Application of soybean GmCLO1 coding gene in regulating resistance of soybean to soybean mosaic virus disease

Abstract

The invention discloses an application of a soybean GmCLO1 coding gene in regulating the resistance of soybeans to soybean mosaic virus diseases. The invention discloses application of the soybean GmCLO1 gene as shown in SEQ ID NO.1 in genetic engineering modification of soybean mosaic virus resistance. Overexpression of the gene can significantly improve the resistance of soybeans to soybean mosaic virus diseases, and gene editing knockout of the gene can significantly reduce the resistance of soybeans to soybean mosaic virus diseases. The soybean coding gene GmCLO1 disclosed by the invention can be transformed into soybeans through genetic engineering, and the resistance of the soybeans to the soybean mosaic virus diseases is finally regulated and controlled.

Description

Technical Field

[0001] The invention relates to the application of soybean calcooleosin GmCLO1 encoding gene, and belongs to the field of genetic engineering. Specifically, the soybean calcooleosin GmCLO1 gene is overexpressed in soybean to increase resistance to soybean mosaic virus. Background Art

[0002] Soybean mosaic virus disease is a serious disease caused by soybean mosaic virus (SMV). Soybeans infected with SMV show symptoms such as mosaic leaves, curled leaves, deformed and wrinkled leaves, brown spotted seeds, deformed pods, reduced number of pods per plant, reduced plant height, reduced branches, and delayed growth. Soybean resistance to SMV is divided into two types: resistance to infection and resistance to spread. Resistance to infection belongs to quality resistance or vertical resistance, which is an extreme resistance. The pathogen cannot infect the host. If a single resistant material is planted for a long time, after a period of time, the resistant material will have a greater selection pressure on the physiological subspecies of the pathogen, and the physiological subspecies will mutate, producing more and more dominant subspecies, turning the original resistant material into susceptible material. There is a lack of resistant material to the newly mutated subspecies or strains, resulting in loss of field resistance. Resistance to expansion belongs to quantitative resistance or horizontal resistance, which means that the pathogen can successfully infect the host and establish a parasitic relationship, but the host can produce a defensive response to the pathogen, secrete antitoxins or the host can inhibit the replication and spread of the pathogen, reduce the reproduction of the pathogen, and reduce the harm. Varieties with quantitative resistance do not cause selection pressure on pathogens, do not lose grains due to loss of resistance, and can achieve satisfactory yields even in the case of a major outbreak of the disease. At present, discovering disease-resistant genes related to the two resistance mechanisms is crucial to improving soybean resistance to SMV and breeding disease-resistant varieties.

[0003] In the early stage, by analyzing the SMV-induced soybean transcriptome, it was found that GmCLO1 strongly responded to the induction of soybean mosaic virus SC7 strain. GmCLO1 belongs to the soybean caleosins gene family, and the encoded amino acid sequence contains a conserved caleosin domain. Caleosins are proteins associated with oil bodies and can be detected in plant seeds and vegetative tissues. Caleosins affect lipid metabolism and oil body stability. Using RNA interference technology to reduce the content of a 24-kilodalton caleosin in soybean seed oil bodies, the content of other caleosins increased. In the seed embryos of Arabidopsis AtCLO1 mutants, the decomposition of storage lipids was delayed, the vacuolar morphology was changed, the vacuolar membrane was abnormal, and the interaction between vacuoles was reduced. AtCLO3 is a leaf caleosin isoform with calcium-dependent protein kinase activity, which strongly responds to abiotic stresses such as drought, high salinity and ABA, suggesting that AtCLO3 may be involved in the signal transduction of these abiotic stresses. The rice caleosin gene OsCLO5 negatively regulates cold tolerance through the JA signaling pathway. Whether GmCLO1 in soybean is resistant to soybean mosaic virus has not been reported. Summary of the invention

[0004] The purpose of the present invention is to disclose the disease resistance genetic engineering application of soybean calcooleosome protein GmCLO1. The GmCLO1 gene responds to soybean SMV induction and overexpression in soybean increases soybean resistance to SMV.

[0005] The GmCLO1 gene can be introduced into soybean as a target gene to regulate soybean resistance to SMV.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] Application of soybean calcooleosomal protein gene GmCLO1 in regulating soybean resistance to SMV. The soybean calcooleosomal protein gene GmCLO1 has a nucleotide sequence as shown in SEQ ID NO.1 and an amino acid sequence as shown in SEQ ID NO.2.

[0008] The application is preferably to overexpress GmCLO1 in soybean to reduce the accumulation of SMV in soybean. When using GmCLO1 to construct a plant overexpression vector or an interference vector, any enhanced promoter or inducible promoter can be added before its transcription start nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, luciferase gene, etc.) to the plant. From the perspective of the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be screened by adversity.

