PCR reaction system in a 96-well plate:

[0228] Primers: 0.5 μl each for forward and reverse primers

[0229] cDNA: 1 μl

[0230] DEPC water 3μl

[0231] 2xchamQ SYBR qPCR Master Mix (Novozyme) 5μl

[0232] Fluorescence quantitative PCR was performed on a QS6P QPCR instrument. The reaction procedure was as follows:

[0233] (1) 95℃ for 3 min

[0234] (2) 95℃20s

[0235] (3) 60℃ 20s

[0236] (4) 72℃20s

[0237] Steps (2) to (4) were cycled 40 times. A reasonable threshold was set, fluorescence signals were collected, and CT values ​​were obtained during the exponential amplification phase.

[0238] Experimental results: Through analysis, it can be concluded that with the increase of JQ1 stimulation time and concentration, the mRNA levels of VISTA in both liver cancer cell lines decreased significantly ( Fig.15 Below and Fig.16 ).

[0239] Second, the function of BET proteins (BRD2, BRD3, BRD4) was inhibited by JQ1, cellular proteins were extracted, and the VISTA protein level was verified by protein immunoblotting experiments.

[0240] 1. Cell plating: After cell subculture, the well-growing human liver cancer cell lines PLC-5 and Huh7 were plated on six-well plates and cultured.

[0241] 2. Inhibition of BET protein function: 12 hours after cell plating, the culture medium was replaced with DMEM medium containing 0.5% fetal bovine serum for starvation. After 24 hours, JQ1 was added and treated with a time gradient (0h, 12h, 24h, 48h) and concentration gradient (0μM, 0.01μM, 0.1μM, 1μM).

[0242] 3. Extract cell proteins for protein immunoblotting experiment (the specific experimental process has been described in detail before).

[0243] Experimental results: With the increase of JQ1 treatment time and concentration, the protein level of VISTA in the two liver cancer cell lines decreased significantly ( Fig.15 Above and Fig.16 ).

[0244] Third, by knocking down the expression of specific BET proteins (BRD2, BRD3, BRD4), cellular proteins were extracted and the VISTA protein levels were verified by western blotting experiments.

[0245] 1. Cell plating: After subculturing, the well-growing human liver cancer cell lines PLC-5 and Huh7 were plated on a six-well plate at a density of 50% and cultured.

[0246] 2. Plasmid transfection: After the cells have been plated for 12 hours and attached to the wall, replace the culture medium with new DMEM containing 10% fetal bovine serum and perform plasmid transfection.

[0247] The shRNA plasmids of BRD2, BRD3, and BRD4 were purchased from Qingke Biotechnology.

[0248] The plasmid functional sequence is:

[0249] BRD2-shRNA: CCGGGCTGCTGATGTACGGCTTATGCTCGAGCATAAGCCGTACATCAGCAGCTTTTTT (SEQ ID NO: 7)

[0250] BRD3-shRNA: CCGGGGGAGATGCTATCCAAGAAGCCTCGAGGCTTCTTGGATAGCATCTCCCTTTTTT (SEQ ID NO: 8)

[0251] BRD4-shRNA: CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTT (SEQ ID NO: 9).

[0252] Prepare the transfection system:

[0253] shRNA plasmid: 2 μg

[0254] Lipo8000 transfection reagent: 4 μl

[0255] Serum-free medium: 100 μl.

[0256] Transfection conditions refer to the lipo8000 instruction manual (Biyuntian)

[0257] Cell proteins were extracted 72 h after transfection and subjected to western blotting.

[0258] Experimental results: Only after knocking down BRD4, the protein levels of VISTA in the two liver cancer cell lines ( Fig.17 ) and mRNA levels ( Fig.17 This indicates that the upstream protein member of the BET protein family that mainly regulates VISTA is BRD4. After exogenous overexpression of BRD4, the mRNA level of VISTA in PLC-5 and Huh7 cell lines increased significantly ( Fig.18 ).

