Recombinant chondroitin 6-O-sulfotransferase mutant and application thereof in synthesis of chondroitin sulfate C

Abstract

The invention discloses a recombinant chondroitin 6-O-sulfotransferase mutant and application of the recombinant chondroitin 6-O-sulfotransferase mutant in synthesis of chondroitin sulfate C, and belongs to the technical field of bioengineering. According to the modification method, the optimal mutant is designed through rational protein engineering, the protein structure of the delta 106RnCHST3 is modified, the problem that the natural activity of 6-O-sulfonation of the wild type delta 106RnCHST3 is low is solved, the obtained optimal mutant delta 106RnCHST3F210R / Y310F / A209L / A303S / I173L successfully achieves the 24-hour sulfonation rate which can reach 46% and is improved by three times compared with that of the wild type, and industrialization of CSC preparation through biological enzyme is accelerated.

Description

Technical Field

[0001] The invention relates to a recombinant chondroitin 6-O-sulfotransferase mutant and application thereof in synthesizing chondroitin sulfate C, belonging to the technical field of bioengineering. Background Art

[0002] The structural feature of chondroitin sulfate C (CSC) is that the C-6 hydroxyl group of N-acetylgalactosamine is protonated and modified with a sulfonic acid group, and its disaccharide unit is composed of GlcAβ1-3GalNAc (6S). In terms of vascular diseases, chondroitin sulfate C exhibits anti-atherosclerotic, anti-coagulation, and anti-thrombotic properties; in terms of neural development, CS plays a major role in the process of neural signal transduction, can improve the activity of the central nervous system, and is beneficial to the development of the brain; in terms of osteoarthritis, it can be used as an important molecule for cartilage repair and regeneration, and can also act as an antioxidant and anti-inflammatory drug.

[0003] There are currently three ways to synthesize CSC: tissue extraction, chemical synthesis, and biosynthesis. (1) Tissue extraction is the main strategy for the current factory production of CSC. In industry, animal tissues are usually used as raw materials to extract CSC. This process involves a series of complex and lengthy steps, with defects such as cumbersome steps, high energy consumption, and easy introduction of viruses. (2) Chemical synthesis has the problem of limited CSC chain length and low molecular weight: Hsieh-Wilson et al. reported a method for synthesizing CSC tetrasaccharide, but this method has the problems of complex steps and harsh conditions. (3) The key limiting factor of the biosynthesis method is the low enzyme activity: Kang Zhen et al. expressed chondroitin 6-O-sulfotransferase in Pichia pastoris GS115 recombinant bacteria, and used the sulfotransferase secreted into the culture medium to catalyze the production of CSC. The enzyme activity was 0.20±0.01U / mg when chondroitin was used as a substrate. However, the low natural activity of chondroitin 6-O-sulfotransferase limits the development of biosynthesis of CSC. New methods are still needed to improve the sulfonation efficiency of chondroitin 6-O-sulfotransferase. Summary of the invention

[0004] The invention provides a recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant. Based on the chondroitin 6-O-sulfotransferase RnCHST3 (GenBank accession number EDL93054.1) from Norwegian rats (Rattus norvegicus), 106 amino acids are truncated at the N-terminus to obtain the recombinant chondroitin 6-O-sulfotransferase RnCHST as shown in SEQ ID NO.1.

[0005] In one embodiment, the mutant is obtained by mutating one or more of the amino acids at positions 143, 173, 209, 210, and 310 of the amino acid sequence as shown in SEQ ID NO.1.

[0006] In one embodiment of the present invention, the mutant is any one of the following (a) to (e):

[0007] (a) mutating the phenylalanine at position 210 of the chondroitin 6-O-sulfotransferase RnCHST3 shown in the amino acid sequence of SEQ ID NO.1 to arginine to obtain a mutant shown in SEQ ID NO.2, named M1;

[0008] (b) mutating the tyrosine at position 310 of the chondroitin 6-O-sulfotransferase RnCHST3 with the amino acid sequence shown in SEQ ID NO.2 to phenylalanine to obtain a mutant shown in SEQ ID NO.3, named M2;

[0009] (c) mutating the alanine at position 209 of the chondroitin 6-O-sulfotransferase RnCHST3 shown in the amino acid sequence of SEQ ID NO.3 to leucine to obtain a mutant shown in SEQ ID NO.4, named M3;

[0010] (d) mutating the alanine at position 303 of the chondroitin 6-O-sulfotransferase RnCHST3 shown in the amino acid sequence of SEQ ID NO.4 to serine to obtain a mutant shown in SEQ ID NO.5, named M4;

[0011] (e) The isoleucine at position 173 of the chondroitin 6-O-sulfotransferase RnCHST3 with the amino acid sequence shown in SEQ ID NO.5 was mutated to leucine to obtain a mutant shown in SEQ ID NO.6, named M5.