[0009] After soybeans are transformed by genetic engineering, the soybean calcooleosin gene GmCLO1 of the present invention is overexpressed to reduce the SMV content in soybeans; after the gene is knocked out by CRISPR, the SMV biomass increases.

[0010] The plant overexpression vector and knockout vector carrying GmCLO1 of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, DNA direct transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc., and the transformed plant tissues can be cultivated into plants.

[0011] Beneficial Effects

[0012] Soybean GmCLO1 is a gene encoding caleosin, which contains a conserved Caleosin domain and belongs to the soybean caleosin gene family. In soybean, we found that the expression of GmCLO1 was induced by soybean mosaic virus infection. The expression of GmCLO1 was significantly increased in the overexpression material, increasing the resistance of transgenic soybean to SMV. In the knockout mutant, the coding sequence of the GmCLO1 gene was deleted by 41 bases, reducing the resistance of transgenic soybean to SMV. Therefore, GmCLO1 can be used to modify soybean resistance to SMV. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The GmCLO1 gene was induced in response to soybean mosaic virus SC7. *, **, *** indicate significant differences at the 0.05, 0.01, and 0.001 levels, respectively.

[0014] Figure 2 Relative expression of GmCLO1 gene in overexpressed transgenic soybean. Jack is wild type, OE-5 and OE-22 represent two GmCLO1 overexpressed transgenic soybean lines, three biological means ± standard error (SE), ** indicates significant at 0.01 level.

[0015] Figure 3 The test results of GmCLO1 gene overexpression transgenic soybean Bar test strips. A. The test results of GmCLO1 overexpression transgenic soybean line OE-5, B. The test results of GmCLO1 overexpression transgenic soybean line OE-22. The first one on the left of the two groups of pictures is the control Jack, and the rest are GmCLO1 overexpression transgenic soybeans

[0016] Figure 4 DNA sequencing results of the target site of GmCLO1 knockout transgenic soybean. Jack is wild type, KO-2 is GmCLO1 knockout transgenic soybean, and the sequencing peak is a single peak.

[0017] Figure 5 .Leaves of GmCLO1-overexpressing transgenic soybeans inoculated with SMV-SC7 strain 21 days after inoculation. PBS is the control, 0.01 mol / L phosphate buffer was applied, SC7 is inoculated with SMV SC7 strain, and the legend is 1 cm.

[0018] Figure 6 .Determination of SMV virus CP protein gene expression in GmCLO1 overexpression and knockout lines. Jack is the wild type, OE-5 and OE-22 represent two GmCLO1 overexpression transgenic soybean lines. qRT-PCR was used to detect the expression of SMV virus CP gene. Three biological means ± standard error (SE), * and ** indicate significance at the 0.05 and 0.01 levels, respectively. DETAILED DESCRIPTION

[0019] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0020] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0021] Example 1 Induced expression of the GmCLO1 gene in response to soybean mosaic virus SC7 strain

[0022] The susceptible variety Nannong 1138-2 and the disease-resistant variety Kefeng No. 1 were planted and inoculated with the SC7 strain of soybean mosaic virus at the true leaf stage. Soybean leaf tissues were collected at 0h, 2h, 8h, and 24h after inoculation, ground with a mortar, added to a 1.5mL EP tube containing lysis solution, and after sufficient shaking, transferred to a new 1.5mL EP tube, and the total RNA of the leaves was extracted using a total RNA extraction kit (Tiangen Biochemical Technology Co., Ltd.). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by a spectrophotometer. GmTubulin, which is constitutively expressed in soybean, was used as an internal reference, and the obtained total RNA was used as a template. The reverse transcription kit (TaKaRa Primer Script TM RT reagent kit, Japan) was used for reverse transcription to obtain the first-chain cDNA, and then real-time RT-PCR was performed to detect the expression changes of GmCLO1 gene at different time points after the two varieties were inoculated with the virus. It was found that GmCLO1 gene strongly responded to the induction of soybean mosaic virus SC7 strain at each time point in both varieties, and the response was stronger in Kefeng No. 1 ( Figure 1). The primer sequences of GmTubulin gene were F: ggagttcacagaggcagag and R: cacttacgcatcacatagc, and the primer sequences of GmCLO1 gene were F: ttttgctgtccgttggaggt and R: tgtttgccgcgttggatatt.