[0259] IV. Immunofluorescence analysis of cells after overexpression of BRD4

[0260] 1. Cell preparation: Place the lysine-coated small discs at the bottom of a 24-well culture plate in advance and sterilize them by ultraviolet irradiation for 30 minutes. Take logarithmically growing human hepatoma cells stably transfected with Plc-5 and Huh7, digest them with trypsin, centrifuge, discard the supernatant, resuspend the cells with culture medium, and blow the cells to a single cell suspension, with 5×10 cells per well. 4 The cells were seeded in a 24-well culture plate so that the cells were evenly attached to the small disc.

[0261] 2. Transfection: ov-flag-BRD4 plasmid purchased from Qingke Biotechnology, transfected with 0.5 μg plasmid 24 hours later (the specific experimental steps have been described in detail before), removed the culture medium and washed twice with PBS. Be careful not to wash off the cells.

[0262] 3. Fixation: Fix the cells with 500 μl of paraformaldehyde for 15 min, discard the culture medium, add 500 μl of PBS and wash with slow shaking on a shaker for 5 min, for a total of 3 times.

[0263] 4. Penetration: Add 500 μl of 0.5% TritonX-100 in PBS, let stand for 10 min, discard the liquid, add 500 μl of PBS and shake slowly on a shaker for 5 min, for a total of 3 times.

[0264] 5. Add 3% BSA and incubate at room temperature for 1 hour to block non-specific proteins.

[0265] 6. Aspirate BSA, add primary antibody (DAPI, BRD4, VISTA diluted 1:100), and incubate at 4°C for 16 hours.

[0266] 7. Recover the primary antibody, wash 3 times with PBS, add fluorescent secondary antibody with corresponding excitation wavelength, dilute the secondary antibody with PBS according to the instructions, and incubate at 4℃ in dark for 2 hours.

[0267] 8. Add 500ul PBS and shake slowly on a shaker for 5 minutes to wash, for a total of 3 times.

[0268] 9. Transfer the small disc to a glass slide, fix it with neutral resin, and take pictures and analyze it under a laser confocal fluorescence microscope.

[0269] The experimental results showed that when BRD4 was overexpressed, the protein level of VISTA was also significantly increased and BRD4 and VISTA had common nuclear localization ( Fig.19 ).

[0270] 5. Next, we will clarify which of the two BRD4 protein domains, BD1 and BD2, plays a major role in VISTA regulation. This experiment will construct GFP-BRD4-BD1 and GFP-BRD4-BD2 overexpression plasmids, and competitively inhibit the BRD4 target domain through transfection.

[0271] Construct BD1 and BD2 overexpression plasmids with GFP tags on pcDNA3.0 (the specific construction steps have been described in detail before)

[0272] Primer sequences:

[0273] BRD4-BD1-BamHI-F:CGGGATCCAGGCAGACCAACCAACTGC(SEQ ID NO:10)

[0274] BRD4-BD1-xbal-R:GCTCTAGATTGCAAGAAGAGCTTTCCAG (SEQ ID NO:11)

[0275] BRD4-BD2-BamHI-F:CGGGATCCAAGGTCTCGGAGCAGCTCAAG (SEQ ID NO: 12)

[0276] BRD4-BD2-xbaI-R:GCTCTAGAAGGCTCGTCCGGCATCTTG (SEQ ID NO: 13)

[0277] After successful construction, amplify the plasmid.

[0278] 3 μg of each plasmid was transfected (the specific experimental steps have been described in detail before).

[0279] 24-48h after transfection, extract cell proteins and perform protein immunoblotting experiment (the specific experimental steps have been described in detail before).

[0280] Experimental results: After overexpression of BRD4-BD1, the protein level of VISTA was significantly reduced ( Fig. 20 ), suggesting that domain BD1 in BRD4 is most important for the regulation of VISTA.

[0281] 6. Through chromatin immunoprecipitation experiments, we further verified that BRD4 binds to the promoter of the VISTA gene and regulates the transcription of VISTA. The specific steps are as follows:

[0282] 1. Cross-linking and cell harvesting

[0283] (1) The cells were subcultured and plated in 10 cm cell culture dishes and divided into three groups: control group, BRD4 overexpression group, and JQ1 treatment group. Formaldehyde was added to the cells to be treated according to the volume of the culture medium at a final concentration of 1%, and the cells were shaken slowly on a shaker at room temperature for 10 minutes to allow cross-linking between DNA and protein.