[0012] In one embodiment, the amino acid sequence of the recombinant chondroitin 6-O-sulfotransferase mutant is shown in any one of SEQ ID NOs. 1-6.

[0013] The present invention also provides a gene encoding the above-mentioned recombinant chondroitin 6-O-sulfotransferase mutant.

[0014] The invention also provides a recombinant vector carrying the gene.

[0015] In one embodiment, the recombinant vector uses pET-28a as an expression vector.

[0016] The present invention also provides a microbial cell carrying the above gene or the above recombinant vector.

[0017] In one embodiment, the microbial cell is a prokaryotic or eukaryotic expression host.

[0018] In one embodiment, the microbial cell uses Escherichia coli Rosetta (DE3) as an expression host.

[0019] The present invention also provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli expresses the recombinant chondroitin 6-O-sulfotransferase mutant.

[0020] In one embodiment, the recombinant Escherichia coli uses Escherichia coli Rosetta (DE3) as an expression host and pET-28a as an expression vector.

[0021] The present invention also provides a method for obtaining the above-mentioned recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, the method comprising the following steps:

[0022] (1) Determine the mutation site based on the amino acid sequence of recombinant chondroitin 6-O-sulfotransferase RnCHST3; design mutation primers, use the vector carrying the recombinant chondroitin 6-O-sulfotransferase RnCHST3 gene as a template for mutation; construct a plasmid vector for site mutation;

[0023] (2) transforming the site-mutated plasmid vector into host cells;

[0024] (3) Select positive clones for fermentation culture and purify chondroitin 6-O-sulfotransferase RnCHST3.

[0025] In one embodiment, the host cell is Escherichia coli.

[0026] The present invention also provides application of the recombinant Escherichia coli or the method in producing chondroitin sulfate or a product containing chondroitin sulfate.

[0027] The present invention also provides a method for preparing CSC, which comprises: adding the above-mentioned recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, or the above-mentioned microbial cell, or the above-mentioned crude enzyme or pure enzyme of recombinant Escherichia coli to a reaction system containing chondroitin and 3'-phosphoadenosine-5'-phosphosulfate to prepare the CSC.

[0028] In one embodiment, the final concentration of chondroitin in the reaction system is 5-20 g / L.

[0029] In one embodiment, the final concentration of the 3'-phosphoadenosine-5'-phosphosulfate in the reaction system is 5.1-20.4 g / L.

[0030] In one embodiment, the reaction conditions are: pH 6.5-8.5, 35-40° C., and 24-48 hours.

[0031] The present invention also provides the use of the above-mentioned recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant, or the above-mentioned gene, or the above-mentioned recombinant vector, or the above-mentioned recombinant cell, or the above-mentioned recombinant Escherichia coli in preparing CSC products.

[0032] Beneficial effects:

[0033] (1) The present invention provides a recombinant chondroitin 6-O-sulfotransferase RnCHST3 and its mutants for catalyzing the production of chondroitin sulfate C.

[0034] (2) The conversion rate of chondroitin 6-O sulfonation to chondroitin sulfate C by the recombinant chondroitin 6-O-sulfotransferase RnCHST3 mutant of the present invention is 3 times higher than that of the recombinant chondroitin 6-O-sulfotransferase RnCHST3. The sulfonation rate reaches 46% under the conditions of 37°C and pH 7.5 for 24 hours. The method of the present invention improves the production capacity of the unit catalyst and the reaction efficiency of the catalyst, reduces the cost of the reaction, and accelerates the industrialization process of producing chondroitin sulfate C by enzyme conversion. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the reaction formula for the generation of CSC by the 6-O-sulfonation of chondroitin catalyzed by RnCHST3.