[0023] Example 2 Genetic Engineering Application of Gene GmCLO1

[0024] 1) Cloning of soybean GmCLO1

[0025] The soybean reference genome Wm82.a2.v1 in the Phytozome v13 database was used as the Glyma.09g123800

[0026] The mRNA sequence of the (GmCLO1) gene was used as a template to design specific primers, and PCR amplification was performed using the cDNA obtained above as a template. The PCR program was as follows: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 15 seconds, 58°C annealing for 15 seconds, 72°C extension for 40 seconds, a total of 35 cycles, and finally 72°C incubation for 5 minutes. The PCR product was cloned into the PUC19-T vector, and the CDS sequence of the soybean GmCLO1 gene with a length of 615 bp with a complete coding region was obtained after sequencing. The coding region sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The primer sequences for amplifying the gene are F: atggcttcttcaccttcctcag and R: ctacttctctttgcctgaagagtg.

[0027] 2) Construction of plant expression vector

[0028] The GmCLO1 gene sequence was PCR amplified from the PUC19-T recombinant vector, and GmCLO1 was connected to the pBA002 vector by recombination to obtain the pBA002-CLO1 plant overexpression vector. The primer sequences were F: ccgggcccaggcctacgcgtatggcttcttcaccttcctcag and R: cgatcggggaaattcgagctcctacttctctttgcctgaagagtg. The plant transformation vector pBA002 contains a 2×35S strong promoter, which can strongly promote the expression of the target gene GmCLO1 in the recipient. Then the pBA002-GmCLO1 vector was transferred into the Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method, and soybean was transformed using the soybean cotyledon node transformation method mediated by Agrobacterium tumefaciens.

[0029] According to the website CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ), sgRNAs for two targeting sites of the GmCLO1 gene were designed, sgRNA1: ggagagaaacccattccact and sgRNA2: gttgcgtgaaatcgggactg. The two sgRNAs were connected to the pSC-M vector, and the recombinant vector was transformed into Escherichia coli. The single clones were plated and tested and sequenced to obtain the correct two sgRNA sequences, indicating that the recombinant vector pSC-M-CLO1 was successfully constructed. Then the vector was transferred into the Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method, and the soybean cotyledon node transformation method mediated by Agrobacterium tumefaciens was used to transform soybean.

[0030] 3) Phenotypic identification

[0031] Two GmCLO1 overexpressing transgenic soybean lines were obtained, named OE-5 and OE-22, and one GmCLO1 knockout line KO2 (knockout 2) was obtained.

[0032] GmCLO1 gene overexpressing transgenic soybeans were planted in a constant temperature and light incubator. Leaves were taken after 20 days, frozen in liquid nitrogen and stored at -80°C. Total RNA extraction, reverse transcription and fluorescence quantitative PCR reaction were the same as in 1) to detect the changes in the expression of GmCLO1 gene in transgenic soybeans. Figure 2 It can be seen that the expression level of GmCLO1 in the overexpressed transgenic soybean is significantly higher than that in the wild type (JACK). The expression level of the GmCLO1 gene was detected by Bar test strips. The results are as follows Figure 3 shown.

[0033] Using the GmCLO1 gene cloning primers in 1), the positive seedlings of GmCLO1 knockout transgenic soybean were detected by PCR product sequencing. The sequencing results of all KO2 plants were single peaks, indicating that the material was homozygous. Compared with the wild-type Jack, the KO2 strain had a 1-base deletion at the first target site and a 40-base deletion at the second target site ( Figure 4 ).

[0034] After the first pair of true leaves unfolded, wild-type Jack, overexpression lines (OE-5 and OE-22), and knockout KO2 lines were inoculated with SMV-SC7 virus. Disease was observed 21 days after virus inoculation. The leaves of the control plant WT showed obvious wrinkling, and the leaves of the overexpression lines showed mild mosaic symptoms. Compared with the wild-type WT, the inoculated leaves on KO2 showed more severe curling and mosaic symptoms ( Figure 5). Analysis of the expression of the viral CP gene found that the expression of the SMV-CP gene in the two overexpression strains was significantly lower than that in the wild type, and the expression of the viral CP gene in the KO2 mutant was significantly higher than that in the wild type ( Figure 6 ). The above results showed that the KO2 mutant was more susceptible to disease than the wild type WT, and overexpression of the GmCLO1 gene reduced the accumulation of soybean mosaic virus and improved the resistance of soybean to SMV-SC7. The primer sequences of the CP gene were F: cagatgggcgtggttatga and R: acaatgggtttcagcggata.

Claims

1. Application of soybean GmCLO1 gene in genetic engineering regulation of soybean resistance to soybean mosaic virus disease.

2. Application of overexpressed soybean GmCLO1 gene in constructing soybean varieties with resistance to soybean mosaic virus disease, wherein the coding region sequence of the soybean GmCLO1 gene is shown in SEQ ID NO.1.

Images