[0284] (2) Add glycine solution with a final concentration of 125 mM according to the volume of the culture medium and shake slowly on a shaker at room temperature for 5 minutes to terminate the cross-linking reaction.

[0285] (3) Wash the cells twice with 10 ml of pre-cooled PBS.

[0286] (4) Add 1 ml of solution A, scrape the cells, collect them in a 1.5 ml centrifuge tube, centrifuge at 4000 rpm, 4°C for 5 minutes, discard the supernatant, and keep the precipitate; the composition and preparation method of solution A are shown in Table 1.

[0287] Table 1 Ingredients and preparation method of solution A

[0288]

[0289] 2. Ultrasonic fragmentation

[0290] (1) Add 600 μl solution C (add protease inhibitors before use), resuspend the cells, and vortex to lyse the cells. B. After ultrasound, run DNA gel to check the fragment size (DNA gel concentration is suitable at about 1.5%), and the fragment size of 200-1000 bp is optimal; the composition and preparation method of the solution C are shown in Table 2.

[0291] Table 2 Composition and preparation method of solution C

[0292]

[0293] (2) Centrifuge at 12000 rpm, 4°C for 15 minutes. Take the supernatant and discard the precipitate.

[0294] 3. Preclear samples

[0295] (1) Add 50 μl of protein A / G beads and protamine (final concentration 200 μg / ml. The stock solution is 10 mg / ml) to 500 μl of supernatant and mix with ddHO. 2 O preparation) and incubated with rotation at 4°C for 2 h.

[0296] (2) Centrifuge at 12000 rpm and 4°C for 15 min. Take the supernatant and discard the precipitate.

[0297] (3) Take out 20 μl of the supernatant as input.

[0298] 4. Combination

[0299] Take 200 μl of supernatant, add 4 μl of primary antibody, 8 μl of protein A / G beads, protamine (final concentration 200 μg / ml) and BSA (final concentration 1 mg / ml), and make up the total volume to 300 μL with Chip1 solution. Incubate at 4℃ with rotation overnight or for 6 hours. Freeze the remaining supernatant at -80℃ for later use.

[0300] 5. Cleaning

[0301] (1) Centrifuge at 3000 rpm for 1 min at 4°C to pellet the beads and discard the supernatant.

[0302] (2) Wash the beads with 400 μl of Chip1 solution, Chip2 solution, Chip3 solution and TE solution respectively. When washing, add DTT (final concentration is 1 mM) to these four solutions.

[0303] The components and preparation methods of the Chip1 solution, Chip2 solution and Chip3 solution are shown in Table 3, Table 4 and Table 5 respectively.

[0304] Table 3 Composition and preparation method of Chip1 solution

[0305]

[0306]

[0307] Table 4 Composition and preparation method of Chip2 solution

[0308]

[0309] Table 5 Composition and preparation method of Chip3 solution

[0310]

[0311] 6. Proteinase K digestion

[0312] (1) Add 100 μl of elution buffer (0.5% SDS, 0.1 M NaHCO 3 and 5 μg proteinase K). The input samples should also undergo this step and subsequent treatments. The eluent should be prepared before use.

[0313] (2) Shake at 65°C on a molecular hybridization instrument overnight or for 6 hours.

[0314] 7. DNA purification, precipitation and dissolution

[0315] (1) Add 300 μL of phenol chloroform to each tube and shake vigorously until a white milky substance is visible. Centrifuge at 8000 rpm and 4°C for 3 min, remove the supernatant, and discard the beads. Repeat the extraction 2-3 times until no white milky substance appears and the supernatant is clear.

[0316] (2) Take the supernatant, add 100 μL of chloroform, shake vigorously, centrifuge at 8000 rpm, 4°C for 3 minutes, and take the supernatant.