[0036] Figure 2 is the 24h sulfonation rate of multiple mutants. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments, but the protection scope of the present invention is not limited to these embodiments.

[0038] Reagents and materials:

[0039] Prime STAR Max DNA polymerase, BamHI, HindIII, NdeI and XhoI endonucleases, DNA Marker and other enzyme reagents were purchased from TaKaRa (Dalian).

[0040] ClonExpress one-step directional cloning kit and gel recovery kit were purchased from Vazyme Biotech (Nanjing).

[0041] The plasmid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0042] Various analytical reagents were purchased from Sinopharm Group.

[0043] Culture medium:

[0044] LB medium (g / L): 5% yeast powder, 10% NaCl, and 10% peptone; dilute to the corresponding volume with deionized water, sterilize at 121°C for 20 min and set aside; about 2% agar powder should be added to the solid medium before sterilization.

[0045] TB culture medium (g / L): 4 g of glycerol, 24 g of yeast powder (Angel 802), 12 g of tryptone, 2.31 g of KH2PO4, and 16.42 g of K2HPO4·3H2O. Add deionized water to make up to the corresponding volume, sterilize at 121°C for 15-20 min, and set aside for use.

[0046] In vitro catalytic reaction of chondroitin sulfate 6-O-sulfotransferase:

[0047] Preparation of reaction solution: Use 20mmol / L Tris pH 7.5 prepared at 37°C as the reaction solvent, add crude enzyme solution prepared by crushing the bacteria with a final concentration of 20g / L, control the final concentration of dissolved chondroitin in the reaction solution to be 15g / L, and the final concentration of dissolved 3'-phosphoadenosine-5'-phosphosulfate to be 15.3g / L.

[0048] CSC detection method:

[0049] The sulfonation efficiency of CSC is defined as the ratio of the content of CSC disaccharide (Di-6S) to the total amount of Di-6S and chondroitin disaccharide (Di-0S). HPLC separation and detection were used to perform quantitative analysis by calculating the peak area ratio of Di-6S and Di-0S. Take 1 mL of fermentation broth, add 20 μL of 20 mg / mL chondroitin lyase ABC I, incubate at 37 ° C for 12 h to completely cleave it into disaccharides, inactivate the protein in a boiling water bath for 10 min, centrifuge at 12,000 × g for 20 min, remove impurities through a MW3000 ultrafiltration tube, and the purified disaccharides are filtered through a 0.22 μm filter membrane and then tested by HPLC.

[0050] HPLC detection conditions are:

[0051] A Pro Pac SAX-10 chromatographic column (specification: 4.0×250mm) was used, mobile phase A: 10mmol / L Tris (pH adjusted to 3.5 with dilute hydrochloric acid), mobile phase B: 10mmol / L Tris + 1mol / L sodium chloride solution (pH adjusted to 3.5 with dilute hydrochloric acid), flow rate was 1.0mL / min, detector was an ultraviolet detector, detection wavelength: 232nm, column temperature: 40℃, injection volume: 10μL, and gradient elution was adopted.

[0052] Table 1 Enzymatic liquid phase gradient elution table

[0053]

[0054] Calculation of sulfonation rate: The sulfonation efficiency of CSC was calculated according to the ratio of the content of CSC disaccharide (Di-6S) to the total amount of Di-6S and chondroitin disaccharide (Di-0S).

[0055] Example 1: Construction and expression of truncated Δ106RnCHST3

[0056] (1) GenBank accession number EDL93054.1 was submitted to Suzhou Jinweizhi Biotechnology Co., Ltd. for codon optimization and artificial synthesis. The synthesized nucleotide sequence as shown in SEQ ID NO.7 was connected and assembled between the BamH I and Hind III restriction sites on the pET28a(+) plasmid to obtain the pET28a(+)-RnCHST3 plasmid.

[0057] (2) Using the pET28a(+)-RnCHST3 constructed in step (1) as a template, primers for the Δ106RnCHST3 truncation with 106 amino acids truncated from the N-terminus were designed, F: CGGATCCGAATTCCTCGGTATCGCTCCGGCTATGGAAG; R: GAATTCGGATCCGCGACCCATTTGC; and the truncation was constructed by whole plasmid PCR.

[0058] Construct the PCR amplification system: 25 μL Prime STAR Max DNA polymerase, 1 μL each of the two primers for each truncation, 1 μL template (RnCHST3), 22 μL water; PCR reaction conditions are: ① 94℃ 3 min; ② 98℃ 10 s; ③ 58℃ 5 s; ④ 72℃ 10 s / kb; ⑤ cycle ② to ④ for 29 times; ⑥ 72℃ 5 min; ⑦ keep warm at 12℃. The above reaction system was incubated at 37°C for 1 hour to digest the plasmid template (the digestion system was: 1 μL DpnI, 44 μL PCR product of the above reaction, and 5 μL 10×T Buffer). After the digestion, the digestion product obtained was introduced into E. coli Rosetta competent cells by chemical transformation. The specific steps of the chemical transformation method were as follows: (1) 10 μL homologous recombination product was introduced into 100 μL E. coli Rosetta (DE3) competent cells; (2) ice bath for 10 minutes; (3) heat shock at 42°C water bath for 1 minute 30 seconds, and then quickly put into ice and stand in an ice bath for 4 minutes; (4) 600 μL non-resistant LB medium was added and mixed, and cultured at 37°C, 200 rpm for 1 hour; (5) centrifuged at 5000 rpm for 2 minutes to collect the bacteria; (6) the supernatant was removed, and the remaining 100-200 μL was mixed by pipetting and coated on an LB resistance plate containing 0.05 mg / mL kanamycin, and cultured at 37°C for about 12 hours. (7) Pick a single clone and place it in LB containing 0.05 mg / mL kanamycin resistance. After culturing at 200 rpm and 37°C for 12 h, send it to the company for sequencing. The one with correct sequencing is the positive transformant.

[0059] (3) The prepared genetically engineered bacteria E. coli Rosetta (DE3)-pET28a (+)-Δ106RnCHST3 and genetically engineered bacteria E. coli Rosetta (DE3)-pET28a (+)-RnCHST3 single colonies were inoculated into 30 mL of fresh LB medium containing Kan and Cm resistance, and cultured at 37°C with shaking for 10 h. The inoculum was transferred to 150 mL of TB medium (containing Kan and Cm resistance) at a 1% (v / v) inoculation volume and cultured at 37°C and 200 rpm until the OD 600 The pH value was 0.6-0.8, and IPTG with a final concentration of 60 mg / L was added for induction. The induction temperature was 16°C and the induction time was 18 hours. After the induction, centrifuge at 4°C, 8000 rpm for 5 minutes, wash the bacteria several times with PBS buffer, resuspend at 10 mg / mL, ultrasonically disrupt the bacteria for 10 minutes (power 100W, ultrasonic 2s, intermittent 1.5s), and high-speed refrigerated centrifuge at 4°C, 12000 rpm, 10 minutes. Take out the supernatant, which is the crude enzyme solution.

[0060] (4) In a 20mM Tris-HCl pH 7.5 system reaction, chondroitin with a final concentration of 15g / L and PAPS with a final concentration of 15.3g / L were added. At 37°C, the crude enzyme solution after bacterial crushing with a final concentration of 20g / L was used to catalyze the reaction for 24h. Take 1mL of fermentation broth, add 20μL of 20g / L chondroitin lyase ABC I, incubate at 37°C for 12h to completely cleave it into disaccharides, inactivate the protein in a boiling water bath for 10min, centrifuge at 12,000×g for 20min, pass through a MW3000 ultrafiltration tube to remove impurities, and the purified disaccharides are filtered through a 0.22μm filter membrane and then detected by HPLC. The results showed that compared with the original RnCHST3, the truncated Δ106RnCHST WT The catalytic efficiency was increased by 51%, and the sulfonation rate reached 11% within 24 hours.

[0061] Example 2: Construction of single and multiple mutants

[0062] (1) Construction of single mutants

[0063] Primers for the mutant site of RnCHST3 were designed as shown in Table 2. Mutant construction was performed by whole plasmid PCR (the whole plasmid used here was pET-28a(+) plasmid containing the wild-type gene Δ106RnCHST3).