[0317] (3) Add 300 μL (3 times the volume) of anhydrous ethanol, 10 μL (1 / 10 volume) of 3M NaOAc, and 0.3 μL (1 / 100 volume) of glycogen (20 mg / ml), and precipitate at -20°C for 30 min.

[0318] (4) Centrifuge at 12000 rpm for 10 min at room temperature.

[0319] (5) Discard the supernatant and wash the precipitate once with 70% ethanol.

[0320] (6) Centrifuge at 12,000 rpm for 10 min at room temperature. After absorbing as much ethanol as possible, air-dry the precipitate.

[0321] (7) Add 40 μl TE to dissolve the DNA.

[0322] 8. PCR reaction: The results of Chip can be reflected by Q-PCR experiment, or by ordinary PCR and then running DNA gel. Followed by fluorescence quantitative PCR (Q-PCR) experiment, Q-PCR primer sequence:

[0323] VISTA-chip-F:AAGTTCTTCCTCACTCCTCCC(SEQ ID NO:14)

[0324] VISTA-chip-R:CAGATATAAATCTGCCCTGCC(SEQ ID NO:15)

[0325] Experimental results: After overexpression of BRD4, BRD4 was able to bind to the promoter region of the VISTA gene to promote its transcription, and JQ1 significantly weakened the binding of BRD4 to the promoter region of VISTA ( Fig.21 ).

[0326] Example 5

[0327] Downstream substrates of VISTA

[0328] 1. Analysis of the data in the TCGA database revealed that MMP11 is also highly expressed in liver cancer ( Fig. 22 ), and VISTA was significantly correlated with MMP11 expression ( Fig.23 ).

[0329] Second, through immunofluorescence experiments (see Example 4 for specific steps), it can be seen that VISTA and MMP11 are co-localized ( Fig.24 )

[0330] 3. After knocking down VISTA or overexpressing VISTA in PLC-5 and Huh7 cell lines, protein immunoblotting experiments and Q-PCR experiments were performed (see Example 4 for specific steps).

[0331] Experimental results: After knocking down VISTA, the protein level and mRNA level of MMP11 were significantly reduced ( Fig.25 ); After overexpression of VISTA, the protein level and mRNA level of MMP11 were significantly increased ( Fig.26 ).

[0332] 4. After overexpressing VISTA, an immunofluorescence experiment was performed (see Example 4 for specific steps).

[0333] Experimental results: The expression level of MMP11 was significantly increased, and VISTA and MMP11 were co-localized in the nucleus ( Fig. 27 ).

[0334] 5. Detect BRD4, VISTA and MMP11 proteins in PLC-5 and Huh7 cell lines with stable BRD4 knockdown.

[0335] Experimental results: It was found that after BRD4 knockdown, the protein expressions of VISTA and MMP11 were significantly reduced ( Fig.28 ); however, after overexpression of BRD4, the protein expressions of VISTA and MMP11 were significantly increased ( Fig.29 ).

[0336] After overexpression of BRD4 in two liver cancer cell lines with stable knockdown of VISTA, the protein level of MMP11 ( Fig.30 ) and mRNA levels ( Fig.31 ) showed no significant recovery.

[0337] From the above examples, it can be concluded that BRD4 regulates the mRNA transcription of MMP11 by regulating the expression of VISTA, thereby affecting the occurrence and development of liver cancer. VISTA plays an important role in the occurrence and development of liver cancer and can be used as a marker for early diagnosis of liver cancer.

[0338] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of reagents for detecting VISTA gene expression in the preparation of products for early diagnosis / prognosis prediction of primary liver cancer.

2. The use according to claim 1, characterized in that: The product includes a chip or a kit.

3. Use of reagents for knocking down VISTA gene expression in the preparation of drugs for treating and / or preventing primary liver cancer.

4. Use of liver cancer cell lines with knockdown of VISTA gene expression in the preparation of drugs for the treatment and / or prevention of primary liver cancer.

5. Use of an agent for knocking down BRD4 gene expression in the preparation of a drug for treating and / or preventing primary liver cancer.

Images