[0064] Table 2 Mutant primer sequence list

[0065]

[0066] (2) Construction of PCR reaction system: PCR was performed according to the method of Example 1. The above reaction system was incubated at 37°C for 1 hour to digest the plasmid template (the digestion system was: 1 μL DpnI, 44 μL PCR product of the above reaction, and 5 μL 10×T Buffer). After the digestion, the digestion product obtained was introduced into E. coli Rosetta competent cells by chemical transformation. The specific steps of the chemical transformation method were as follows: (1) 10 μL homologous recombination product was introduced into 100 μL E. coli Rosetta (DE3) competent cells; (2) ice bath for 10 minutes; (3) heat shock in a 42°C water bath for 1 minute and 30 seconds, and then quickly put it in ice and let it stand in an ice bath for 4 minutes; (4) 600 μL non-resistant LB medium was added and mixed, and cultured at 37°C, 200 rpm for 1 hour; (5) centrifuged at 5000 rpm for 2 minutes to collect the bacteria; (6) the supernatant was removed, and the remaining 100-200 μL was mixed by pipetting and coated on an LB resistance plate containing 0.05 mg / mL kanamycin, and cultured at 37°C for about 12 hours. (7) Pick a single clone and place it in LB containing 0.05 mg / mL kanamycin resistance. After culturing at 200 rpm and 37°C for 12 h, send it to the company for sequencing. The one with correct sequencing is the positive transformant.

[0067] (3) Construction of multiple mutants: The construction method was the same as that of single mutants. The single mutant Δ106RnCHST3 obtained in the first round was used. F210R (The amino acid sequence is shown in SEQ ID NO.2), named Δ106RnCHST3 M1 (M1); Using M1 as a template, a second round of combination was performed to obtain Δ106RnCHST3 F210R / Y310F (The amino acid sequence is shown in SEQ ID NO.3), named Δ106RnCHST3 M2 (M2); M2 was then used as a template to perform combined mutations with the remaining sites to obtain the mutant Δ106RnCHST3 F210R / Y310F / A209L (The amino acid sequence is shown in SEQ ID NO.4), named Δ106RnCHST3 M3 (M3); M3 was then used as a template to perform combined mutations with the remaining sites to obtain the mutant Δ106RnCHST3 F210R / Y310F / A209L / A303S (The amino acid sequence is shown in SEQ ID NO.5), named Δ106RnCHST3 M4 (M4); M4 was used as a template to perform combined mutations to obtain the mutant Δ106RnCHST3 F210R / Y310F / A209L / A303S / I173L (The amino acid sequence is shown in SEQ ID NO.6), named Δ106RnCHST3 M5 (M5).

[0068] The recombinant strains E. coli Rosetta (DE3)-pET28a (+)-Δ106RnCHST3 were prepared respectively. M1 , E.coli Roset ta(DE3)-pET28a(+)-Δ106RnCHST3 M2 , E.coli Rosetta(DE3)-pET28a(+)-Δ106RnCHST3 M3 , E.coli Rosetta(DE3)-pET28a(+)-Δ106RnCHST3 M4 , E.coli Rosetta(DE3)-pET28a(+)-Δ106Rn CHST3 M5 .

[0069] Example 3: Determination of 24h Sulfonation Rate Performance Improvement of Mutants

[0070] In a 20mM Tris-HCl pH 7.5 system reaction, chondroitin with a final concentration of 15g / L and APS with a final concentration of 15.3g / L were added. At 37°C, the crude enzyme solution after the bacterial cells were crushed with a final concentration of 20g / L was used to catalyze the reaction for 24 hours. The preparation method of the crude enzyme solution was the same as that in Example 1. Take 1mL of fermentation broth, add 20μL of 20g / L chondroitin lyase ABC I (sigma-aldrich; product number: C2905), incubate at 37°C for 12h to completely cleave it into disaccharides, inactivate the protein in a boiling water bath for 10min, and centrifuge at 12,000×g for 20min. Then, impurities were removed by ultrafiltration tube of MW3000, and the purified disaccharides were filtered through a 0.22μm filter membrane and then detected by HPLC. Compare the conversion of chondroitin 6-O sulfonation catalyzed by the wild type and the five mutants for 24h. Figure 2 The results showed that the 24h sulfonation rate of the best five mutants M5 was 46%, which was 3 times higher than the sulfonation rate of the wild enzyme Δ106RnCHST3 (WT) (11%).

[0071] Table 3 Transformation rates of different mutants

[0072]

[0073] Example 4: Characterization of kinetic parameters of wild type and five mutants

[0074] In order to evaluate the mutants, the present invention determined the mutant wild type Δ106RnCHST3 and five mutants Δ106RnCHST3 M5 Kinetic parameters at 37°C.

[0075] The positive transformants of the recombinant strain containing M5 prepared in Example 2 were inoculated into LB medium and cultured at 37°C until OD 600 When the pH value is 0.6-0.8, IPTG with a final concentration of 60 mg / L is added to induce the expression of the enzyme, the induction temperature is 16°C, and the induction time is 18 hours to obtain a culture solution. The culture solution is centrifuged at 4°C and 8000 rpm for 5 minutes to collect the bacteria. The same operation is performed to obtain the wild enzyme.

[0076] Prepare a nickel ion affinity chromatography column. First, use a constant flow pump at 4°C to pump ultrapure water into the column to rinse the column (about 6 to 12 times the column volume), and then balance the column environment with 10 mL of binding solution A. When the pH value of the effluent at the bottom of the column is consistent with the pH value of the low-salt concentration buffer pumped into the column (about 5 times the column volume of buffer), add the obtained membrane-permeable crude enzyme solution to the column. First, rinse the impurities with binding solution A to the baseline equilibrium, and then elute with elution solution B (20mM sodium phosphate, 0.5mM NaCl, 500mM imidazole). Under this method, Δ106RnCHST3 and Δ106RnCHST3 were obtained. M5 of pure enzyme.

[0077] The kinetic parameters of the enzyme were determined by measuring the initial rate of the enzymatic reaction at different substrate concentrations for 60 min. cat / K m ), the catalytic constant of M5 for PAPS increased by 6 orders of magnitude, and the catalytic constant for chondroitin increased by 3 orders of magnitude.

[0078] Table 4 Kinetic parameter characterization

[0079]

[0080] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A chondroitin 6-O-sulfotransferase mutant, characterized in that The recombinant chondroitin 6-O-sulfotransferase is obtained by mutating one or more of the amino acids at positions 210, 310, 209, 143 and 173 of the recombinant chondroitin 6-O-sulfotransferase shown in SEQ ID NO.

1.

2. The chondroitin 6-O-sulfotransferase mutant according to claim 1, characterized in that Having any mutation from (a) to (e): (a) mutating the phenylalanine at position 210 to arginine; (b) mutating the tyrosine at position 310 to phenylalanine; (c) mutating alanine at position 209 to leucine; (d) mutating alanine at position 303 to serine; (e) The isoleucine at position 173 was mutated to leucine.

3. A gene encoding the chondroitin 6-O-sulfotransferase mutant according to claim 1 or 2.

4. A recombinant vector carrying the gene according to claim 3.

5. A microbial cell carrying the gene according to claim 3 or the recombinant vector according to claim 4.

6. A recombinant Escherichia coli, characterized in that The chondroitin 6-O-sulfotransferase mutant according to claim 1 or 2 is expressed.

7. The recombinant Escherichia coli according to claim 6, characterized in that Escherichia coli Rosetta (DE3) was used as the expression host and pET-28a was used as the expression vector.

8. A method for preparing chondroitin sulfate C, characterized in that: The chondroitin 6-O-sulfotransferase mutant according to claim 1 or 2, or the microbial cell according to claim 5, or the recombinant Escherichia coli according to claim 6 or 7 is added to a reaction system containing chondroitin and 3'-phosphoadenosine-5'-phosphosulfate to carry out the reaction.

9. The method according to claim 8, characterized in that React at pH 6.5-8.5 and 35-40°C for 24-48 hours.

10. Use of the chondroitin 6-O-sulfotransferase mutant according to claim 1 or 2, or the gene according to claim 3, or the recombinant vector according to claim 4, or the microbial cell according to claim 5, or the recombinant Escherichia coli according to any one of claims 6 to 7, or the method according to any one of claims 8 to 9 in the preparation of chondroitin sulfate C or a product containing chondroitin sulfate C.

Images